O-type foot-and-mouth disease virus monoclonal antibody and application thereof

By using a double-antibody sandwich ELISA method and specific monoclonal antibodies, the problem of accurately quantifying the content of type O foot-and-mouth disease virus protein in mixtures of multiple proteins in existing technologies has been solved, achieving highly sensitive detection of vaccine semi-finished and finished products and meeting the needs of product quality testing.

CN116023476BActive Publication Date: 2026-03-24LUOYANG PULIKE WANTAI BIOTECH
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202111253130.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-10-27
Publication Date
2026-03-24
Estimated Expiration
2041-10-27

AI Technical Summary

Technical Problem

Existing protein quantification methods cannot accurately distinguish the content of type O foot-and-mouth disease virus protein in mixtures of multiple proteins, especially in semi-finished and finished vaccines, and cannot meet the needs of product quality testing.

Method used

A double-antibody sandwich ELISA method based on monoclonal antibody technology was developed, using a monoclonal antibody that specifically binds to type SEA foot-and-mouth disease virus (FMDV) O, to develop a double-antibody sandwich detection kit that can detect the protein content of type O FMDV with high sensitivity and specificity.

Benefits of technology

It enables accurate quantitative detection of type O foot-and-mouth disease virus protein in mixtures of multiple proteins, and is suitable for quality control of vaccine semi-finished and finished products, improving the accuracy and sensitivity of detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116023476B_ABST
    Figure CN116023476B_ABST
Patent Text Reader

Abstract

The application provides a monoclonal antibody 4E3 and a monoclonal antibody 4D5 which specifically bind to a SEA type O foot-and-mouth disease virus, and a double-antibody sandwich kit with the monoclonal antibody 4E3 as a coating antibody and the monoclonal antibody 4D5 as an enzyme-labeled antibody; the kit can quantitatively detect the content of the SEA type O foot-and-mouth disease virus-like particles, and can detect the content of the SEA type O foot-and-mouth disease virus-like particles in a single vaccine, a multivalent vaccine or a combined vaccine; and can quantitatively detect the content of antigens in a semi-finished vaccine or a finished vaccine.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to O-type foot-and-mouth disease virus monoclonal antibody, in particular SEA-type O-type foot-and-mouth disease virus monoclonal antibody, hybridoma cells secreting the monoclonal antibody, and double antibody sandwich detection reagent kit and application containing monoclonal antibody pair, belong to the field of biotechnology. BACKGROUND

[0002] Foot-and-mouth disease is a fever, acute, highly contagious disease of cloven-hoofed animals caused by foot-and-mouth disease virus infection. The disease spreads rapidly, with a high incidence, and the outbreak and prevalence of the disease have brought huge economic losses to the global livestock industry. The World Organization for Animal Health (OIE) and the Food and Agriculture Organization of the United Nations (FAO) have listed it as the first A-class virulent infectious disease, and China has listed it as the first infectious disease.

[0003] There are 7 serotypes of foot-and-mouth disease virus (A, O, C, Asia I, SAT1, SAT2 and SAT3), which are prone to variation, and there is no cross-immune protection between types. Among them, O-type foot-and-mouth disease virus and A-type foot-and-mouth disease virus are mainly prevalent in China. Vaccination is an effective measure to control the disease and protect livestock from harm. At present, the vaccines used to prevent foot-and-mouth disease are mainly whole virus inactivated vaccine and synthetic peptide vaccine, but the whole virus inactivated vaccine has biological safety risk. Virus-like particles (VLPs) are a kind of virus-like particles that can self-package into virus shell structure when expressed in vitro and / or in vivo. They are pseudo-viruses with similar shell structure of viruses but without virus replication ability. VLPs vaccine can effectively stimulate the body to produce anti-infection and anti-tumor immunity, and the vaccine designed based on virus-like particles is a relatively ideal vaccine form. Therefore, safe and effective subunit vaccines based on virus-like particles are the current research hotspot.

[0004] At present, the prevalent strains of foot-and-mouth disease O-type are mainly two topological types of SEA-type and CATHAY-type, therefore, the research and development of foot-and-mouth disease O-type virus-like particle subunit vaccine is also mainly based on the above topological types, and the key technical points in research and development, production are how to accurately quantify the protein content in the subunit vaccine semi-finished product and finished product testing, especially how to identify the protein of each protein after mixing.

[0005] At present, the commonly used protein quantification methods are BCA method, Bradford method or Lowry method, but only for protein quantification, and cannot distinguish the content of different proteins after mixing multiple proteins.

[0006] Therefore, there is an urgent need for a method for quantitatively detecting the content of foot-and-mouth disease virus O protein, which can not only detect the content of foot-and-mouth disease virus O protein, but also detect the content of foot-and-mouth disease virus O protein from a variety of protein mixtures; and there is also a need to detect the antigen content in semi-finished vaccine and finished vaccine at the same time to meet the needs of product quality detection. SUMMARY

[0007] The double antibody sandwich ELISA method based on the monoclonal antibody technology can specifically detect different proteins, and can accurately and effectively quantify the protein content, thereby providing support for the research and development of virus subunit vaccine. In order to solve the problems of the prior art, the present application provides a pair of monoclonal antibodies capable of specifically binding to foot-and-mouth disease virus O, and a double antibody sandwich detection kit containing the monoclonal antibody pair and its application.

[0008] The present application relates to a monoclonal antibody specifically binding to SEA type O foot-and-mouth disease virus-like particles.

[0009] The present application also relates to a kit for detecting SEA type O foot-and-mouth disease virus-like particles with high sensitivity, good specificity and good repeatability.

[0010] The present application also relates to a kit for detecting SEA type O foot-and-mouth disease virus-like particles with a long shelf life.

[0011] The present application also relates to a single-chain antibody capable of having good reaction characteristics with SEA type O foot-and-mouth disease virus-like particles.

[0012] The present application relates to a kit capable of detecting the content of foot-and-mouth disease virus O protein.

[0013] The present application relates to a kit capable of detecting the content of foot-and-mouth disease virus O protein from a variety of protein mixtures.

[0014] The present application relates to a kit capable of detecting the content of foot-and-mouth disease virus O protein in semi-finished vaccine and finished vaccine. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 For the standard curve of the kit of the present application for detecting SEA type O virus-like particle standard, it is shown that the standard has a good linear relationship in the range of 3.9 μg / ml to 500 μg / ml, R 2 > 0.99; the detection sensitivity is 3.9 μg / ml. DETAILED DESCRIPTION

[0016] DEFINITIONS

[0017] "Foot-and-mouth disease virus" belongs to the family of small RNA viruses, aphthovirus genus, the virus has O, A, C, SAT1, SAT2, SAT3 (i.e. South African foot-and-mouth disease virus 1, 2, 3 type) and Asia1 (Asia 1 type) 7 serotypes, there is no cross protection between each type, and there are multiple subtypes within each type. In the center of the virus is a single-stranded positive-strand RNA consisting of about 8000 bases, which is the basis of infection and inheritance; the surrounding protein determines the antigenicity, immunity and serological response ability of the virus; the virus shell is a symmetrical icosahedron. Foot-and-mouth disease virus is the pathogen of highly contagious disease of odd-toed animals-foot-and-mouth disease. The international animal epidemic bureau lists foot-and-mouth disease as the first in the "A class animal infectious disease list", and China lists it as "imported animal quarantine class infectious disease". The prevention and control of foot-and-mouth disease in our country, the prevention is mainly through vaccine injection inoculation, and the animals with foot-and-mouth disease are killed.

[0018] The term "virus-like particles (VLPs)" is a particle assembled by one or more viral structural proteins, which has similar external structure and antigenicity to virus particles, but does not contain viral genes.

[0019] The term "SEA type O foot-and-mouth disease virus-like particles" is a virus-like particle assembled by structural proteins encoded by O foot-and-mouth disease virus SEA type gene sequence, and the specific preparation can be referred to Chinese patent CN111840533A, but is not limited thereto.

[0020] The term "monoclonal antibody" refers to an antibody produced by a single clone of B cells, highly uniform, directed only to a specific epitope of an antigen, obtained from a population of antibodies which are essentially homogeneous, i.e. the individual antibodies making up the population are identical except for possible naturally-occurring mutations that might arise during production. Thus, the modifier "monoclonal" indicates the character of the antibody as not being an accidental mixture of discrete antibodies. Preferably, the monoclonal antibody includes monovalent or single chain antibodies, diabodies, chimeric antibodies, humanized antibodies, and derivatives, functional equivalents and homologues of the above, as well as antibody fragments and any polypeptide containing an antigen binding domain. An antibody is any specific binding member having a binding domain with the desired specificity, and thus this term encompasses antibody fragments, derivatives, humanized antibodies and functional equivalents and homologues of antibodies, as well as any polypeptide containing an antigen binding domain, whether naturally occurring or synthetically produced. Examples of antibodies are immunoglobulin isotypes (such as IgG, IgE, IgM, IgD and IgA) and subtypes thereof; also fragments containing an antigen binding domain such as Fab, scFv, Fv, dAb, Fd; and diabodies. Chimeric molecules or equivalents containing an antigen binding domain fused to another polypeptide are also included. Cloning and expression of chimeric antibodies is described in EP.A. 0 120 694 and EP.A. 0 125 023. Antibodies can be modified in many ways, and other antibodies or chimeric molecules retaining the specificity of the original antibody can be produced using DNA recombination techniques. Such techniques can involve introducing DNA encoding the variable region or complementarity determining regions (CDRs) of an antibody into the constant region or constant region plus framework region of a different immunoglobulin, see EP.A. 0 841 87, GB 2188638A or EP.A. 0 239 400. Hybridoma cells or other cells producing antibodies can also be genetically mutated or otherwise altered, which can or can not alter the binding specificity of the antibody produced. "Monoclonal antibodies" for use in the present application can also be produced using hybridoma methods, since DNA sequences encoding the murinized antibodies of the present application can be artificially synthesized from the amino acid sequences disclosed herein or obtained by PCR amplification using methods well known to those skilled in the art, and thus can be incorporated into suitable expression vectors using a variety of methods well known in the art. Finally, the resulting host cells are cultured under conditions suitable for expression of the antibodies of the present application, and the monoclonal antibodies of the present application are purified using methods well known to those skilled in the art. Antibodies comprise a geometry of polypeptide chains, linked together by disulfide bridges, two polypeptide backbones called light and heavy chains, which make up all the major classes (isotypes) of antibodies. Both the heavy and light chains are further divisible into subregions called variable and constant regions.The heavy chains comprise a single variable region and three different constant regions, while the light chains comprise a single variable region (different from that of the heavy chains) and a single constant region (different from that of the heavy chains). The variable regions of the heavy and light chains are responsible for the binding specificity of the antibody.

[0021] The term "heavy chain variable region" refers to a polypeptide of 110 to 125 amino acids in length, whose amino acid sequence corresponds to the heavy chain amino acid sequence of the monoclonal antibody of the present application starting from the N-terminal amino acid of the heavy chain. The term "light chain variable region" refers to a polypeptide of 95 to 115 amino acids in length, whose amino acid sequence corresponds to the light chain amino acid sequence of the monoclonal antibody of the present application starting from the N-terminal amino acid of the light chain. It is apparent to those skilled in the art that, based on the heavy chain variable region and light chain variable region amino acid sequences of the specifically disclosed monoclonal antibodies of the present application, one or more amino acid additions, deletions, substitutions, etc. can be made by conventional genetic engineering and protein engineering methods to obtain conservative variants, while still being able to maintain specific binding to canine rotavirus. The monoclonal antibodies of the present application also include active fragments or conservative variants thereof.

[0022] The term "conservative variant" refers to a variant that substantially retains the properties of its parent, such as the basic immunological biological, structural, regulatory, or biochemical properties. Generally, the amino acid sequence of a conservative variant of a polypeptide differs from that of the parent polypeptide, but the differences are limited so that the sequence of the conservative variant is overall very similar to, and in many regions identical with, the sequence of the parent polypeptide. The differences in the amino acid sequences of the conservative variant and the parent polypeptide can be, for example, substitutions, additions, and deletions of one or more amino acid residues and any combination thereof. The substituted or inserted amino acid residues can or can not be encoded by the genetic code. The conservative variant of a polypeptide can be naturally occurring or it can be a non-naturally occurring variant. The non-naturally occurring conservative variant of a polypeptide can be produced by mutagenesis techniques or direct synthesis.

[0023] The term "genetically engineered antibody" or "recombinant antibody" refers to an antibody molecule expressed by a suitable recipient cell after the gene encoding the antibody has been processed, modified, and reassembled according to different needs using recombinant DNA and protein engineering techniques.

[0024] The term "single chain antibody fragment" (scFv) refers to an antibody formed by linking the variable region of the heavy chain and the variable region of the light chain through a short peptide (linker) of 15 to 20 amino acids.

[0025] The term "chimeric monoclonal antibody" refers to an antibody in which the constant region of a mouse is replaced by the constant region of a human, the variable region sequence of the mouse monoclonal antibody is retained, forming a human-mouse hybrid antibody. Its development process is fast, and it can greatly reduce the immunogenicity of heterologous antibodies, while almost maintaining all the specificity and affinity of the parent mouse monoclonal antibody.

[0026] The term "degenerate sequence" in molecular biology refers to the phenomenon that the same amino acid has two or more codons, which is called the degeneracy of codons. Such sequences are called degenerate sequences.

[0027] The term "semi-finished product" refers to inactivated virus (bacteria) liquid or attenuated vaccine harvested virus (bacteria) liquid or genetically engineered expressed protein.

[0028] The term "finished product" refers to a product prepared by mixing the semi-finished product with the adjuvant according to the production steps. DETAILED DESCRIPTION

[0030] The present application relates to a monoclonal antibody 4E3 which specifically binds to SEA type O foot-and-mouth disease virus, wherein the heavy chain variable region of the monoclonal antibody 4E3 is encoded by SEQ. ID No. 1 or a degenerate sequence thereof; and the light chain variable region of the monoclonal antibody 4E3 is encoded by SEQ. ID No. 2 or a degenerate sequence thereof.

[0031] The present application relates to an antibody or an antibody fragment which specifically binds to SEA type O foot-and-mouth disease virus, wherein the heavy chain variable region of the antibody or the antibody fragment is encoded by SEQ. ID No. 1 or a degenerate sequence thereof, and the light chain variable region of the antibody or the antibody fragment is encoded by SEQ. ID No. 2 or a degenerate sequence thereof; the antibody is a monoclonal antibody, a genetically engineered antibody; wherein the genetically engineered antibody includes a single-chain antibody, a chimeric monoclonal antibody, and a modified monoclonal antibody; and the antibody or the antibody fragment specifically binds to a SEA type O foot-and-mouth disease virus-like particle.

[0032] As an embodiment of the present application, the antibody is a monoclonal antibody 4E3, the heavy chain variable region of the monoclonal antibody 4E3 is encoded by SEQ. ID No. 1 or a degenerate sequence thereof, and the light chain variable region of the monoclonal antibody 4E3 is encoded by SEQ. ID No. 2 or a degenerate sequence thereof.

[0033] As an embodiment of the present application, the monoclonal antibody is a monoclonal antibody 4E3, wherein the heavy chain variable region of the monoclonal antibody 4E3 is encoded by SEQ. ID No. 1, and the light chain variable region of the monoclonal antibody 4E3 is encoded by SEQ. ID No. 2.

[0034] The SEA type O foot-and-mouth disease virus monoclonal antibody 4E3 of the application is screened after immunization with a SEA type O foot-and-mouth disease virus-like particle, and the ELISA titer is 1:8192.

[0035] The application relates to a hybridoma cell 4E3 strain which secretes the monoclonal antibody 4E3.

[0036] The application relates to an antibody or an antibody fragment which specifically binds to a SEA type O foot-and-mouth disease virus, wherein the heavy chain variable region of the antibody or the antibody fragment is encoded by SEQ.ID No.3 or a degenerate sequence thereof, and the light chain variable region of the antibody or the antibody fragment is encoded by SEQ.ID No.4 or a degenerate sequence thereof.

[0037] As an embodiment of the application, the antibody is a monoclonal antibody 4D5, wherein the heavy chain variable region of the monoclonal antibody 4D5 is encoded by SEQ.ID No.3 or a degenerate sequence thereof, and the light chain variable region of the monoclonal antibody 4D5 is encoded by SEQ.ID No.4 or a degenerate sequence thereof.

[0038] The SEA type O foot-and-mouth disease virus monoclonal antibody 4D5 of the application is screened after immunization with a SEA type O foot-and-mouth disease virus-like particle, and the ELISA titer is 1:5760.

[0039] The application relates to a hybridoma cell 4D5 strain which secretes the monoclonal antibody 4D5.

[0040] The hybridoma cell 4E3 strain and the hybridoma cell 4D5 strain can effectively secrete the monoclonal antibody 4E3 strain and the monoclonal antibody 4D5 strain respectively, and the monoclonal antibody 4E3 strain and the monoclonal antibody 4D5 strain have high purity.

[0041] The application also relates to the application of the antibody or the antibody fragment or the monoclonal antibody, and the application is epitope identification research and SEA type O foot-and-mouth disease virus antigen reactivity research.

[0042] The present application relates to a kit for detecting antigens of SEA type O foot-and-mouth disease virus, wherein the kit comprises: a support medium coated with the monoclonal antibody 4E3, the support medium being blocked with a blocking solution after being coated with the monoclonal antibody 4E3, and the enzyme-labeled monoclonal antibody 4D5; or a support medium coated with the monoclonal antibody 4D5, the support medium being blocked with a blocking solution after being coated with the monoclonal antibody 4D5, and the enzyme-labeled monoclonal antibody 4E3; or a support medium coated with the monoclonal antibody 2A7, the support medium being blocked with a blocking solution after being coated with the monoclonal antibody 2A7, and the enzyme-labeled monoclonal antibody 4E3; or a support medium coated with the monoclonal antibody 2A7, the support medium being blocked with a blocking solution after being coated with the monoclonal antibody 2A7, and the enzyme-labeled monoclonal antibody 4D5; 20x concentrated washing solution, which is a 0.1M PBS solution containing 10% v / v Tween 20, pH 7.4; a standard, which is a SEA type O foot-and-mouth disease virus-like particle; a color developing solution, which comprises color developing solution A and color developing solution B, the color developing solution A being an aqueous solution containing 14.7g / L disodium hydrogen phosphate, 9.3g / L citric acid, and 0.3g / L urea peroxide, and the color developing solution B being an aqueous solution containing 0.2g / L tetramethyl benzidine (TMB) and 10% v / wv anhydrous ethanol; and a stop solution, which is a 2M H2SO4 solution.

[0043] As an embodiment of the present application, the kit comprises: a support medium coated with the monoclonal antibody 4E3, the support medium being blocked with a blocking solution after being coated with the monoclonal antibody 4E3, and the enzyme-labeled monoclonal antibody 4D5; the support medium is a microtiter plate; the working concentration of the monoclonal antibody 4E3 is 0.1μg / well-0.25μg / well, the antibody titer of the enzyme-labeled monoclonal antibody 4D5 is 1:20-1:40, and the blocking solution is a 0.1M PBS solution containing 1% w / v soybean protein, 1% w / v sucrose, and 0.05% v / v Tween 20, pH 7.4; the standard is a 1mg / ml SEA type O foot-and-mouth disease virus-like particle; and the kit further comprises a sample diluent, which is a 0.1M PBS solution containing 0.5%-2% w / v sucrose, 1% w / v EDTA, and 0.004% w / v AW dye, pH 7.4.

[0044] The coating concentration of the monoclonal antibody 4E3 can be 0.1 μg / well, 0.11 μg / well, 0.12 μg / well, 0.13 μg / well, 0.14 μg / well, 0.15 μg / well, 0.16 μg / well, 0.17 μg / well, 0.18 μg / well, 0.19 μg / well, 0.2 μg / well, 0.21 μg / well, 0.22 μg / well, 0.23 μg / well, 0.24 μg / well, 0.25 μg / well.

[0045] The titer of the enzyme-labeled reagent, i.e. the titer of the enzyme-labeled monoclonal antibody 4D5, can be 1:20, 1:21, 1:22, 1:23, 1:24, 1:25, 1:26, 1:27, 1:28, 1:29, 1:30, 1:31, 1:32, 1:33, 1:34, 1:35, 1:36, 1:37, 1:38, 1:39, 1:40.

[0046] As an embodiment of the present application, the coating concentration of the monoclonal antibody 4E3 is 0.1 μg / well to 0.25 μg / well, and the titer of the enzyme-labeled reagent is 1:20 to 1:40.

[0047] As an embodiment of the present application, the working concentration of the monoclonal antibody 4E3 is 0.1 μg / well, and the titer of the enzyme-labeled monoclonal antibody 4D5 is 1:40.

[0048] As an embodiment of the present application, the sample diluent is a 0.1M PBS solution with pH 7.4 containing 0.5% to 2% w / v sucrose, 1% w / v EDTA, and 0.004% w / v AW dye.

[0049] As an embodiment of the present application, the washing solution is a 0.1M PBS solution with pH 7.4 containing 10% v / v Tween 20, which is diluted 20 times with purified water when used.

[0050] As an embodiment of the present application, the color developing solution includes color developing solution A and color developing solution B, the color developing solution A is a purified water mixture containing 14.7 g / L disodium hydrogen phosphate, 9.3 g / L citric acid, and 0.3 g / L urea peroxide, and the color developing solution B is a purified water mixture containing 0.2 g / L tetramethyl benzidine (TMB) and 100 ml / L anhydrous ethanol.

[0051] As an embodiment of the present application, the termination solution is a 2M H2SO4 solution.

[0052] As an embodiment of the present application, the standard sample is a 1 mg / ml SEA type O foot-and-mouth disease virus antigen.

[0053] The present application relates to a method for preparing the kit, wherein the method comprises: step (1) diluting the monoclonal antibody 4E3 with a pH 9.6 carbonate buffer, coating the monoclonal antibody 4E3 in a microtiter plate; step (2) blocking the microtiter plate coated with the monoclonal antibody 4E3 in step (1) with the blocking solution; step (3) preparing the sample diluent, the enzyme-labeled monoclonal antibody 4D5, the 20x concentrated washing solution, the standard, the color developing solution, and the termination solution; step (4) assembling the blocked microtiter plate in step (2), the sample diluent in step (3), the enzyme-labeled monoclonal antibody 4D5, the 20x concentrated washing solution, the color developing solution, and the termination solution into an A box, and assembling the standard into a B box.

[0054] The present application ensures higher sensitivity of detection by selecting the fixed content of the monoclonal antibody 4E3 and the titer of the enzyme-labeled monoclonal antibody 4D5.

[0055] The present application also relates to a method for preparing the kit, wherein the method comprises:

[0056] Step 1) preparation of the support medium coated with the monoclonal antibody 4E3, coating the monoclonal antibody 4E3 in a microtiter plate with a carbonate buffer (pH 9.6) at a concentration of 0.05 μg / well to 0.5 μg / well, 100 μl / well, coating at 2-8°C for 12-16 hours, washing with a washing solution, and then drying the reaction plate; blocking at 2-8°C for 12-16 hours with a blocking solution, drying, and vacuum packaging;

[0057] Step 2) preparation of the sample diluent, the washing solution, the color developing solution, and the termination solution, and dispensing;

[0058] Step 3) preparation of the enzyme-labeled reagent, diluting the enzyme-labeled monoclonal antibody 4D5 with the sample diluent to 1:10 to 1:80;

[0059] Step 4) preparation of the standard, diluting the SEA type foot-and-mouth disease virus sample particles with the sample diluent to 1 mg / ml, and dispensing;

[0060] Step 5) assembling the support medium prepared in step 1), the sample diluent, the washing solution, the color developing solution, the termination solution, and the enzyme-labeled reagent prepared in step 3) into a kit A box, and storing at 2-8°C; and assembling the standard prepared in step 4) into a kit B box, and storing at -20°C.

[0061] As an embodiment of the present application, the concentration of the monoclonal antibody 4E3 in step 1) is 0.1 μg / well to 0.25 μg / well, and preferably 0.1 μg / well.

[0062] As an embodiment of the present application, the blocking solution in step 1) is 0.1M PBS with pH 7.4 containing 1% w / v soybean protein, 1% w / v sucrose and 0.05% v / v Tween 20.

[0063] As an embodiment of the present application, the sample diluent in step 2) is 0.1M PBS with pH 7.4 containing 0.5%-2% w / v sucrose, 1% w / v EDTA and 0.004% w / v AW dye; the washing solution is 0.1M PBS with pH 7.4 containing 10% v / v Tween 20, which is diluted 20 times with purified water when used; the color developing solution includes color developing solution A and color developing solution B, the color developing solution A is a mixture of purified water containing 14.7g / L sodium phosphate dibasic, 9.3g / L citric acid and 0.3g / L urea peroxide, and the color developing solution B is a mixture of purified water containing 0.2g / L tetramethyl benzidine (TMB) and 100ml / L anhydrous ethanol; the termination solution is 2M H2SO4 solution.

[0064] As an embodiment of the present application, the titer of the enzyme-labeled reagent in step 3) is 1:20-1:40, preferably 1:40.

[0065] The present application relates to the use of the kit in detecting the content of SEA type O foot-and-mouth disease virus-like particles; wherein the content of SEA type O foot-and-mouth disease virus-like particles is the content of the SEA type O foot-and-mouth disease virus-like particles in single vaccine, multivalent vaccine or combined vaccine.

[0066] As an embodiment of the present application, the single vaccine, multivalent vaccine or combined vaccine is a semi-finished product vaccine or a finished product vaccine.

[0067] The double-antibody sandwich method detection kit of the present application can detect SEA type O foot-and-mouth disease virus and accurately quantify the content of SEA type O foot-and-mouth disease virus antigen in a subunit vaccine containing SEA type O foot-and-mouth disease virus, thereby providing support for the testing of semi-finished product vaccines and finished product vaccines.

[0068] The present application relates to a single-chain antibody, wherein the heavy chain variable region of the single-chain antibody is encoded by SEQ.ID No.1 or a degenerate sequence thereof, or the heavy chain variable region of the single-chain antibody is encoded by SEQ.ID No.3 or a degenerate sequence thereof, and the light chain variable region of the single-chain antibody is encoded by SEQ.ID No.2 or a degenerate sequence thereof, or the light chain variable region of the single-chain antibody is encoded by SEQ.ID No.4 or a degenerate sequence thereof.

[0069] The single-chain antibody has an ELISA titer of SEA type O foot-and-mouth disease virus of ≥1:1600, indicating that it has good reaction characteristics with SEA type O foot-and-mouth disease virus.

[0070] Advantages of the present application:

[0071] The two strains of SEA type O foot-and-mouth disease virus monoclonal antibodies prepared by the present application can specifically recognize the SEA type O foot-and-mouth disease virus.

[0072] The kit prepared by the present application can be used for quantitative detection of semi-finished products and finished products containing SEA type O foot-and-mouth disease virus subunit vaccine, and is more conducive to quality control in research and development and production.

[0073] The advantages and characteristics of the present application will be clearer with the description. However, these examples are only exemplary and do not constitute any limitation on the scope of the present application. Those skilled in the art should understand that the details and forms of the technical solutions of the present application can be modified or replaced without departing from the spirit and scope of the present application, and such modifications and replacements fall within the protection scope of the present application.

[0074] The chemical reagents used in the embodiments of the present application are all of analytical purity and purchased from the National Pharmaceutical Group.

[0075] The coating liquid used in the examples of the present application is a carbonate buffer solution containing pH 9.6. Unless otherwise specified, all dilutions are made with phosphate buffer, but this embodiment does not constitute a limitation on the present application under any circumstances.

[0076] The experimental methods described in the present application are all conventional methods unless otherwise specified; the biological materials described in the present application can be obtained from commercial channels unless otherwise specified.

[0077] Example 1 Preparation and identification of foot-and-mouth disease virus-like particles

[0078] The preparation and identification of SEA type O foot-and-mouth disease virus-like particles, CATHAY type O foot-and-mouth disease virus-like particles and type A virus-like particles are described in Chinese patent CN111840533A.

[0079] Example 2 Preparation and identification of SEA type O foot-and-mouth disease virus monoclonal antibodies

[0080] 2.1 Preparation of SEA type O foot-and-mouth disease virus monoclonal antibodies

[0081] The SEA type O foot-and-mouth disease virus-like particles prepared in Example 1 were used as immunogens to immunize 6 five to six-week-old Balb / c mice, and the immunization method was multiple point injection subcutaneously on the back, with an injection amount of 100-150 μg per mouse. The first immunization was emulsified with an equal volume of Freund's complete adjuvant, and the booster immunization was performed after 2 weeks. The booster immunization was emulsified with an equal volume of Freund's incomplete adjuvant, and the mouse serum was collected one week after the second booster immunization.

[0082] The antibody titer of the mouse serum was detected by using the FMDV O type liquid phase blocking ELISA antibody detection kit according to its instructions. The antibody titer of the mouse serum was not less than 1:1440. The mouse with the highest antibody titer was selected for challenge immunization, i.e. tail vein injection of antigen. Three days after the challenge immunization, the mouse spleen was taken and fused with myeloma cells. The hybridoma cells were subcloned by limiting dilution method. The positive hybridoma cells were screened by using the FMDV O type liquid phase blocking ELISA antibody detection kit. Seven positive hybridoma cells were obtained, which were numbered as hybridoma cell M1, hybridoma cell M2, hybridoma cell M3, hybridoma cell M4, hybridoma cell M5, hybridoma cell M6 and hybridoma cell M7 in sequence. The supernatant of the cells was detected by using the FMDV O type antibody liquid phase blocking ELISA detection kit according to its instructions. The antibody titer was not less than 1:128.

[0083] The above-mentioned seven hybridoma cells were prepared into ascites by the mouse ascites method. Each ascites was purified to obtain monoclonal antibody M1, monoclonal antibody M2, monoclonal antibody M3, monoclonal antibody M4, monoclonal antibody M5, monoclonal antibody M6 and monoclonal antibody M7. First, sodium acetate buffer was added to the ascites to adjust the pH value to 5.0. The ascites was stirred at 2-8°C for 30 minutes. Caprylic acid was slowly added during the stirring. The ascites was placed at 2-8°C for 2 hours. The supernatant was taken after centrifugation at 10,000 rpm for 30 minutes. PBS solution was added. The saturated ammonium sulfate solution was added to the ascites at 2-8°C within 30 minutes to a final concentration of 0.277 g / ml. The ascites was placed at 2-8°C for 1 hour. The ascites was centrifuged at 10,000 rpm for 30 minutes. The supernatant was discarded. The precipitate was dissolved in 1 / 5 volume of PBS of the initial ascites volume. The ascites was dialyzed at 4°C for overnight using 100 times volume of PBS. The insoluble substances were removed by centrifugation at 4°C. The supernatant was the purified antibody.

[0084] 2.2 Identification of the monoclonal antibody of FMDV O type SEA

[0085] 2.2.1 Purity identification and protein content determination of the monoclonal antibody

[0086] The purified monoclonal antibodies were identified by SDS-PAGE gel electrophoresis. The results showed that the purity of each purified monoclonal antibody was greater than 90%.

[0087] The concentration of each purified monoclonal antibody was determined by using the BCA protein concentration determination kit. The concentrations were 3.1 mg / ml, 3.4 mg / ml, 3.7 mg / ml, 3.8 mg / ml, 3.2 mg / ml, 3.6 mg / ml and 3.5 mg / ml in sequence.

[0088] 2.2.2 Identification of the type and subclass of the monoclonal antibody

[0089] The subtypes of 7 monoclonal antibodies were identified by monoclonal antibody subtype identification kit, and the results were as follows: the heavy chain subtypes of 7 monoclonal antibodies were IgG1, IgG2b, IgG2a, IgG2a, IgG2b, IgG1 and IgG2a, and the light chain subtypes were all kappa.

[0090] 2.2.3 titer determination

[0091] The titers of 7 monoclonal antibodies were determined by using the antibody liquid-phase blocking ELISA detection kit for foot-and-mouth disease virus type O according to its instructions, and the titers were 1:2880, 1:2880, 1:4096, 1:8192, 1:5760, 1:11520 and 1:8192, respectively.

[0092] 2.2.4 specificity identification of monoclonal antibodies

[0093] The reactivity of 7 monoclonal antibodies with CATHAY type O foot-and-mouth disease virus-like particles was determined by indirect ELISA method. The specific operation was as follows: CATHAY type O foot-and-mouth disease virus-like particles were diluted to 1 μg / ml with coating solution, mixed well, coated on an enzyme-labeled plate at 100 μl / well, and sealed with a sealing film after 2-8°C incubation for 24 hours; the liquid in the wells was discarded, 200 μl of blocking solution (5% w / v skim milk in PBS with pH 7.4) was added to each well, and sealed with a sealing film after 37°C incubation for 2 hours; the liquid in the wells was discarded, the plate was washed and dried, and 100-fold diluted 7 monoclonal antibodies were added, and PBS was added as a negative control, and CATHAY type O foot-and-mouth disease virus-like particle immunized positive mouse serum was added as a positive control, all at 50 μl / well, and incubated at 37°C for 1 hour; the liquid in the wells was discarded, the plate was washed and dried, and 1:20000-fold diluted HRP-labeled goat anti-mouse IgG was added at 50 μl / well, and incubated at 37°C for 30 minutes; the liquid in the wells was discarded, the plate was washed and dried, and color developing agent A and B were added at 50 μl / well, mixed well, and incubated at 37°C for 15 minutes; 50 μl / well of stop solution was added, and the OD value was read; when the OD value of the negative control was less than 0.2, and the OD value of the positive control was greater than or equal to 0.8, the test was valid; when S / N (sample OD value / negative control OD value) was greater than or equal to 2.1, it was determined to be positive, and when S / N (sample OD value / negative control OD value) was less than 2.1, it was determined to be negative. The detection results showed that monoclonal antibodies M1, M3, M6 and M7 had reactivity with CATHAY type O foot-and-mouth disease virus-like particles, and monoclonal antibodies M2, M4 and M5 had no reactivity with CATHAY type O foot-and-mouth disease virus-like particles. 450nm-630nm

[0094] 7 monoclonal antibodies were detected by using the antibody liquid-phase blocking ELISA detection kit for foot-and-mouth disease virus type A according to its instructions, and the antibody titers were all less than 1:8, indicating that they all had no reactivity with foot-and-mouth disease virus type A. ​

[0095] The specificity of the 7 monoclonal antibodies was evaluated by IFA using common porcine viruses. The test was valid when there was no fluorescence in the healthy cell control wells and yellow-green fluorescence in the positive control wells. Yellow-green fluorescence was observed in the virus-infected cell wells, which were determined to be positive wells, and no yellow-green fluorescence was observed in the virus-infected cell wells, which were determined to be negative wells. Results: The 7 monoclonal antibodies did not react with porcine pseudorabies virus (PRV), porcine parvovirus (PPV), classical swine fever virus (CSFV), porcine circovirus type 2 (PCV2), or porcine reproductive and respiratory syndrome virus (PRRSV).

[0096] The above results show that the monoclonal antibodies M1, M3, M6, and M7 are reactive with both SEA type O foot-and-mouth disease virus-like particles and CATHAY type O foot-and-mouth disease virus-like particles, and the monoclonal antibodies M2, M4, and M5 are only specific monoclonal antibodies for SEA type O foot-and-mouth disease virus. Therefore, the monoclonal antibody M2, the monoclonal antibody M4, and the monoclonal antibody M5 were selected for the study of the SEA type O foot-and-mouth disease virus-like particle quantification method. The monoclonal antibody M2, the monoclonal antibody M4, and the monoclonal antibody M5 were named 2A7, 4E3, and 4D5.

[0097] Example 3 Preparation and identification of enzyme-labeled antibodies

[0098] 3.1 Preparation

[0099] The monoclonal antibodies 2A7, 4E3, and 4D5 were labeled with horseradish peroxidase (HRP) using a modified sodium periodate method. 20 mg of horseradish peroxidase (HRP) was dissolved in 1 ml of ultrapure water, 1 ml of freshly prepared NaIO4 solution (30 mg of NaIO4 dissolved in 1 ml of ultrapure water) was added, and the mixture was mixed well and kept in the dark at 2-8°C for 30 minutes. 40 μl of ethylene glycol was added to the above solution, and the mixture was kept in the dark at 2-8°C for 30 minutes. According to the ratio of 1 mg of purified monoclonal antibody to 100 μl of the above mixture, the two were mixed well and then added to a dialysis bag, which was dialyzed against CB buffer for 6 hours. The entire operation was carried out in the dark. The dialyzed mixture was transferred to a 1.5 ml EP tube, 10 μl of freshly prepared NaBH4 solution (10 mg of NaBH4 dissolved in 1 ml of ultrapure water) was added, and the mixture was mixed well and kept at room temperature for 2 hours, with mixing every 30 minutes. An equal volume of saturated ammonium sulfate was added, the mixture was mixed well, and then kept at 2-8°C for 15 minutes. Centrifugation was performed at 12000 rpm for 10 minutes, and the supernatant was discarded. The precipitate was resuspended with an equal volume of a mixture of PBS and glycerol (V:V=1:1) to obtain enzyme-labeled monoclonal antibodies, which were stored at -20°C for later use.

[0100] 3.2 Identification

[0101] Appearance: Red-brown liquid at room temperature, no flocculent precipitate.

[0102] Quality evaluation: The absorbance of enzyme-labeled antibody at 403 nm and 280 nm was detected by ultraviolet spectrophotometer. The corresponding enzyme parameters were calculated according to the formula:

[0103] Enzyme amount (mg / ml) = A 403nm × 0.4 × dilution factor.

[0104] IgG amount (mg / ml) = (A 280nm - A 403nm × 0.3) × 0.62 × dilution factor.

[0105] Molar ratio (E / P) = enzyme amount × 4 / IgG amount.

[0106] Labeling rate = A 403nm / A 280nm .

[0107] After absorbance detection and calculation, the specific results are shown in Table 1:

[0108] Table 1 Quality evaluation of enzyme-labeled antibody

[0109] Antibody A 403nm ]] A 280nm ]] Enzyme amount IgG amount Molar ratio Labeling efficiency 2A7 0.461 0.485 1.844 2.150 3.430 0.951 4E3 0.395 0.420 1.580 1.860 3.380 0.940 4D5 0.375 0.431 1.50 1.975 3.038 0.870

[0110] 3.3 Enzyme-labeled antibody activity detection

[0111] The SEA type O foot-and-mouth disease virus-like particles prepared in Example 1 were used as coating agents, coated on a microplate at 2 μg / ml, 100 μl / well, and then blocked with 5% w / v skim milk in PBS at pH 7.4 at 37°C for 2 hours; the liquid in the wells was discarded, the plate was washed and dried. The enzyme-labeled monoclonal antibodies 2A7, 4E3 and 4D5 were diluted by 1000, 10000, 20000, 40000, 80000, 160000, 320000 and 640000 times respectively with PBS at pH 7.4, 50 μl / well, and PBS was added as a negative control, 50 μl / well, at 37°C for 1 hour; the liquid in the wells was discarded, the plate was washed and dried, and then color developing agent A and B were added, 50 μl / well, mixed and incubated at 37°C for 15 minutes; stop solution was added, 50 μl / well, and the OD 450nm-630nm value was read; the results were determined as follows: S / N (sample OD value / negative control OD value) ≥ 2.1 was determined as positive, and S / N (sample OD value / negative control OD value) < 2.1 was determined as negative, and the reciprocal of the maximum dilution factor of the sample S / N value ≥ 2.1 was taken as the titer of the sample. Results: The ELISA titers of monoclonal antibodies 2A7, 4E3 and 4D5 were 1:80000, 1:160000 and 1:160000, respectively.

[0112] Preparation of kit and establishment of detection method

[0113] 4.1 Preparation of the kit

[0114] Coating plate: the purified monoclonal antibody prepared in Example 2 is diluted to a preferred concentration with carbonate buffer (pH 9.6) as a coating solution, coated in a microtiter plate at 100 μl / well, and incubated at 2-8°C for 12-16 hours. After washing with a washing solution, the reaction plate is dried and then sealed in vacuum. The plate is stored at 2-8°C for standby.

[0115] Sample diluent: 0.1M PBS solution (pH 7.4) containing 0.5-2% w / v sucrose, 1% w / v EDTA, and 0.004% w / v AW dye, filtered through a 0.22 μm filter, and aseptically dispensed.

[0116] Enzyme-labeled reagent: the enzyme-labeled antibody prepared in Example 3 is diluted to an antibody titer of 1:20-1:40 with the sample diluent, filtered through a 0.22 μm filter, and aseptically dispensed.

[0117] 20x concentrated washing solution: 0.1M PBS solution (pH 7.4) containing 10% v / v Tween 20, filtered through a 0.22 μm filter, and aseptically dispensed. Before use, the solution is diluted 20 times with purified water.

[0118] Standard: the SEA type O foot-and-mouth disease virus-like particles prepared in Example 1 are diluted to 1 mg / ml with the sample diluent, filtered through a 0.22 μm filter, and aseptically dispensed. The standard is stored at -20°C.

[0119] Color developing solution: includes color developing solution A and color developing solution B. Take 14.7 g of disodium hydrogen phosphate, 9.3 g of citric acid, and 0.3 g of urea peroxide, dissolve in purified water, and make up to 1 L. Filter through a 0.22 μm filter, and aseptically dispense as color developing solution A. Take 0.2 g of tetramethyl benzidine (TMB) and 100 ml of anhydrous ethanol, dissolve in purified water, and make up to 1 L. Filter through a 0.22 μm filter, and aseptically dispense as color developing solution B.

[0120] Termination solution: 2M H2SO4 solution.

[0121] The SEA type O foot-and-mouth disease virus-like particle content determination kit includes A box and B box. The antigen-coated plate, sample diluent, enzyme-labeled reagent, 20x concentrated washing solution, color developing solution A, color developing solution B, and termination solution are assembled into A box, which is stored at 2-8°C for standby. The standard is B box, which is stored at -20°C.

[0122] 4.2 Establishment of the kit detection method

[0123] The kit detection method includes the following steps:

[0124] Step 1) Dilute the standard 2 times, i.e. 2 times dilution, 4 times dilution, 8 times dilution, 16 times dilution, 32 times dilution, 64 times dilution, 128 times dilution, 256 times dilution, and add 50 μl / well to the antigen-coated plate.

[0125] Step 2) Dilute the sample to be tested to the appropriate dilution, 50 μl / well, and add to the coated plate, and mix gently; set 1 well as blank control (add 50 μl of sample dilution). After sealing the plate with sealing film, incubate at 37°C for 60 minutes.

[0126] Step 3) Discard the liquid in the plate, wash the reaction plate 3-5 times, and try to dry the last time.

[0127] Step 4) Add 50 μl of enzyme-labeled reagent to each well, mix gently, and seal the plate with sealing film. Incubate at 37°C for 30 minutes.

[0128] Step 5) Discard the liquid in the plate, wash the reaction plate 3-5 times, and try to dry the last time.

[0129] Step 6) Add 50 μl of color developing solution A and B to each well in turn, mix gently, and incubate at 37°C for 15 minutes.

[0130] Step 7) Add 50 μl of stop solution to each well, mix gently, and measure the results within 10 minutes.

[0131] Step 8) Set the double-wavelength at 450 nm-630 nm, and measure the OD value of each well.

[0132] Step 9) Draw a lg-lg standard curve according to the OD value and protein content of the standard, and calculate the content of the sample to be tested according to the standard curve.

[0133] Test condition: the standard curve R 2 ≥0.99, and the standard curve contains at least 5 points, otherwise the test is not valid and should be retested. The working range of the standard curve is 8 μg / ml-1000 μg / ml, and the linear relationship is good within this range. The dilution multiple of the sample to be tested is selected according to this range.

[0134] Result determination: select the average protein content corresponding to different dilution multiples within the linear relationship range as the content of the sample.

[0135] 4.3 Kit paired test with monoclonal antibody

[0136] The enzyme-labeled antibodies 2A7, 4E3 and 4D5 prepared in Example 3 were paired with the purified monoclonal antibodies 2A7, 4E3 and 4D5 prepared in Example 2 to prepare antigen-coated plates according to Example 4.1 (the concentration of the coating monoclonal antibody was 0.25 μg / well, and the enzyme-labeled antibody was diluted at a ratio of 1:20), and the pairs were assembled into kits according to Table 2. The SEA type O foot-and-mouth disease virus-like particles prepared in Example 1 were detected according to the detection method of Example 4.2, and the appropriate pairings were selected according to the sensitivity of the detection, and the results are shown in Table 2. The monoclonal antibody 4E3 as the coating monoclonal antibody and the monoclonal antibody 4D5 as the enzyme-labeled antibody had the highest sensitivity (7.8 μg / ml), and therefore the coating antibody 4E3 and the enzyme-labeled antibody 4D5 were used for subsequent studies.

[0137] Table 2 Sensitivity detection results of monoclonal antibody pairing test

[0138]

[0139] Note: " / " means that this pairing is not performed.

[0140] 4.4 Determination of the variable region sequence of the monoclonal antibody

[0141] According to the sequence characteristics of the murine monoclonal antibody, the heavy chain variable region primer sequence was designed as follows:

[0142] P1: 5'-ACTAGTCGACATGAAATGCTCGTGGRTYATSAACTT-3'

[0143] P2: 5'-ACTAGTCGACATGAAATGCAGCTGGRTYAT-3'

[0144] The light chain variable region primer sequence was designed as follows:

[0145] P3: 5'-ACTAGTCGACATGGTYGTYATVTCCTTGCT-3'

[0146] P4: 5'-ACTAGTCGACATGGGCWTCAAGATGRAGTCACAKW-3'

[0147] The hybridoma cells 4E3 and 4D5 were cultured and collected respectively, and the RNA was extracted and reversely transcribed as a template. The variable region sequences were amplified by using the primers, and the amplification products were sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for sequencing. Results: The nucleotide sequences of the heavy chain variable region and the light chain variable region of the monoclonal antibody 4E3 are shown in SEQ. ID No. 1 and SEQ. ID No. 2 respectively, and the nucleotide sequences of the heavy chain variable region and the light chain variable region of the monoclonal antibody 4D5 are shown in SEQ. ID No. 3 and SEQ. ID No. 4 respectively.

[0148] 4.5 Optimization of the coating monoclonal antibody concentration and the working concentration of enzyme-labeled antibody in the kit

[0149] According to the coating monoclonal antibody working concentration 0.5 μg / well, 0.25 μg / well, 0.1 μg / well and 0.05 μg / well, and the enzyme-labeled antibody 2000-fold dilution, 4000-fold dilution, 8000-fold dilution and 16000-fold dilution shown in Table 3, the SEA type O virus-like particles 200 μg / ml diluent was detected, and 3 wells were repeated, and the sample diluent was used as a negative control, and 3 wells were repeated. According to the P / N value, the appropriate coating monoclonal antibody concentration and the working concentration of enzyme-labeled antibody were selected. Results (see Table 3): Therefore, when the working concentration of the coating antibody is 0.1 μg / well-0.25 μg / well, and the enzyme-labeled antibody is 4000-fold dilution-8000-fold dilution (titer 1:20-1:40), the P / N value is higher, and the kit can be prepared. The kit prepared by using the working concentration of the coating antibody 0.1 μg / well and the titer of the enzyme-labeled antibody 1:40 has the optimal detection results.

[0150] Table 3 Optimization test results of the working concentration of the coating monoclonal antibody and the enzyme-labeled antibody (P / N value)

[0151]

[0152] 4.6 Optimization of the blocking solution in the kit

[0153] The kit was prepared by using different blocking solution formulations (see Table 4) under the same conditions, and the sensitivity and specificity of the kit were detected (see Example 5). Results (Table 4): When the blocking solution is 1% w / v soybean protein, 1% w / v sucrose and 0.05% v / v Tween 20 in 0.1M PBS with pH 7.4, the detection sensitivity is the highest.

[0154] Table 4 Optimization results of the blocking solution

[0155]

[0156] Based on this, the optimal kit prepared according to Example 4.1 is used for subsequent detection, with a working concentration of 0.1 μg / well for coating antibody, a titer of 1:40 for enzyme-labeled antibody, and a blocking buffer of 0.1 M PBS at pH 7.4 containing 1% w / v soy protein, 1% w / v sucrose, and 0.05% v / v Tween 20.

[0157] Example 5: Application of the reagent kit

[0158] 5.1 Linearity range and sensitivity detection of the kit's standard curve

[0159] The SEA type O virus-like particle standard (1 mg / ml) was serially diluted with sample diluent in a 2-fold gradient (corresponding to protein concentrations of 1000 μg / ml, 500 μg / ml, 250 μg / ml, 125 μg / ml, 62.5 μg / ml, 31.3 μg / ml, 15.6 μg / ml, 7.8 μg / ml, 3.9 μg / ml, 1.95 μg / ml, and 0.98 μg / ml), and the test was repeated three times. Results (see...) Figure 1 The kit standards showed good linearity in the range of 3.9 μg / ml to 500 μg / ml, with R0. 2 >0.99; detection sensitivity is 3.9 μg / ml.

[0160] 5.2 Specificity Detection

[0161] Three batches of CATHAY type O virus-like particles and three batches of type A virus-like particles were prepared according to the method in Example 1, and were detected using the prepared kits. The results (see Table 5) show that the OD values ​​of the three batches of CATHAY type O virus-like particles and the three batches of type A virus-like particles were basically consistent with the blank control values, indicating that the kits have good specificity.

[0162] Table 5. Results of reagent kit specificity testing

[0163]

[0164] 5.3 Repeatability Test

[0165] The SEA type O foot-and-mouth disease virus-like particles prepared in Example 1 were diluted with sample diluent to 400 μg / ml, 100 μg / ml, 50 μg / ml, and 10 μg / ml, respectively, and tested 5 times each between batches and within batches. Results (see Table 6): The coefficients of variation (CV) for intra-batch repeatability tests ranged from 2.38% to 7.54%, and the CVs for inter-batch repeatability tests ranged from 2.02% to 7.71%, both <8%, indicating good reproducibility of the kit.

[0166] Table 6. Repeatability test results of the reagent kit

[0167]

[0168] 5.4 Shelf life

[0169] The kit (A box is placed at 2-8℃, B box is placed at -20℃) is stored for 3, 6, 12 and 15 months respectively for sensitivity, specificity and repeatability detection, and the coincidence rate of the detection results is 100%, indicating that the kit can be stored for 15 months.

[0170] 5.5 Clinical application

[0171] 5.5.1 Semi-finished product detection

[0172] Ten batches of SEA type O virus-like particles prepared according to the method of Example 1 are semi-finished products of the SEA type O virus subunit vaccine, which are detected by the kit, and the results are compared with the BCA detection results. As shown in Table 7, the relative deviation of the detection results of the kit and the BCA detection is less than 10%, indicating that the kit is good for detecting semi-finished products.

[0173] Table 7 Detection results of vaccine semi-finished products

[0174]

[0175] 5.5.2 Finished product detection

[0176] The SEA type O foot-and-mouth disease virus-like particles, CATHAY type O foot-and-mouth disease virus-like particles and type A virus-like particles prepared in Example 1 are emulsified with ISA 206 adjuvant according to the antigen components and contents in Table 8 to prepare finished products containing the SEA type O foot-and-mouth disease virus subunit vaccine. After the vaccine is demulsified with n-pentanol, the water phase is detected by the kit. As shown in Table 8, the single-component vaccine, two-component vaccine and three-component vaccine containing the SEA type O virus can be specifically detected by the kit, and the relative deviation from the theoretical value is less than 2%, indicating that the kit is good for detecting finished products.

[0177] Table 8 Detection results of vaccine finished products

[0178]

[0179] In summary, the kit prepared in the application overcomes the shortcomings of the BCA and other protein quantification methods that cannot specifically detect proteins. The double monoclonal antibody ELISA method established by using monoclonal antibody technology can conveniently, quickly and specifically detect the SEA type O foot-and-mouth disease virus in vaccine finished products and vaccine semi-finished products, has good repeatability, and the sensitivity can reach 3.9 μg / ml, thereby providing support for the quality control of foot-and-mouth disease virus subunit vaccine.

[0180] Preparation and application of genetically engineered antibodies

[0181] The heavy chain variable region and light chain variable region gene sequences of the monoclonal antibodies 4E3 and 4D5 in Example 2 were amplified respectively, and the heavy chain variable region gene and the light chain variable region gene were linked by a linker peptide to construct recombinant plasmids 4E3-ScFv, 4D5-ScFv, 4E3 heavy+4D5 light-ScFv and 4D5 heavy+4E3 light-ScFv respectively. The ScFv genes were inserted into a pCDNA-3.1 vector to construct eukaryotic expression systems pCDNA-4E3-ScFv, pCDNA-4D5-ScFv, pCDNA-4E3 heavy+4D5 light-ScFv and pCDNA-4D5 heavy+4E3 light-ScFv respectively, and MDCK cells were transfected for expression.

[0182] The SEA type O foot-and-mouth disease virus-like particles prepared in Example 1 were used as coating antigens, and were coated on a microplate at 0.1 μg / ml and 100 μl / well, and then blocked with PBS containing 5% (w / v) skim milk. The expressed single-chain antibodies 4E3, 4D5, 4E3 heavy+4D5 light and 4D5 heavy+4E3 light were subjected to titer detection, and the results showed that the titers were 1:1600, 1:1600, 1:3200 and 1:1600 respectively, indicating that the above single-chain antibodies have good reaction characteristics with the SEA type O foot-and-mouth disease virus.

[0183] The above results show that SEQ. ID No. 1, SEQ. ID No. 2, SEQ. ID No. 3 and SEQ. ID No. 4 can be used for the preparation of genetically engineered antibodies of the SEA type O foot-and-mouth disease virus.

[0184] The above merely describes preferred embodiments of the present application and is not used to limit the present application, and any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application. SEQUENCE LISTING <110> Luoyang Putai Biotechnology Co., Ltd. <120> Monoclonal antibody of O foot-and-mouth disease virus and application thereof <160> 4 <170> PatentIn version 3.3 <210> 1 <211> 357 <212> DNA <213> Hybridoma <400> 1 CAGATCCAGTTGGTGCAGTCTGGACCTGAGCTGAAGAAGCCTGGAGAGACAGTCAAGATC 60 TCCTGCAAGGCTTCTGGCTATACCTTCACACACTATGGGATGAACCGGGTGAAGCAGGCT 120 CCAGGAGAGGTTTAAAGTGGATGGGCTGGATAAACAACCTACACTGGAAGAGCTAACATAT 180 GCTGATGACTTCAAGGGACGGTTTGCCTTCTCTTTGGAAACCTCTGCCAGC ACTGCCTAT 240 TTGCAGATCAACAACCTCAAAAATGAGGACACGGCTACATATTTCTGTACAAGG GTGC GC 300 GACGACGGGGCCTGGTTTGCCTACTGGGGCCAAGGGACTCTG GTC ACTGTCTCTGCA 357 <210> 2 <211> 339 <212> DNA <213> Hybridoma <400> 2 GACATTGCATGACACAGTCTCCATCATCCCTGACTGGGACAGCCGGGGAGAAGGCCACT 60 ATGAGCTGCAAGTCCAGTCAAGTCTGTCAAACAGTGAAAATCAAAAGAECTACTTGACC 120 TGGTACCAACAGAAACCA GGCCAGCCTCCTAAACTGTTGATCTACTGGGCATCCACTAGG 180 GATTCTGGTGTCCCTGATCGCTTCACAGGC ACTGGATCAGGAACAGATTTCACTCTCAC C 240 atcagcagtg tgcaggctgg agacctggca gtttattact gtcagaacga ttataattat 300 ccgctcacgt tcggtgctgg gaccaagctg gagctgaaa 339 <210> 3 <211> 354 <212> DNA <213> Hybridoma <400> 3 cagatccagt tggtgcagtc tggacctgag ctgaagaagc ctggagagac agtcaagatc 60 tcctgcaagg cttctgggta taccttcaca cactatggga tgaactgggt gaagcagact 120 ccaggagagg gtttaaagtg gatgggctgg ataaacacct acactggaga gctaacttat 180 gctgatgact tcaagggacg gtttgtcttc tctttggaaa cctctgccag cactgcctat 240 ttgcagatca acaacctcaa aaatggggac acggctacat atttctgtac aagggtgcgc 300 gacgacgggg cctggtttgc ttactggggc caagggactc tggtcactgt ctct 354 <210> 4 <211> 339 <212> DNA <213> Hybridoma <400> 4 gacattgtga tgacacagtc tccatcctcc ctgactgtga cagccgggga gaaggtcact 60 atgagctgca agtccagtca gagtctgtta aacagtgaaa atcaaaagaa ctacttgacc 120 tggtaccagc agaaaccagg ccagcagcct aaactgttga tctactgggc atccactagg 180 gattctggtg tccctgatcg cttcacaggc actggatctg gaacagattt tactctcacc 240 atcagcagtg tgcaggctgg agacctggca gtttattact gtcagaatga ttataattat 300 ccgctcacgt tcggtgctgg gaccaagctg gagctgaaa 339

Claims

1. An antibody that specifically binds to SEA type O foot-and-mouth disease virus, wherein, The antibody comprises a heavy chain variable region and a light chain variable region. The heavy chain variable region of the antibody is encoded by SEQ ID No. 1 or its degenerate sequence, and the light chain variable region of the antibody is encoded by SEQ ID No. 2 or its degenerate sequence. The antibody is a monoclonal antibody or a genetically engineered antibody. The genetically engineered antibody includes a single-chain antibody or a chimeric monoclonal antibody. The antibody specifically binds to SEA type O foot-and-mouth disease virus-like particles.

2. The antibody according to claim 1, wherein, The antibody is a monoclonal antibody 4E3, which includes a heavy chain variable region and a light chain variable region. The heavy chain variable region of the monoclonal antibody 4E3 is encoded by SEQ ID No. 1 or its degenerate sequence, and its light chain variable region is encoded by SEQ ID No. 2 or its degenerate sequence.

3. The antibody according to claim 1, wherein, The antibody is a single-chain antibody, which includes a heavy chain variable region and a light chain variable region. The heavy chain variable region is encoded by SEQ ID No. 1 or its degenerate sequence, and its light chain variable region is encoded by SEQ ID No. 2 or its degenerate sequence.

4. A kit for detecting SEA type O foot-and-mouth disease virus antigen, wherein, The kit includes: a support medium coated with the monoclonal antibody 4E3 of claim 2, wherein the support medium is blocked with blocking buffer after being coated with the monoclonal antibody 4E3, and enzyme-labeled monoclonal antibody 4D5; The monoclonal antibody 4D5 includes a heavy chain variable region and a light chain variable region. The heavy chain variable region of the monoclonal antibody 4D5 is encoded by SEQ ID No. 3 or its degenerate sequence, and its light chain variable region is encoded by SEQ ID No. 4 or its degenerate sequence. Concentrated washing solution, the The concentrated washing solution was a 0.1M PBS solution at pH 7.4 containing 10% v / v Tween 20; The standard is a type SEA O foot-and-mouth disease virus-like particle; The colorimetric solution includes colorimetric solution A and colorimetric solution B. Colorimetric solution A is an aqueous solution containing 14.7 g / L disodium hydrogen phosphate, 9.3 g / L citric acid, and 0.3 g / L urea peroxide. Colorimetric solution B is an aqueous solution containing 0.2 g / L tetramethylbenzidine and 10% v / v anhydrous ethanol. The termination solution is a 2M H2SO4 solution.

5. The kit according to claim 4, wherein, The kit includes: a support medium coated with the monoclonal antibody 4E3, wherein the support medium is blocked with blocking buffer after being coated with the monoclonal antibody 4E3, and enzyme-labeled monoclonal antibody 4D5; The supporting medium is a micro-titer plate; The working concentration of the monoclonal antibody 4E3 is 0.1 μg / well to 0.25 μg / well, the antibody titer of the enzyme-labeled monoclonal antibody 4D5 is 1:20 to 1:40, and the blocking solution is 0.1M PBS at pH 7.4 containing 1% w / v soy protein, 1% w / v sucrose, and 0.05% v / v Tween 20. The standard is 1 mg / ml of SEA type O foot-and-mouth disease virus-like particles; The kit also includes a sample diluent, which is a 0.1M PBS solution at pH 7.4 containing 0.5%–2% w / v sucrose, 1% w / v EDTA, and 0.004% w / v AW dye.

6. The kit according to claim 5, wherein, The working concentration of the monoclonal antibody 4E3 is 0.1 μg / well, and the antibody titer of the enzyme-labeled monoclonal antibody 4D5 is 1:

40.

7. A method for preparing the kit according to claim 5 or 6, wherein, The method includes: Step (1) Dilute the monoclonal antibody 4E3 with pH 9.6 carbonate buffer and coat it onto a microtiter plate; Step (2) Block the microtiter plate coated with monoclonal antibody 4E3 from step (1) with the blocking solution; Step (3) Prepare the sample dilution solution, the enzyme-labeled monoclonal antibody 4D5, and the... Concentrated washing solution, the standard, the colorimetric solution, and the stop solution; Step (4) involves combining the sealed microtiter plate from step (2), the sample dilution buffer from step (3), the enzyme-labeled monoclonal antibody 4D5, and the... The concentrated washing solution, the color developing solution, and the stop solution are assembled into box A, and the standard product is assembled into box B.

8. The use of the kit according to any one of claims 4 to 6 in detecting the content of SEA type O foot-and-mouth disease virus-like particles for non-disease diagnostic or therapeutic purposes; wherein, The content of SEA type O foot-and-mouth disease virus-like particles refers to the content of SEA type O foot-and-mouth disease virus-like particles in a single vaccine or a triple vaccine.

9. The application according to claim 8, wherein, The single or triple vaccine is either a semi-finished or finished vaccine product.

Citation Information

Patent Citations

  • Chimeric antibodies

    GB2188638A

  • Kit and detection method for detecting type O protective antibody of foot and mouth disease virus

    CN109682980A

  • Virus-like particle antigen of foot-and-mouth disease type A, and vaccine composition of virus-like particle antigen and preparation method and application thereof

    CN111840533A