New pathogenic gene cyclc1 of sperm head deformity and mutation detection reagent thereof

Abstract

The application belongs to the technical field of gene diagnosis, and discloses a new pathogenic gene CYLC1 of sperm head deformity and a mutation detection reagent thereof; the new pathogenic gene CYLC1 of sperm head deformity is used as a candidate gene diagnosis object of sperm head deformity, and four homozygous missense mutations thereof are c.1157A>C / p.N386T, c.1377G>T / p.K459N, c.1402T>G / p.S468A and c.1834T>A / p.C612S. The application can use the detection reagent to perform simple, fast and accurate gene diagnosis on sperm head deformity patients, and is also helpful for understanding pathogenesis, genetic counseling, prenatal diagnosis and gene therapy. The application can also use the established Cylc1 gene knockout mouse model to reveal the role and mechanism of Calicin-1 protein on sperm acrosome anchoring and head development of mammals.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of gene diagnosis, and particularly relates to a novel pathogenic gene CYLC1 of sperm head deformity and a mutation detection reagent thereof. BACKGROUND

[0002] Sperm head deformity is a common type of male primary infertility, which is closely related to genetic factors. The main clinical features are sperm head deformity and acrosome development abnormalities. At present, the gene mutation spectrum of sperm head deformity has not been completely discovered, and the relationship between genotype and phenotype is not clear. With the development of whole exon sequencing (WES) technology, researchers have identified some pathogenic genetic factors in patients with sperm head deformity, such as harmful mutations of DPY19L2, SPATA16, PICK1, ZPBP1, ACTL7A, ACTL9 and CCIN genes. However, according to a large cohort study, only about 4% of male infertility patients have obtained a clear genetic diagnosis. Further excavation of pathogenic gene mutations of male infertility (including sperm head deformity) has important clinical application value for its genetic diagnosis, assisted reproductive treatment and genetic counseling.

[0003] The inventors found that 14 patients carried CYLC1 gene pure missense mutations in whole exon sequencing of 332 patients with sperm head deformity (content of the application, not published in articles), which indicates that CYLC1 gene mutation is a new pathogenic genetic factor of sperm head deformity. CYLC1 gene is located on the X chromosome, and the gene contains 6 exons. The Cylicin-1 protein encoded by the gene contains 651 amino acids, which is a specific expression protein of perinuclear theca (PT) of mammalian sperm. Its protein structure and physiological function are not clear. At present, only two articles have reported that researchers have isolated the structure of sperm perinuclear theca and identified Cylicin-1 as one of the main components of sperm perinuclear theca. Its base sequence and amino acid sequence have been successfully obtained. Gene knockout mouse model is an important research means to reveal the physiological function of genes. However, there is no report on Cylc1 gene knockout mice at present. The application uses CRISPR / Cas9 gene editing technology to construct Cylc1 gene knockout mice, which reveals the important physiological function of Cylc1 gene in regulating sperm acrosome anchoring (content of the application, not published in articles). Cylc1 gene knockout mice, like CYLC1 gene mutation patients, show sperm head deformity.

[0004] Through the above analysis, the existing problems and defects of the prior art are:

[0005] (1) At present, the known sperm head deformity pathogenic gene mutation is few, the gene diagnosis rate of sperm head deformity patient is low, and new pathogenic gene mutation of sperm head deformity needs to be excavated urgently.

[0006] (2) At present, no research reports that CYLC1 gene mutation is a pathogenic genetic factor of sperm head deformity, and there is no detection method for CYLC1 gene mutation.

[0007] (3) The Cylc1 gene knockout mouse model has not been established, and the physiological function of Cylicin-1 in regulating sperm head development is not clear. SUMMARY

[0008] In view of the problems existing in the prior art, the present application provides a new pathogenic gene CYLC1 of sperm head deformity and a mutation detection reagent thereof, in particular to a CYLC1 gene, four homozygous missense mutations and a pathogenic mutation detection reagent for detecting hereditary sperm head deformity.

[0009] The present application is realized in that a new pathogenic gene CYLC1 of sperm head deformity is used as a candidate gene diagnosis object of sperm head deformity, and the cDNA sequence of the wild type CYLC1 gene is SEQ ID NO: 1.

[0010] Further, the c.1157A>C / p.N386T homozygous missense mutation of the wild type CYLC1 gene indicates that the 1157th nucleotide point mutation occurs, which is c.1157A>C; the mutation site is changed from adenine A to cytosine C, and the corresponding amino acid is changed from asparagine N to threonine T, which is p.N386T; and the mutant cDNA sequence of the CYLC1 gene is SEQ ID NO: 2.

[0011] Further, the c.1377G>T / p.K459N homozygous missense mutation of the wild type CYLC1 gene indicates that the 1377th nucleotide point mutation occurs, which is c.1377G>T; the mutation site is changed from guanine G to thymine T, and the corresponding amino acid is changed from lysine K to asparagine N, which is p.K459N; and the mutant cDNA sequence of the CYLC1 gene is SEQ ID NO: 3.

[0012] Further, the c.1402T>G / p.S468A homozygous missense mutation of the wild type CYLC1 gene indicates that the 1402th nucleotide point mutation occurs, which is c.1402T>G; the mutation site is changed from thymine T to guanine G, and the corresponding amino acid is changed from serine S to alanine A, which is p.S468A; and the mutant cDNA sequence of the CYLC1 gene is SEQ ID NO: 4.

[0013] Further, the c.1834T>A / p.C612S homozygous missense mutation of the wild-type CYLC1 gene indicates that a point mutation occurs at the 1834th nucleotide, which is c.1834T>A; the mutation site is from thymine T to adenine A, and the corresponding amino acid is from cysteine C to serine S, which is p.C612S; the mutant cDNA sequence of the CYLC1 gene is SEQ ID NO: 5.

[0014] Another object of the present application is to provide an application of the novel pathogenic gene CYLC1 of the sperm head deformity in preparing a sperm head deformity detection reagent.

[0015] Further, the sperm head deformity detection kit comprises:

[0016] reagents for detecting the 1157th, 1377th, 1402nd and 1834th positions of the CYLC1 gene;

[0017] a specification; wherein it is recorded that the mutations of the base at the 1157th position of the CYLC1 gene from A to C, the base at the 1377th position from G to T, the base at the 1402nd position from T to G and the base at the 1834th position from T to A are pathogenic mutations of the sperm head deformity.

[0018] Further, the reagents are reagents for detecting the 1157th, 1377th, 1402nd and 1834th nucleotide sites by PCR-Sanger sequencing method.

[0019] The reagents comprise a pair of primers for detecting the 1157th, 1377th, 1402nd and 1834th nucleotide sites by PCR, and the length of the amplification product is 915 base pairs; wherein the sequence of the forward primer is SEQ ID NO: 6, the sequence of the reverse primer is SEQ ID NO: 7, and the sequence of the sequencing primer is SEQ ID NO: 8.

[0020] Further, the sperm head deformity detection kit further comprises:

[0021] (1) a kit for extracting peripheral blood genomic DNA, which is stored at room temperature;

[0022] (2) 2X PCR premix, which contains 2X Taq DNA polymerase, 2X PCR reaction buffer and 2X dNTP, and is stored at 4°C;

[0023] (3) a pair of primers for specifically amplifying a product of 915 base pairs in length covering the 1157th, 1377th, 1402nd and 1834th bases in the CYLC1 gene, which is stored at 4°C;

[0024] (4) Double distilled water, PCR tube, room temperature preservation.

[0025] In combination with the above technical solutions and the technical problems solved, the technical solutions to be protected by the present application have the following advantages and positive effects:

[0026] Firstly, in view of the technical problems existing in the prior art and the difficulty in solving the problems, in combination with the technical solutions to be protected by the present application and the results and data in the research and development process, the technical solutions of the present application are analyzed in detail and profoundly on how to solve the technical problems and some creative technical effects brought after the problems are solved. The specific description is as follows:

[0027] 1. Infertility is one of the three major diseases that seriously affect human beings. However, the genetic diagnosis rate of infertility is extremely low. According to a large cohort study, only 4.3% of male infertility patients obtained clear genetic diagnosis through conventional genetic detection process in the past 20 years. Teratospermia is one of the main causes of male infertility, and it is often found in clinical male infertility patients with sperm head deformity and acrosome defect. The present application aims to explore the pathogenic genes and mutations of sperm head deformity, so as to help understand the pathogenesis, gene detection, genetic counseling, prenatal diagnosis and gene therapy.

[0028] 2. At present, there is no research indicating the relationship between CYLC1 gene mutation and sperm head deformity. Therefore, it is particularly necessary to conduct research on the correlation between CYLC1 gene and sperm head deformity. The present application selects four homozygous missense mutations of CYLC1 gene as the detection object of the pathogenic cause of sperm head deformity, which is screened out by the inventors in the work of whole exon sequencing and Sanger sequencing of 332 patients with sperm head deformity. Through the method of the present application, the four homozygous missense mutations of CYLC1 gene in patients with sperm head deformity can be detected simply, quickly and accurately.

[0029] 3. At present, there is no literature report on Cylc1 gene knockout mice. Through the scheme of the present application, the role and regulation mechanism of Calicin-1 protein on sperm acrosome anchoring and head development of mammals can also be revealed by using the Cylc1 gene knockout mouse model established by the present application.

[0030] Secondly, from the perspective of the product as a whole, the technical solutions to be protected by the present application have the following technical effects and advantages, which are described in detail as follows:

[0031] Based on the previous research on Cylc1 gene knockout mice and CYLC1 gene mutation found in patients with globocephalia, the application provides a new pathogenic gene CYLC1 of globocephalia, four homozygous missense mutations are c.1157A>C / p.N386T, c.1377G>T / p.K459N, c.1402T>G / p.S468A and c.1834T>A / p.C612S. CYLC1 gene is a new pathogenic gene of globocephalia, and the four homozygous missense mutations are all new mutation sites, which can be used for preparing a reagent for detecting globocephalia. The application also uses Cylc1 gene knockout mouse model to reveal the physiological role of Calicin-1 protein in anchoring of sperm acrosome and nuclear membrane, and reveals the pathogenesis of globocephalia caused by CYLC1 gene mutation.

[0032] Thirdly, the creativity of the application as the claim is also embodied in the following important aspects:

[0033] (1) The expected income and commercial value of the technical scheme of the application after transformation are:

[0034] At present, it is not clear that CYLC1 gene mutation is a new pathogenic genetic factor of globocephalia, and there is no kit for detecting CYLC1 gene mutation. The kit provided by the application can use patient peripheral blood samples to carry out simple, fast and accurate detection of four homozygous missense mutations of CYLC1 gene, and determine the pathogenic genetic cause of globocephalia patients.

[0035] (2) The technical scheme of the application fills the technical gap in the industry at home and abroad:

[0036] Clinically, the genetic diagnosis rate of globocephalia patients is very low. The application first reveals that CYLC1 gene mutation is a new pathogenic genetic factor of globocephalia, enriches the pathogenic gene spectrum of globocephalia, and the four homozygous missense mutations of CYLC1 gene disclosed in the application have a certain incidence rate in globocephalia patients (14 / 332=4.22%; note: 14 patients carrying CYLC1 gene mutation are found in 332 globocephalia patients in the application). BRIEF DESCRIPTION OF DRAWINGS

[0037] In order to more clearly illustrate the technical scheme of the embodiments of the application, the drawings needed in the embodiments of the application will be briefly introduced as follows. Obviously, the drawings described below are only some embodiments of the application, and other drawings can be obtained by those skilled in the art without creative labor on the basis of these drawings.

[0038] Figure 1 is a Sanger sequencing map of a homozygous missense mutation of c.1157A>C / p.N386T of CYLC1 gene of a patient with sperm head deformity provided by the embodiment of the present application;

[0039] Figure 2 is a phenotype diagram of reduced male fertility, sperm head deformity and acrosome shedding of a Cylc1 gene knockout mouse provided by the embodiment of the present application. DETAILED DESCRIPTION

[0040] In order to make the objectives, technical solutions and advantages of the present application clearer, the present application is further described in detail below with reference to the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and not used to limit the present application.

[0041] In view of the problems in the prior art, the present application provides a new pathogenic gene CYLC1 of sperm head deformity and a mutation detection reagent thereof, which is described in detail below with reference to the drawings.

[0042] I. Explanation of the embodiments. In order to enable those skilled in the art to fully understand how the present application is specifically implemented, this part is an explanation of the embodiments of the technical solution of the claims.

[0043] The new pathogenic gene CYLC1 of sperm head deformity provided by the embodiment of the present application is used as a candidate gene diagnosis object of sperm head deformity, and the cDNA (complementary deoxyribonucleic acid) sequence of the wild-type CYLC1 gene is SEQ ID NO: 1.

[0044] The homozygous missense mutation of c.1157A>C / p.N386T of the wild-type CYLC1 gene provided by the embodiment of the present application indicates that a point mutation of the 1157th nucleotide occurs, that is, c.1157A>C, the mutation site is mutated from adenine A to cytosine C, and the rest is the same as the wild type, and the corresponding amino acid is mutated from asparagine N to threonine T, that is, p.N386T. The mutant cDNA sequence of the CYLC1 gene is SEQ ID NO: 2.

[0045] The homozygous missense mutation of c.1377G>T / p.K459N of the wild-type CYLC1 gene provided by the embodiment of the present application indicates that a point mutation of the 1377th nucleotide occurs, that is, c.1377G>T, the mutation site is mutated from guanine G to thymine T, and the rest is the same as the wild type, and the corresponding amino acid is mutated from lysine K to asparagine N, that is, p.K459N. The mutant cDNA sequence of the CYLC1 gene is SEQ ID NO: 3.

[0046] The homozygous missense mutation of c.1402T>G / p.S468A of the wild-type CYLC1 gene provided by the embodiment of the present application indicates that a point mutation of the 1402th nucleotide occurs, that is, c.1402T>G, the mutation site is mutated from thymine T to guanine G, and the rest is the same as the wild type, and the corresponding amino acid is mutated from serine S to alanine A, that is, p.S468A. The mutant cDNA sequence of the CYLC1 gene is SEQ ID NO:4.

[0047] The homozygous missense mutation of c.1834T>A / p.C612S of the wild-type CYLC1 gene provided by the embodiment of the present application indicates that a point mutation of the 1834th nucleotide occurs, that is, c.1834T>A, the mutation site is mutated from thymine T to adenine A, and the rest is the same as the wild type, and the corresponding amino acid is mutated from cysteine C to serine S, that is, p.C612S. The mutant cDNA sequence of the CYLC1 gene is SEQ ID NO:5.

[0048] The embodiment of the present application provides an application of a new pathogenic gene CYLC1 of a sperm head deformity in preparation of a sperm head deformity detection reagent.

[0049] The sperm head deformity new pathogenic gene CYLC1 kit comprises:

[0050] (a) reagents for detecting the 1157th, 1377th, 1402nd and 1834th positions of the CYLC1 gene;

[0051] (b) an instruction manual, wherein it is recorded that the mutations of the base at the 1157th position of the CYLC1 gene from A to C, the base at the 1377th position from G to T, the base at the 1402nd position from T to G and the base at the 1834th position from T to A are pathogenic mutations of the sperm head deformity.

[0052] Preferably, the reagent provided by the embodiment of the present application is a reagent for PCR detection of the 1157th, 1377th, 1402nd and 1834th nucleotide sites.

[0053] The PCR-Sanger sequencing detection reagent provided by the embodiment of the present application comprises a primer pair for amplifying the 1157th, 1377th, 1402nd and 1834th nucleotide sites by PCR (the length of the amplification product is 915 base pairs), the forward primer sequence is SEQ ID NO:6, the reverse primer sequence is SEQ ID NO:7, and the Sanger sequencing primer sequence is SEQ ID NO:8.

[0054] The embodiment of the present application provides a kit for detecting sperm head deformity based on CYLC1 gene mutation, the base sequence at the 1157th position, the 1377th position, the 1402nd position or the 1834th position of the CYLC1 gene after mutation is changed, and the kit for genetic detection of sperm head deformity comprises the following components:

[0055] (1) a kit for extracting peripheral blood genomic DNA, which is stored at room temperature;

[0056] (2) 2X PCR premix, wherein 2X Taq DNA polymerase, 2X PCR reaction buffer and 2X dNTP (deoxyribonucleoside triphosphate) are contained, and the 2X PCR premix is stored at 4 DEG C;

[0057] (3) a pair of primers for specifically amplifying a product with a length of 915 base pairs covering the 1157th position, the 1377th position, the 1402nd position and the 1834th position of the CYLC1 gene, which is stored at 4 DEG C, and the pair of primers comprises:

[0058] a forward primer as shown in SEQ ID NO: 6;

[0059] a reverse primer as shown in SEQ ID NO: 7;

[0060] (4) double distilled water (ddH2O), which is stored at room temperature;

[0061] (5) a PCR tube, which is stored at room temperature.

[0062] Genomic DNA of a patient's peripheral blood sample is extracted according to the steps of "genomic DNA extraction" in the embodiment, PCR products are obtained according to the steps of "amplification system and PCR amplification conditions" in the embodiment, and commercial sequencing and nucleotide sequence reading of the PCR products are completed according to the steps of "Sanger sequencing" in the embodiment. The sequencing primer is shown in SEQ ID NO: 8.

[0063] The kit for detecting sperm head deformity provided by the embodiment of the present application is a kit for carrying out gene detection on peripheral blood samples of sperm head deformity patients by using PCR amplification and subsequent Sanger sequencing on the basis of nucleotide sequence change caused by CYLC1 gene mutation.

[0064] The following are sequences involved in the scheme of the present application:

[0065] SEQ ID NO: 1: cDNA sequence of human CYLC1 gene

[0066]

[0067] SEQ ID NO: 2: cDNA sequence of the human CYLC1 gene c.1157A>C mutation

[0068]

[0069] SEQ ID NO: 3: cDNA sequence of the human CYLC1 gene c.1377G>T mutation

[0070]

[0071] SEQ ID NO: 4: cDNA sequence of the human CYLC1 gene c.1402T>G mutation

[0072]

[0073] SEQ ID NO: 5: cDNA sequence of the human CYLC1 gene c.1834T>A mutation

[0074]

[0075] SEQ ID NO: 6: Forward amplification primer (5' to 3') ggagactcaaaggatgaaagg

[0076] SEQ ID NO: 7: Reverse amplification primer (5' to 3') caggcaaaggagcatatcttg

[0077] SEQ ID NO: 8: Sequencing primer (5' to 3') ggacacaaagaagtacccag

[0078] II. Application Examples. In order to prove the creativity and technical value of the technical solutions of the present application, this part is the application examples of the technical solutions of the claims on specific products or related technologies.

[0079] In the present application, 332 patients with sperm head deformity were collected in the clinic, and peripheral blood samples were extracted. Through whole exome sequencing, the present application found that 14 patients carried 4 pure missense mutations of CYLC1 gene, i.e. c.1157A>C / p.N386T, c.1377G>T / p.K459N, c.1402T>G / p.S468A and c.1834T>A / p.C612S. Using the kit of the present application, the present application performed genomic DNA extraction, PCR amplification and Sanger sequencing on the peripheral blood samples of the 14 patients, and found that 3 patients carried c.1157A>C / p.N386 pure missense mutation, 9 patients carried c.1377G>T / p.K459N pure missense mutation, 1 patient carried c.1402T>G / p.S468 pure missense mutation, and 1 patient carried c.1834T>A / p.C612S pure missense mutation. The above examples prove that the kit of the present application can quickly, conveniently and accurately detect the 4 mutation sites of CYLC1 gene, which is helpful for the genetic diagnosis of patients with sperm head deformity.

[0080] III. Evidence of the effects of the examples. The examples of the present application have achieved some positive effects during research and development or use, and indeed have great advantages compared with the prior art. The following content is described in combination with the steps, data, tables and the like of the experimental process.

[0081] In the present application, the general representation in the art is used to represent the mutation. For example, in the mutation c.1157A>C / p.N386T, c represents cDNA, p represents protein, A is adenine, C is cytosine, N is asparagine (Asn), and T is threonine (Thr). The mutation of DNA corresponds to the variation of protein amino acid.

[0082] Example: Discovery of CYLC1 gene mutation carried by patients with sperm head deformity and PCR-Sanger sequencing detection.

[0083] Implementation method:

[0084] 1. Collection of clinical samples and semen analysis:

[0085] The present application collected 332 cases of male infertility patients with sperm head deformity in assisted reproduction clinics. The cases were all without normal external genital development, normal size of bilateral testis, no varicocele, and the patients reported no mumps and tuberculosis infection. Peripheral blood chromosome karyotype analysis was normal, and there was no Y chromosome microdeletion. Morphological analysis in semen detection showed that the proportion of normal morphology sperm was <4%, which met the diagnostic criteria of WHO (WHO) for deformity sperm. Sperm smear after Papanicolaou staining showed that the sperm head morphology of the patients was deformed, such as small acrosome and acrosome shedding, and occasionally abnormal nuclear morphology such as fan-shaped head.

[0086] 2. Pathogenic gene mutation screening by whole exome sequencing (WES):

[0087] The present application performed whole exome sequencing on all 332 cases of sperm head deformity, the specific steps are as follows: collecting peripheral blood, using blood genomic DNA extraction kit (Qiagen, Hilden, Germany) to extract genomic DNA in peripheral blood sample; using Illumina kit TruSeq DNA Library Prep Kit to make DNA library, using Agilent kit SureSelect Human All Exon V5 to capture exons, using Illumina Hiseq2000 sequencing platform to perform parallel sequencing reading on the captured exon region; comparing with human reference genome (hg19), using SAMtools to process data and mine SNVs (single nucleotide variation) and InDels (insertion or deletion change); referring to 1000Genomes and ExAC databases, removing mutation sites with allele frequency greater than 1%, finally selecting homozygous mutations, compound heterozygous mutations and hemizygous mutations that have greater effect on amino acids. Whole exome sequencing found that 14 cases of sperm head deformity patients carried CYLC1 gene homozygous missense mutations (c.1157A>C / p.N386T, c.1377G>T / p.K459N, c.1402T>G / p.S468A and c.1834T>A / p.C612S), the incidence was 4.22%, which proved that CYLC1 gene is a clinically valuable detection target for sperm head deformity.

[0088] 3. PCR amplification and Sanger sequencing to verify mutation sites:

[0089] The present application carries out PCR amplification and Sanger sequencing of the mutation site region of CYLC1 gene of 14 patients with sperm head deformity. The specific operation steps are as follows:

[0090] 3.1 Extraction of peripheral blood genomic DNA: Extract peripheral venous blood of patients, extract genomic DNA of peripheral blood samples by using blood genomic DNA extraction kit, OD 260 / OD 280 (absorbance of nucleic acid) is between 1.7 and 2.0, the concentration is >100 nanograms / microliter, and the volume is >30 microliters.

[0091] 3.2 Primer design: Referring to the human genome sequence database hg19, a pair of amplification primers is designed. The forward primer sequence (5' to 3') is ggagactcaaaggatgaaagg (SEQ ID NO: 6), and the reverse primer sequence (5' to 3') is caggcaaaggagcatatcttg (SEQ ID NO: 7). The primers are purified by PAGE (denaturing polyacrylamide gel electrophoresis) and synthesized by Sheng Wu Bioengineering (Shanghai) Co., Ltd. The expected product size is 915 base pairs, covering the 1157th, 1377th, 1402nd and 1834th mutation sites.

[0092] 3.3 Amplification system: 2X PCR premix (containing 2X Taq DNA polymerase, 2X PCR buffer, 2XdNTP) is used, and only appropriate amount of primers, templates and ddH2O are needed to carry out PCR amplification. 25 microliters of amplification system is prepared as follows: template (genomic DNA): 10-100 nanograms, forward primer (10 micromole): 1 microliter, reverse primer (10 micromole): 1 microliter, 2X PCR premix 12.5 microliters, ddH2O to 25 microliters.

[0093] 3.4 PCR amplification conditions: 94℃ denaturation for 5 minutes, then 35 cycles of 94℃ denaturation for 30 seconds, 60℃ annealing for 30 seconds, and 72℃ extension for 1 minute, 72℃ extension for 10 minutes, and the PCR product is temporarily stored at 4℃. Note: PCR amplification instrument needs to be prepared.

[0094] 3.5 Sanger sequencing: SEQ ID NO: 8 is used for sequencing primer and sequencing company such as Sheng Wu Bioengineering (Shanghai) Co., Ltd. is entrusted to carry out Sanger sequencing of PCR product, and base peak chart is obtained. Use biological software such as SnapGene to read the picture, and read the 1157th, 1377th, 1402nd and 1834th base sequences.

[0095] In an embodiment of the present invention, Figure 1 Sanger sequencing results of four homozygous missense mutations in the CYLC1 gene from 14 patients with sperm head malformation. Figure 1 (a) Sanger sequencing profiles of patients (cases 1-3) with homozygous missense mutations in the CYLC1 gene c.1157A>C / p.N386T, with arrows indicating the mutated base sites. Figure 1 (b) Sanger sequencing profiles of patients (cases 4-12) with homozygous missense mutations in the CYLC1 gene c.1377G>T / p.K459N, with arrows indicating the mutated base sites. Figure 1 (c) is the Sanger map of a patient (Case 13) with a homozygous missense mutation in the CYLC1 gene c.1402T>G / p.S468A. Figure 1 (d) is the Sanger sequence map of a patient (Case 14) with a homozygous missense mutation in the CYLC1 gene c.1834T>A / p.C612S. As mentioned above, the simplified steps for obtaining the above Sanger sequencing peak map are as follows: peripheral blood genomic DNA was extracted from patients and normal individuals and PCR amplified using primers SEQ ID NO:6 and SEQ ID NO:7, followed by sequencing and peak map reading using primer SEQ ID NO:8. Figure 1 (e) Transmission electron microscopy images of sperm from cases 2, 4, 7, and 11 show the acrosome detached from the nucleus in sperm from patients with CYLC1 gene mutations. The asterisk indicates the gap between the acrosome and the nuclear membrane. Scale bar: 200 nm.

[0096] like Figure 2 As shown, it is a phenotypic diagram of sperm loss and reduced male fertility in Cylc1 gene knockout mice. Figure 2 (a) To construct Cylc1 knockout mice by targeting exons 3 and 4 using CRISPR / Cas9 gene editing technology, Cylc1 knockout mice were finally obtained after genotyping. Western blot showed that Calicin-1 protein was missing in the testes of the knockout mice. Figure 2 (b) This study showed a significant decrease in male fertility in Cylc1 knockout mice. In a two-month fertility testing experiment, 53 out of 56 female mice in the control group (mated with wild-type males) became pregnant and gave birth to 429 offspring, while only 16 out of 50 female mice mated with Cylc1 knockout males became pregnant and gave birth to 73 offspring. Statistical analysis showed a significant difference in pregnancy rate and litter size (Student's t-test, p < 0.001). Figure 2(c) Graphs showing the number of sperm and total motility of Cylcl knockout mice and wild type mice. The number of sperm was counted using Makler sperm counting chamber and the motility parameters were analyzed by computer assisted sperm analysis (CASA). Student's t test, p>0.05 shows no significant difference. Figure 2 (d) Morphology of sperm of Cylcl knockout mice and wild type mice. Abnormal head shape of Cylcl knockout mice, such as fan-shaped head, can be seen. Scale bar: 5 μm. Figure 2 (e) Peanut agglutinin fluorescein marker (PNA-FITC) staining showing the acrosome loss of elongated sperm cells of Cylcl knockout mice. The asterisk shows the space between the acrosome and the nuclear membrane. Scale bar: 2 μm. Figure 2 (f) Transmission electron microscopy (TEM) images of sperm of Cylcl knockout mice and wild type mice. The acrosome of Cylcl knockout mice is clearly shown to be detached from the nuclear membrane. Scale bar: 200 nm.

[0097] The above merely illustrates the embodiments of the present application, but the protection scope of the present application is not limited thereto, and any modification, equivalent replacement and improvement within the technical range disclosed by the present application, and within the spirit and principle of the present application, should be covered within the protection scope of the present application.

Claims

1. Use of a detection reagent of CYLC1 gene in the preparation of a product for diagnosing globozoospermia.

Images