A genetically engineered yeast strain for producing resveratrol and its construction method and application

Abstract

The present invention provides a yeast genetic engineering bacterium for producing resveratrol and a construction method and application thereof. The engineering bacterium overexpresses resveratrol synthase on the chromosome of Saccharomyces cerevisiae BY4742. STS , p-Coumaryl-CoA ligase 4CL , phenylalanine / tyrosine ammonia lyase TAL , cinnamate-4-hydroxylase C4H , cytochrome P450 enzyme reductase CPR1 , DAHP synthase mutant ARO4 , chorismate mutase mutant ARO7 Chorismate synthase ARO2 shikimate kinase AroL , acetyl-CoA synthetase ACS and malonyl-CoA synthetase ACC1 , and knock out bypass genes CIT2, LPP1, DPP1, and PDC6 at the same time, to achieve biosynthesis of resveratrol using glucose as a substrate. The present invention utilizes phenylalanine / tyrosine ammonia lyase to react with phenylalanine and tyrosine as substrates to generate key precursors for resveratrol synthesis, strengthens the precursors required for resveratrol synthesis, and greatly increases the yield of the product resveratrol.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a yeast genetic engineering bacterium for producing resveratrol, a construction method and an application thereof. Background Art

[0002] Resveratrol (3,4',5-trihydroxystilbene) is a natural active substance. It is an antitoxin secreted by plants in harsh environments or when attacked by pathogens. It is widely found in natural plants such as peanuts, grapes, knotweed and cassia seeds. Recent studies have shown that resveratrol has antioxidant, anti-tumor, anti-free radical, liver protection, cardiovascular protection, immune regulation, anti-virus, anti-bacterial and anti-fungal, anti-allergic, radiation protection, and prevention of acute infectious atypical pneumonia. It can be widely used in medicine, food, cosmetics and health products, and is a natural compound with great potential.

[0003] At present, resveratrol products are divided into three types according to the production method, including plant extraction, synthesis and fermentation. Each type has corresponding application industries, including dietary supplements, cosmetics, food and beverages, etc. At present, the main production method of resveratrol is plant extraction. Foreign countries mainly extract it from grape skins and grape seeds, while my country mainly extracts it from the roots of the Chinese medicinal material Polygonum cuspidatum, which occupies a dominant position in the market. However, the content of resveratrol in plant tissues is not high, the extraction process is complicated and the extraction efficiency is low, and a large amount of raw materials are consumed. The price of Polygonum cuspidatum is relatively expensive, the growth cycle is long, and it is easily affected by climate change, which affects its production cost and controllability to a certain extent. Resveratrol synthesized by chemical synthesis has the same biological activity as naturally extracted resveratrol, and can quickly produce resveratrol in large quantities to meet market demand. However, the chemical synthesis method has problems such as long synthesis route, high production cost, and serious environmental pollution. It is necessary to explore new methods with low production cost and green environmental protection. In view of the shortcomings of plant extraction and chemical synthesis, researchers are looking for biosynthetic methods with high yield, low energy consumption and less environmental sacrifice, especially microbial synthesis methods with advantages such as easy fermentation production, short production cycle, low production cost, simple product purification and less environmental pollution. In recent years, with the progress of microbial metabolic engineering and synthetic biology technology, designing and constructing efficient heterologous synthesis pathways in microorganisms and combining large-scale fermentation of engineered strains are important methods to achieve industrial production of plant-derived natural products such as resveratrol.

[0004] In recent years, research on the production of resveratrol based on microbial cell factories has made a lot of progress. For example, heterologous fermentation synthesis of resveratrol has been achieved in host bacteria such as Escherichia coli, Saccharomyces cerevisiae, Yarrowia lipolytica, and Corynebacterium glutamicum, but there are still some problems that need to be solved. It is worth noting that under the premise of relieving feedback inhibition, the copy number of the heterologous synthesis pathway of resveratrol in Yarrowia lipolytica was increased, and a higher resveratrol yield was obtained (Sáez-Sáez J, Wang G, Marella ER, et al, Engineering the oleaginous yeast Yarrowialipolytica for high-level resveratrol production [J], Metabolic Engineering, 2020, 62: 51-61. However, compared with model microorganisms such as Saccharomyces cerevisiae, systematic research on Yarrowia lipolytica is still relatively limited, which is not conducive to systematic optimization of metabolic pathways, and will limit its further improvement of the fermentation yield of compounds such as resveratrol.

[0005] Among the various model microorganisms that are currently widely used, Saccharomyces cerevisiae is the first model eukaryotic organism to be sequenced in its entire genome. It is a generally recognized as safe (GRAS) strain that contains organelles such as the endoplasmic reticulum, mitochondria, and vacuoles, which provide a basis for the localization and correct folding of plant-derived membrane proteins and have unique advantages in the heterologous synthesis of plant-derived natural products. In addition, Saccharomyces cerevisiae has a high DNA recombination efficiency and mature gene editing technology, which provides a good foundation for the design, construction, and optimization of recombinant Saccharomyces cerevisiae engineering strains. However, the highest yield of the Saccharomyces cerevisiae engineering strains reported to produce resveratrol after batch feed fermentation is only 0.8 g / L (Li M, Schneider K, Kristensen M, et al, Engineering yeast for high-level production of stilbenoid antioxidants [J], Scientific Reports, 2016, 6 (1)), which hinders the industrialization of efficient biosynthesis of resveratrol. In addition, other reported recombinant Saccharomyces cerevisiae engineered strains either utilize the phenylalanine pathway, or utilize the tyrosine pathway, or use two genes to achieve simultaneous utilization of the phenylalanine pathway and the tyrosine pathway, and no reports have been found on the use of bifunctional genes to achieve efficient synthesis of resveratrol. Based on the research of predecessors, this application designs and constructs a series of recombinant Saccharomyces cerevisiae engineered strains with a new idea, and applies them to the efficient synthesis of resveratrol. Summary of the invention

[0006] The invention provides a yeast genetic engineering bacterium for producing resveratrol, and provides a new path for the efficient synthesis of resveratrol. The genetic engineering bacterium contains a resveratrol synthase gene STS, a p-coumaryl-CoA ligase gene 4CL, a phenylalanine / tyrosine ammonia lyase gene TAL, a cinnamate-4-hydroxylase gene C4H, a cytochrome P450 enzyme reductase CPR1 gene, a malonyl-CoA synthetase ACC1 gene, a DAHP synthase mutant ARO4 gene, a chorismate mutase mutant ARO7 gene, a chorismate synthase ARO2 gene, a shikimate kinase AroL gene, and an acetyl-CoA synthetase gene ACS, and by knocking out bypass genes CIT2, LPP1, DPP1, and PDC6, so as to realize the biosynthesis of resveratrol using glucose as a substrate.

[0007] The resveratrol synthase gene STS, p-coumaryl-CoA ligase gene 4CL, phenylalanine / tyrosine ammonia lyase gene TAL, cinnamate-4-hydroxylase gene C4H, cytochrome P450 enzyme reductase CPR1 gene, and malonyl-CoA synthetase ACC1 gene have nucleotide sequences as shown in SEQ ID NOs: 1 to 6, respectively.

[0008] Preferably, the resveratrol synthase gene STS, p-coumaroyl-CoA ligase gene 4CL, phenylalanine / tyrosine ammonia lyase gene TAL, cinnamate-4-hydroxylase gene C4H, cytochrome P450 enzyme reductase gene CPR1, DAHP synthase mutant ARO4 gene, chorismate mutase mutant ARO7 gene, chorismate synthase ARO2 gene, shikimate kinase AroL gene, acetyl-CoA synthetase gene ACS and malonyl-CoA synthetase ACC1 gene are all placed on the chromosome of Saccharomyces cerevisiae for expression; wherein the expression copy number of the resveratrol synthase gene STS, p-coumaroyl-CoA ligase gene 4CL and phenylalanine / tyrosine ammonia lyase gene TAL is ≥1.

[0009] Preferably, the resveratrol synthase gene STS is derived from grape (Vitis vinifera); the p-coumaryl-CoA ligase gene 4CL is derived from parsley (Petroselinum crispum); the phenylalanine / tyrosine ammonia lyase gene TAL is derived from Rhodotorula toruloides; the cinnamate-4-hydroxylase gene C4H and the cytochrome P450 enzyme reductase gene CPR1 are derived from Arabidopsis thaliana; the acetyl-CoA synthetase gene ACS is derived from Salmonella enterica; the DAHP synthase mutant ARO4 gene, the chorismate mutase mutant gene ARO7, the chorismate synthase gene ARO2, and the malonyl-CoA synthetase gene ACC1 are derived from Saccharomyces cerevisiae, and are respectively obtained by PCR amplification using the genome of Saccharomyces cerevisiae as a template; the shikimate kinase AroL gene is derived from Escherichia coli, and is obtained by PCR amplification using the genome of Escherichia coli as a template.

[0010] Preferably, the nucleotide sequences of the resveratrol synthase gene STS, p-coumaryl-CoA ligase gene 4CL, phenylalanine / tyrosine ammonia lyase gene TAL, cinnamate-4-hydroxylase gene C4H, cytochrome P450 enzyme reductase gene CPR1, and acetyl-CoA synthetase gene ACS are synthesized after codon optimization according to the codon preference of Saccharomyces cerevisiae.

[0011] At the same time, the present invention provides a method for constructing a yeast genetically engineered bacterium for producing resveratrol, which introduces a heterologous synthesis pathway of resveratrol, that is, utilizes phenylalanine / tyrosine ammonia lyase to simultaneously catalyze the aminolysis of tyrosine and phenylalanine of the engineered bacterium to generate key intermediates cinnamic acid and p-coumaric acid; wherein cinnamic acid produces p-coumaric acid through the action of cinnamic acid-4-hydroxylase C4H and cytochrome P450 enzyme reductase CPR, and p-coumaric acid produces p-coumaric acid through p-coumaryl-CoA ligase 4CL, and then generates resveratrol under the action of resveratrol synthase STS; at the same time, metabolic engineering means are utilized to strengthen the synthesis pathway of aromatic amino acids and malonyl-CoA of the recombinant bacterium, the bypass gene is knocked out to reduce the consumption of acetyl-CoA, and the precursors required for the synthesis of resveratrol are strengthened, so that the yield of the product resveratrol is greatly improved. Among them, the gene RgTAL has dual functions and can simultaneously use phenylalanine and tyrosine as substrates to react and generate key precursors for resveratrol synthesis. The SeACS, ACC1, ARO2, AROL, ARO4 and ARO7 genes are related to the supply of precursors for resveratrol synthesis, including the enhanced synthesis of malonyl-CoA and aromatic amino acids. Genes such as PDC6 and CIT2 are metabolic bypass genes, which are used as one of the target integration sites to insert the target expression fragment and knock out the original gene at the same time.

[0012] The specific steps include:

[0013] (1) Using overlap extension PCR technology or other vector construction methods to obtain the expression cassette of each target gene, that is, containing the promoter-target gene-terminator sequence, so that the gene to be expressed has a strong constitutive promoter and terminator of Saccharomyces cerevisiae, and obtaining the DNA fragment of the expression cassette by PCR technology;

[0014] (2) Using specific primers to amplify the homology arm sequence 300-1000 bp upstream and downstream of the target integration site, and connect it with the target gene expression frame to be expressed through overlap extension PCR amplification technology to obtain the gene expression frame fragment integrated at a specific site on the Saccharomyces cerevisiae chromosome;

[0015] (3) Connecting the nutritional deficiency screening tag genes His3, Ura3, Leu2, and Lys2 to the target gene expression frame fragment and upstream and downstream homology arm sequences, and transforming them into Saccharomyces cerevisiae competent cells, integrating the genes into the chromosomes through homologous recombination for overexpression, and then screening positive clones in the Saccharomyces cerevisiae competent cells in a defective culture medium lacking histidine, uracil, leucine, and lysine;

[0016] Alternatively, construct a CRISPR-Cas9 plasmid with a specific recognition site, and transform it into Saccharomyces cerevisiae competent cells together with the corresponding upstream and downstream homology arm sequences and the target gene expression frame sequence to knock out and integrate the gene of Saccharomyces cerevisiae, and screen positive clones on a plate containing geneticin resistance;

[0017] (4) Inoculate a single colony grown on the plate into YPD liquid culture medium and culture for 16-36 hours. Perform PCR amplification to verify the genome and obtain a resveratrol yeast genetic engineering strain.

[0018] As a further improvement of the construction method of yeast genetic engineering bacteria for resveratrol, the target gene expression frame is constructed on the G418 plasmid and obtained by PCR amplification, as follows:

[0019] (1) Using plasmid G418 as a template, the Pc4CL-VvSTS gene, RgTAL-VvSTS gene, AtCPR1-AtC4H gene, ARO4-ARO7 gene, AROL-ARO2 gene and ACC1 gene were expressed in tandem on plasmid G418, respectively, to construct plasmid G418-PV, plasmid G418-TS, plasmid G418-C4H, plasmid G418-Aro47, plasmid G418-AroL2 and plasmid G418-ACC1;

[0020] (2) Using plasmid G418-PV, plasmid G418-TS, plasmid G418-C4H, plasmid G418-Aro47, plasmid G418-AroL2 and plasmid G418-ACC1 as templates, the target gene expression cassette was amplified by PCR;

[0021] The plasmid construction method in step (1) is as follows:

[0022] The plasmid G418 backbone fragment and the integrated gene fragment were obtained by PCR amplification. The fragments were mixed and added to In-fusi on Cloning Mixture. The reaction was carried out at 50°C for 50 minutes. The resulting transformation solution was transferred into Escherichia coli competent cells, and the single colonies were verified. Finally, the correct plasmid was verified by sequencing.

[0023] As a further improvement of the construction method of yeast genetic engineering bacteria for producing resveratrol, the method of constructing a recombinant strain by screening a tag gene through nutritional deficiency is as follows:

[0024] Using Saccharomyces cerevisiae as the starting strain, using the nutritional deficiency genes His3 and Ura3 and Leu2 and Lys2 as screening tags, the target gene expression cassette was integrated into the YORWΔ17 site, Ura3 site, Leu2 site and Lys2 site of the Saccharomyces cerevisiae genome to construct a recombinant strain; the specific construction method is as follows:

[0025] The cerevisiae yeast is a model strain BY4742 (MATα, his3Δ1, leu2Δ0, lys2Δ0, Ura3Δ0), which cannot grow in CM medium lacking histidine, leucine, lysine and uracil;

[0026] The CM culture medium contains the following components: 0.67 g / L amino-free yeast nitrogen source (YNB), 20 g / L glucose, 0.15 g / L threonine, 0.03 g / L tyrosine, 0.15 g / L valine, 0.10 g / L glutamic acid, 0.15 g / L serine, 0.1 g / L aspartic acid, 0.02 g / L methionine, 0.05 g / L phenylalanine, 0.03 g / L isoleucine, 0.02 g / L arginine, 0.05 g / L adenine, 0.1 g / L tryptophan, and other nutrients (0.03 g / L lysine, 0.05 g / L uracil, 0.1 g / L histidine, 0.1 g / L leucine), and the pH is adjusted to 5.6-6.5 by using sodium hydroxide; and 2% agar powder is added to the solid culture medium.

[0027] As a further improvement of the method for constructing a yeast genetically engineered bacterium for producing resveratrol, the CRISPR-Cas9 plasmid capable of recognizing specific sites is used to perform CRISPR-Cas9 gene manipulation, and the coding gene sequences of the CIT2, LPP1, PDC6 and DPP1 sites on the Saccharomyces cerevisiae genome are knocked out respectively, and the gene expression frames of RgTAL-VvSTS, RgTAL-VvSTS, ACC1S659A / S1157A and Pc4CL-VvSTS are correspondingly integrated to obtain a recombinant engineered strain; or, the coding sequence of the PHA2 site on the Saccharomyces cerevisiae genome is knocked out to construct a recombinant engineered strain; or, the expression frame of the target gene is inserted into the 1309a, 511b, 911b sites on the Saccharomyces cerevisiae genome to construct a recombinant engineered bacterium.

[0028] The CRISPR-Cas9 plasmid capable of recognizing specific sites is constructed as follows:

[0029] The original pCas plasmid is amplified by PCR or seamlessly cloned using primers with recognition sequences of specific recognition sites to replace the specific 20bp recognition sequence on the pCas plasmid, obtain the pCas plasmid of the specific site, and then transform it into competent E. coli cells, pick a single colony to culture in the culture medium, extract the plasmid and perform sequencing verification;

[0030] The specific recognition site and its recognition sequence are as follows:

[0031] CIT2:GTTATGGTCATGCTGTGCTA;

[0032] LPP1:GCCATGACAGAGATCATCCT;

[0033] PHA2:TCAGCGACAAAAGTAAACAG;

[0034] 1309a: CCTGTGGTGACTACGTATCC;

[0035] 511b: CAGTGTATGCCAGTCAGCCA;

[0036] PDC6:GATGCGTGCGTAACCATCGG;

[0037] 911b: GTAATATTGTCTTGTTTCCC;

[0038] DPP1: GATCGTTGCCAACCTGTTGA.

[0039] At the same time, the present invention also provides the application of the yeast genetic engineering bacteria for producing resveratrol, and resveratrol is synthesized in different fermentation media using the recombinant engineering strains. That is, a single colony is picked from a plate or the recombinant engineering bacteria are inoculated into a 2-20 mL liquid culture medium from a glycerol storage tube, and cultured for 16-36 hours to obtain a seed liquid; the seed liquid is inoculated into a fermentation medium containing substrate glucose, and fermentation culture is performed to achieve the synthesis of resveratrol, the culture temperature is 28-33°C, the culture time is 48-156 hours, the pH is 4.5-6.5, glucose is added during the fermentation process, and the yield of synthesized resveratrol varies greatly according to the characteristics of the recombinant engineering strain and the culture method, and the maximum amount is 4.0 g / L.

[0040] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0041] (1) The genetically engineered bacteria of the present invention integrate resveratrol synthase STS, p-coumaryl-CoA ligase 4CL, phenylalanine / tyrosine ammonia lyase TAL, cinnamate-4-hydroxylase C4H, cytochrome P450 enzyme reductase CPR, DAHP synthase mutant ARO4, chorismate mutase mutant ARO7, chorismate synthase ARO2, shikimate kinase AroL, acetyl-CoA synthetase ACS and malonyl-CoA synthetase ACC1 genes, complement the four nutritional deficiency genes of Saccharomyces cerevisiae BY4742, and knock out the CIT2, LPP1, DPP1 and PDC6 bypass genes at the same time. The finally obtained recombinant Saccharomyces cerevisiae genetically engineered strain significantly increases the content of the product resveratrol.

[0042] (2) The genetically engineered bacteria of the present invention utilize phenylalanine / tyrosine ammonia lyase TAL to synthesize resveratrol, and can simultaneously utilize phenylalanine and tyrosine as substrates to generate precursors required for resveratrol synthesis, thereby increasing the synthesis flux of resveratrol and ultimately increasing the content of resveratrol in the extract.

[0043] (3) The heterologous gene expression of the genetically engineered bacteria of the present invention is stable, and the fermentation does not require the addition of antibiotics, inducers, nutritionally deficient amino acids, etc., thereby reducing the production cost; there is no need to add exogenous precursors such as p-coumaric acid, cinnamic acid, phenylalanine, tyrosine, and additives such as cyanobacterium, thereby avoiding the toxicity of additives to cells. The fermentation process is simple and controllable, providing a simple and effective implementation method for the safe biological production of resveratrol, and has good industrial application potential.

[0044] (4) The genetically engineered bacteria of the present invention are based on the model yeast Saccharomyces cerevisiae. During the construction of the engineered bacteria, the information such as the gene expression frame, integration site, and copy number are clear, and the genetic background of the strain is clear, which is conducive to increasing the yield of resveratrol. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 Metabolic pathway diagram for the synthesis of resveratrol by genetically engineered bacteria.

[0046] Figure 2 Plasmid map of the gene expression cassette for the resveratrol biosynthesis pathway.

[0047] Figure 3 Map of the plasmid pCas required for CRISPR-Cas9 gene editing technology.

[0048] Figure 4 This is the spectrum and standard curve of HPLC detection of p-coumaric acid and resveratrol in Example 3.

[0049] Figure 5 This is the process of producing resveratrol by fermentation of the recombinant engineered bacteria in synthetic culture medium in Example 3.

[0050] Figure 6 Batch-fed-batch fermentation process of the recombinant engineered bacteria in Example 4. DETAILED DESCRIPTION

[0051] The present invention will be further described below in conjunction with the accompanying drawings.

[0052] In the following examples, only typical construction methods are listed for the construction of recombinant bacteria, and the construction process of each engineered bacteria is not listed in detail. However, the bacterial species and their genotypes involved in the present invention are listed in Table 1, and the recombinant strains of the present invention can be obtained according to the genotype construction.

[0053] Table 1:

[0054]

[0055]

[0056] Example 1: Construction of genetically engineered yeast expressing resveratrol

[0057] 1. Construction of target gene expression cassette

[0058] Using plasmid G418 as a template, PV gene, TS gene, gene C4H, as well as Saccharomyces cerevisiae promoter genes PGK1, TEF1, TDH3, and Saccharomyces cerevisiae terminator genes tADH1 / tCYC were tandemly connected on plasmid G418. After sequencing verification, G418-PV plasmid, G418-TS plasmid, and G418-C4H plasmid containing Saccharomyces cerevisiae promoter and terminator genes were constructed; the same method was used to construct plasmids G418-Aro47, G418-AroL2, and G418-ACC1, which were used to improve the precursor supply of recombinant engineered bacteria and increase the yield of resveratrol. The specific plasmid maps are shown in the following figure. Figure 2 shown.

[0059] After the construction of the above 6 plasmids was completed, they were sequenced and verified, and the gene expression cassette sequence was obtained by amplification, and then amplified by overlapping extension PCR with the upstream and downstream homology arm sequences of the target integration site and the nutritional deficiency screening tag to construct the target gene expression cassette.

[0060] Among them, tADH1 / tCYC is the terminator of Saccharomyces cerevisiae, and PGK1, TEF1, and TDH3 are promoters of Saccharomyces cerevisiae, which can all be amplified from the genome of Saccharomyces cerevisiae or obtained by gene synthesis.

[0061] The resveratrol pathway genes RgTAL, Pc4CL and STS were synthesized by optimizing the codon preference of Saccharomyces cerevisiae. The construction method of the related plasmids is a common molecular biological method.

[0062] This example uses the seamless cloning (In-fusion) method to construct the plasmid. First, primers GJ-F and GJ-R are used to amplify the backbone of plasmid G418. This backbone can be used to construct the six plasmids involved in this example, as follows:

[0063] (1) Primers G418-PV-F1 / R1, G418-PV-F2 / R2, and G418-F3 / R3 were used to amplify Pc4CL, PGK1-TEF1, and VvSTS fragments, respectively. The PCR products were subjected to agarose gel electrophoresis, and the bands of the correct size were cut out and the genes were recovered. The concentration of the purified gene fragments was measured by NanoDrop, and the fragments were mixed according to the system of 50 ng backbone and 100 ng fragments, added to In-Fusion 2X Mixture, mixed evenly, and then incubated at 50°C for 50 minutes to obtain the recombinant product. The recombinant product was transformed into Escherichia coli competent cells, and after preliminary verification by colony PCR, it was sent to the company for sequencing verification to obtain the plasmid G418-PV.

[0064] (2) According to the method of step (1), primers G418-TS-F0, G418-TS-F1 / R1, G418-TS-F2 / R2, and G418-TS-F3 / R3 were used to amplify RgTAL, PGK1-TDH3, and VvSTS fragments, which were seamlessly cloned and connected to the backbone and verified to obtain plasmid G418-TS;

[0065] (3) According to the method of step (1), primers G418-C4H-F1 / R1, G418-C4H-F2 / R2, and G418-C4H-F3 / R3 were used to amplify the AtCPR1, PGK1-TEF1, and AtC4H fragments, and seamlessly cloned and connected with the backbone and verified to obtain plasmid G418-C4H;

[0066] (4) According to the method of step (1), primers G418-AroL2-F1 / R1, G418-AroL2-F2 / R2, and G418-AroL2-F3 / R3 were used to amplify AROL, PGK1-TEF1, and ARO2 fragments, respectively, and seamlessly cloned and connected with the backbone and verified to obtain plasmid G418-AroL2.

[0067] (5) For the plasmid containing the mutant gene, primers G418-Aro47-F1 / R1 / F2 / R2 were used to amplify the fragments on both sides of the mutation site of ARO4, and primers G418-Aro47-F4 / R4 / F5 / R5 were used to amplify the two fragments of ARO7. G418-Aro47-F1 / R2 and G418-Aro47-F4 / R5 were used as primers, and the corresponding ARO4 and ARO7 fragments were used as templates to amplify the gene fragments of ARO4 and ARO7. Finally, seamless cloning and connection were performed and verified to obtain the plasmid G418-Aro47.

[0068] (6) The construction of plasmid G418-ACC1 was carried out by using G418-PV plasmid as template and primers GJ-F and G418-ACC1-R0 to obtain the G418-PV backbone (containing the promoter sequence), and then primers G418-ACC1-F1 / R1 / F2 / R2 / F3 / R3 were used to amplify ACC1 S659A / S1157A The three fragments of the mutant were directly cloned seamlessly with the G418-PV backbone, and finally transformed into Escherichia coli and sequenced to obtain plasmid G418-ACC1.

[0069] The primer sequences used above are shown in Table 2.

[0070] Table 2:

[0071]

[0072]

[0073] The above gene expression frame, ie, the sequence between tADH1-tCYC, can be constructed on a G418 plasmid, or can be constructed on any plasmid backbone, or obtained by overlapping extension PCR amplification, the main purpose of which is to obtain a complete gene expression frame sequence.

[0074] 2. Construction of recombinant Saccharomyces cerevisiae engineering strains through nutritional deficiency screening tags

[0075] Taking the construction of the recombinant engineering bacteria BR1 in Table 1 as an example, the strain uses His3 as a screening tag and integrates the expression frame of Pc4CL-VvST S into the YORWΔ17 site of the Saccharomyces cerevisiae genome. The specific operation process is as follows:

[0076] (1) Use primer pairs YORW-Up-F / YORW-Up-R and YORW-Down-F / YORW-Down-R to amplify homology arm sequences upstream and downstream of the integration site;

[0077] (2) amplifying the synthetic His3 screening tag using primer pair Y-His3-F / Y-His3-R;

[0078] (3) The G418-PV plasmid was amplified using primer pair Y-TADH1-F / Y-TADH1-R to obtain the expression cassette of Pc4CL-VvSTS. The relevant amplified products were detected by agarose gel electrophoresis and recovered by gel excision to obtain four fragments: 500 bp of the upstream homology arm of YORW, 1000 bp of the His3 screening tag, the Pc4CL and VvSTS expression cassettes, and the downstream homology arm of YORW.

[0079] The primer sequences required for amplification are shown in Table 3.

[0080] Table 3:

[0081]

[0082] (4) Transform the fragments recovered from the gel into competent yeast cells as follows:

[0083] 1) Streak the glycerol bacteria of Saccharomyces cerevisiae on a non-antibiotic YPD plate for 2-3 days, pick a single colony and inoculate it into YPD liquid culture medium, shake it at 30℃ and 220r / min, and activate it overnight.

[0084] 2) Transfer the overnight culture solution into 50 mL YPD medium so that its initial OD600 is 0.2.

[0085] 3) Cultivate at 30℃ in a shaker at 220r / min until OD600 reaches 0.8, then collect the cells by centrifugation at 3600r / min for 5min. Wash twice by centrifugation with sterilized ddH2O, adding 35mL of ddH2O each time.

[0086] 4) Add 900 μL sterile ddH2O to resuspend, dispense 100 μL into each 1.5 mL centrifuge tube, centrifuge and discard the supernatant.

[0087] 5) Add 360 μL of transformation system to the cell pellet and mix well with a pipette; the transformation system is shown in Table 4.

[0088] Table 4:

[0089]

[0090] 6) The transformation system was placed in a 30°C water bath for 20 min, followed by heat shock at 42°C for 40 min. 180 μL was plated and cultured at 30°C for 2-3 days. After a single clone was grown, verification was performed.

[0091] 7) The single clone was spread on CM-His (i.e. lacking histidine) medium for screening and culture to obtain the yeast genetic engineering bacteria BR1.

[0092] (5) According to the method of steps (1)-(4), strain BR1 is used as the starting strain, Ura3 is used as the screening tag, the gene expression frame of RgTAL-VvSTS is integrated into the Ura3 site, and the recombinant strain is coated in CM-His-Ura (i.e., lacking histidine and uracil) medium for screening to obtain the genetically engineered yeast BRT2; this strain can directly use glucose as a carbon source to synthesize resveratrol;

[0093] Using strain BRT3 as the starting strain and Leu2 as the screening tag, the AtCPR1-At gene C4H expression cassette was integrated into the Leu2 site, and screening was performed using CM_His-Ura-Leu (i.e., lacking histidine, uracil, and leucine) medium to obtain the cerevisiae genetically engineered strain BRT4;

[0094] Using strain BRT9 as the starting strain and Lys2 as the screening tag, the Lys2 sequence was directly integrated, and the cerevisiae genetically engineered strain BRT10 was screened using an amino acid-free culture medium (containing only 20 g / L glucose, 6.7 g / L amino-free yeast nitrogen source, and 20 g / L agar powder).

[0095] The CM culture component content is as follows: 0.67g / L of amino-free yeast nitrogen source (YNB), 20g / L of glucose, 0.15g / L of threonine, 0.03g / L of tyrosine, 0.15g / L of valine, 0.10g / L of glutamic acid, 0.15g / L of serine, 0.1g / L of aspartic acid, 0.02g / L of methionine, 0.05g / L of phenylalanine, 0.03g / L of isoleucine, 0.02g / L of arginine, 0.05g / L of adenine, 0.1g / L of tryptophan and other nutrients (0.03g / L of lysine, 0.05g / L of uracil, 0.1g / L of histidine, 0.1g / L of leucine), and the pH is adjusted to 5.6-6.5 by sodium hydroxide. 2% of agar powder is added to the solid culture medium. When the corresponding amino acids are omitted in the culture medium as needed, it can be used to screen recombinant saccharomyces cerevisiae engineering bacteria.

[0096] The monoclonal clones grown on the plates were picked up and placed in the corresponding liquid culture medium. The culture was activated at 30°C and shaken at 220 r / min for 16-36 hours. 2 mL of the bacterial solution was collected by centrifugation. The genome of the transformants was extracted according to the conventional phenol-chloroform genome extraction method. PCR amplification was performed for verification. The size of the amplified band was used to determine whether the integration was successful.

[0097] The metabolic pathway for synthesizing resveratrol by the genetically engineered bacteria constructed in this example and the genes involved are as follows: Figure 1 shown.

[0098] Example 2: Construction of recombinant Saccharomyces cerevisiae engineered bacteria by CRISPR-Cas9

[0099] Since only four nutritional deficiency screening tags can be used in Saccharomyces cerevisiae BY4742, after four integrations, no tag recovery will result in no screening tags available. Therefore, this embodiment develops and utilizes the CRISPR-Cas9 gene editing method to construct a recombinant strain, and the original pCas plasmid is subjected to full plasmid PCR amplification using primers with recognition sequences of specific recognition sites to obtain PCR amplification products, and restriction endonucleases Dpn I and their buffer are added to the amplified products, and the products are incubated at 37°C for 10-90 minutes. The obtained products are transformed into competent Escherichia coli cells, and single colonies are picked and cultured in culture medium for 8-16 hours, and plasmids are extracted and sequenced for verification.

[0100] Taking the recombinant bacteria BRT3 constructed in Example 1 as an example, the details are as follows:

[0101] The RgTAL-VvSTS expression cassette was integrated into the CIT2 locus to knock out the CIT2 gene of Saccharomyces cerevisiae and achieve the expression of RgTAL-VvSTS. The operation process is as follows:

[0102] (1) Primer pairs CIT2-Up-F / CIT2-Up-R and CIT2-Down-F / CIT2-Down-R were used to amplify the homology arm sequences upstream and downstream of the integration site, respectively. Primer pair CIT2-tADH-F / CIT2-tCYC1-R was used to amplify plasmid G418-TS to obtain the expression frame of RgTAL-VvSTS. The relevant amplified products were detected by agarose gel electrophoresis and recovered by gel excision to obtain three fragments of the integration site of CIT2. Alternatively, the complete integration fragment could be further amplified by overlap extension PCR.

[0103] (2) The CIT2-pCas plasmid and the integration fragment of the CIT2 site were transformed according to the above-mentioned Saccharomyces cerevisiae transformation method, and spread on YPD plates containing G418 and cultured at 30°C for 2-3 days.

[0104] The pCas plasmid maps involved are as follows Figure 3 As shown, the specific recognition sequence of the knockout or integration site involved is shown in Table 5. The specific 20bp recognition sequence on the original plasmid can be replaced by whole plasmid PCR amplification, seamless cloning, etc. to obtain the pCas plasmid of the specific site, and the correctness of the recognition sequence can be verified by sequencing.

[0105] Table 5:

[0106]

[0107] After the single colony obtained by plate culture was cultured in YPD liquid medium containing G418 for 16-36 hours, the recombinant bacteria obtained by screening by nutritional deficiency labeling in Example 1 were screened, and finally positive clones were obtained. The positive clones were subcultured in YPD medium without antibiotics until the pCas plasmid was lost, that is, a CRISPR-Cas9 gene editing was completed.

[0108] According to the above method, new recombinant engineering bacteria were constructed based on other recombinant engineering strains in Table 1, as follows:

[0109] (1) Using strain BRT2 as the starting strain and PHA2-pCas plasmid as the specific recognition plasmid, a recombinant engineered bacterium BRT3-1 with the PHA2 gene knocked out was constructed.

[0110] (2) Using strain BRT4 as the starting strain and LPP1-pCas plasmid as the specific recognition plasmid, the RgTAL-VvSTS expression cassette was integrated on the basis of knocking out the LPP1 coding sequence to construct the recombinant engineered bacterium BRT5.

[0111] (3) Using strain BRT5 as the starting strain and 1309a-pCas plasmid as the specific recognition plasmid, the ARO4-ARO7 expression cassette was integrated to construct the recombinant engineered bacterium BRT6.

[0112] (4) Using strain BRT6 as the starting strain and 511b-pCas plasmid as the specific recognition plasmid, the AROL-ARO2 expression cassette was integrated to construct the recombinant engineered bacterium BRT7.

[0113] (5) Using strain BRT7 as the starting strain and PDC6-pCas plasmid as the specific recognition plasmid, the ACC1 S659A / S1157A expression frame was integrated to construct the recombinant engineered strain BRT8.

[0114] (6) Using strain BRT7 as the starting strain, 911b-pCas plasmid as the specific recognition plasmid, and integrating the SeACSL641P expression cassette, the recombinant engineered bacterium BRT8-1 was constructed.

[0115] Example 3: Fermentation of resveratrol by recombinant engineered bacteria

[0116] 1. Detection method of resveratrol

[0117] Resveratrol was mainly detected by HPLC, and the detection conditions were: Shimadzu LC-20ADXRHPLC system; SPD-20A UV-visible detector; Kinetex 5μm C18 LC Column (250×4.6 mm); mobile phase A = acetonitrile, mobile phase B = water (containing 0.1% formic acid). Gradient elution conditions: flow rate 1 mL / min; column temperature: 30°C; injection volume: 20 μL; detection wavelength: 303 nm. Gradient elution conditions: 0 min, 5% A, 95% B; 3 min: 10% A, 90% B; 5 min: 30% A, 70% B; 10 min: 70% A, 30% B; 10.5 min: 95% A, 5% B; 10.5-12.5 min: 95% A, 5% B; 13 min: 5% A, 95% B; 16 min, end.

[0118] This method was used to detect the mixed solution of resveratrol and intermediate p-coumaric acid. The test results are as follows: Figure 4 As shown, the peak time of resveratrol is about 10.1 min, and the peak time of p-coumaric acid is about 9.1 min.

[0119] Sample processing method: After the fermentation is completed, the fermentation liquid (including the bacteria and the liquid mixture) is extracted with ethyl acetate, dried by rotation, and re-dissolved in methanol before HPLC detection, or 1-9 times the volume of ethanol is added to the fermentation liquid for dilution, extraction by shaking, and the supernatant is subjected to HPLC detection after centrifugation to detect the content of resveratrol in the fermentation liquid.

[0120] 2. Shake flask fermentation in nutrient-rich medium

[0121] The resveratrol recombinant engineering bacteria constructed in Example 1 were streaked on a YPD plate for 2-3 days, and a single clone was picked into 2-10 mL of YPD liquid culture medium, and cultured in a shaking incubator at 30°C and 180-250 rpm for 16-36 h to obtain seeds; the seeds were transferred to a fresh YPD liquid culture medium at an inoculation rate of 0.5%-10%, and cultured at 30°C and 180-250 rpm for 60-156 h. After the fermentation, the samples were tested to obtain the resveratrol yields of the 12 recombinant resveratrol engineering bacteria in Example 1, as shown in Table 6.

[0122] The YPD liquid culture medium contains 10 g / L yeast powder, 20 g / L peptone and 20 g / L glucose.

[0123] The recombinant engineered bacteria BR1 in Table 1 needs to add 0.1-1 mmol / L of p-coumaric acid to the culture medium in order to synthesize resveratrol by fermentation. The other recombinant engineered strains do not need to add any precursor substances other than the culture medium components, and can synthesize resveratrol from glucose by fermentation.

[0124] Table 6:

[0125]

[0126] Note: The glucose content in the YPD medium in yield 1 is 2%, and the glucose content in yield 2 is 4%. In the fermentation of strain BR1, 0.5 mmol / L of p-coumaric acid was added to the medium, and the other strains synthesized resveratrol de novo.

[0127] The yield of resveratrol produced by shake flask fermentation in this example is high, reaching a level of 1 g / L, which is higher than the highest resveratrol yield (batch fed fermentation) of 0.8 g / L produced by recombinant Saccharomyces cerevisiae fermentation reported in current papers, indicating that the recombinant strain constructed by the present invention has obvious advantages in resveratrol yield and fermentation process.

[0128] 3. Shake flask fermentation with completely synthetic medium

[0129] In addition to producing resveratrol by fermentation in a nutrient-rich culture medium, the recombinant engineered bacteria of Example 1 can also grow and synthesize resveratrol in an inexpensive culture medium. These inexpensive culture media mainly contain carbon sources (such as glucose, molasses, etc.), inorganic nitrogen sources (such as ammonium sulfate, ammonium chloride, ammonia water, etc.), inorganic phosphorus sources (such as potassium dihydrogen phosphate, sodium dihydrogen phosphate, etc.), magnesium ions (such as magnesium sulfate, magnesium chloride, etc.), trace metal elements and vitamin solutions and essential amino acids. Compared with nutrient-rich culture media such as yeast powder and peptone, the synthetic culture medium is inexpensive and can effectively reduce the cost of fermentation production of resveratrol.

[0130] In this example, the fermentation of strains BRT8, BRT9 and BRT10 constructed in Example 1 is mainly used as an example. The seed preparation process is consistent with the shake flask fermentation in a nutrient-rich medium. The only difference is the composition of the fermentation medium. The fermentation process results are shown in FIG. Figure 5 As shown in the figure, the resveratrol production of strains BRT9 and BRT10 is comparable, and BRT10 can achieve efficient fermentation and synthesis of resveratrol without adding additional amino acids (lysine) to the culture medium, further reducing the fermentation cost.

[0131] Further considering the advantages of strain BRT10 and the nutrient-rich characteristics of sugarcane molasses, strain BRT10 was fermented in a culture medium containing only 4% molasses, ammonium sulfate, potassium dihydrogen phosphate and magnesium sulfate for 72 hours. HPLC detection found that the resveratrol production reached 473.5 mg / L. Compared with synthetic culture media with glucose as the carbon source, there is no need to add trace metal ions and vitamin solutions, which further reduces the fermentation production cost and obtains a higher resveratrol yield.

[0132] Example 4: Batch-fed fermentation in a 3 L fermenter

[0133] The recombinant engineered bacteria BRT10 in Example 1 was fermented in a 3L fermenter in batch-fed batch mode. The initial culture medium was glucose (2%), ammonium sulfate (1.5%), potassium dihydrogen phosphate (0.8%) and magnesium sulfate (0.5%). Trace metal elements and vitamin solution were added. The inoculation amount was 10%. The temperature during the fermentation process was controlled at 30°C. The pH was controlled at 5.0 by adding ammonia water and phosphoric acid. The ventilation volume was 1vvm. Feeding was started about 16-24 hours after the start of fermentation. The feed solution was 500-750g / L of glucose solution. The feeding rate per hour was controlled between 1-5g / L. The results of bacterial growth and resveratrol production during the final fermentation process are shown in the following table. Figure 6 As shown in the figure, through fed-batch fermentation, the yield of resveratrol can reach 3.0 g / L in about 80 hours of fermentation, and the yield of resveratrol reaches 4.0 g / L after 120 hours of fermentation, and the bacterial biomass, i.e., OD600, reaches 128.

[0134] The above embodiments are only exemplary embodiments of the present invention and are not intended to limit the present invention. The protection scope of the present invention is defined by the claims. Those skilled in the art may make various modifications or equivalent substitutions to the present invention within the essence and protection scope of the present invention, and such modifications or equivalent substitutions shall also be deemed to fall within the protection scope of the present invention.

Claims

1. A genetically engineered yeast strain for producing resveratrol, characterized in that: The engineered bacteria is based on Saccharomyces cerevisiae BY4742 as the starting strain, and the resveratrol synthase gene is introduced STS , p-Coumaryl-CoA ligase gene 4CL , phenylalanine / tyrosine ammonia lyase gene TAL , cinnamate-4-hydroxylase gene C4H , cytochrome P450 enzyme reductase gene CPR1, malonyl-CoA synthetase gene ACC1 , DAHP synthase mutant gene ARO4 , chorismate mutase mutant gene ARO7 chorismate synthase gene ARO2 , shikimate kinase gene AroL , acetyl-CoA synthetase gene ACS , while knocking out bypass genes CIT2 , LPP1 , DPP1 , PDC6 ; The resveratrol synthase gene STS , p-Coumaryl-CoA ligase gene 4CL , phenylalanine / tyrosine ammonia lyase gene TAL , cinnamate-4-hydroxylase gene C4H , cytochrome P450 enzyme reductase gene CPR1, malonyl-CoA synthetase gene ACC1 , and their nucleotide sequences are shown in SEQ ID NOs: 1 to 6, respectively.

2. The genetically engineered yeast for producing resveratrol according to claim 1, characterized in that: The resveratrol synthase gene STS , p-Coumaryl-CoA ligase gene 4CL , phenylalanine / tyrosine ammonia lyase gene TAL , cinnamate-4-hydroxylase gene C4H , cytochrome P450 enzyme reductase gene CPR1, DAHP synthase mutant gene ARO4 , chorismate mutase mutant gene ARO7 Chorismate synthase ARO2 Shikimate kinase gene AroL , acetyl-CoA synthetase gene ACS and malonyl-CoA synthetase gene ACC1 All of them are expressed on the chromosome of Saccharomyces cerevisiae; among them, the resveratrol synthase gene STS , p-Coumaryl-CoA ligase gene 4CL , phenylalanine / tyrosine ammonia lyase gene TAL The expression copy number is ≥1.

3. The genetically engineered yeast for producing resveratrol according to claim 1, characterized in that: The resveratrol synthase gene STS Derived from grapes ( Vitis vinifera ); The p-coumaryl-CoA ligase gene 4CL From parsley ( Petroselinum crispum ); The phenylalanine / tyrosine ammonia lyase gene TAL From Rhodococcus yeast ( Rhodotorula toruloides ); The cinnamate-4-hydroxylase gene C4H and the cytochrome P450 enzyme reductase gene CPR1 from Arabidopsis thaliana ( Arabidopsis thaliana ); The acetyl-CoA synthetase gene ACS Derived from Salmonella enterica; The DAHP synthase mutant ARO4 gene, chorismate mutase mutant gene ARO7 chorismate synthase gene ARO2 , malonyl-CoA synthetase gene ACC1 Derived from Saccharomyces cerevisiae, they were obtained by PCR amplification using the genome of Saccharomyces cerevisiae as template; Shikimate kinase AroL The gene comes from Escherichia coli and is amplified by PCR using the genome of Escherichia coli as a template.

4. The genetically engineered yeast for producing resveratrol according to claim 3, characterized in that: The resveratrol synthase gene STS , p-Coumaryl-CoA ligase gene 4CL , phenylalanine / tyrosine ammonia lyase gene TAL Cinnamate 4-hydroxylase gene C4H , cytochrome P450 enzyme reductase gene CPR1, acetyl-CoA synthetase gene ACS The nucleotide sequence was synthesized after codon optimization according to the codon preference of Saccharomyces cerevisiae.

5. The method for constructing a genetically engineered yeast strain for producing resveratrol according to any one of claims 1 to 4, characterized in that: The following steps are involved: (1) Using overlap extension PCR technology or other vector construction methods to obtain the expression frame of each target gene, that is, containing the promoter-target gene-terminator sequence, so that the gene to be expressed has a strong constitutive promoter and terminator of Saccharomyces cerevisiae, and the DNA fragment of the expression frame is obtained by PCR technology; (2) Use specific primers to amplify the homology arm sequence 300-1000 bp upstream and downstream of the target integration site, and connect it with the target gene expression frame to be expressed through overlap extension PCR amplification technology to obtain the gene expression frame fragment integrated at a specific site on the Saccharomyces cerevisiae chromosome; (3) Screening of nutritional deficiency marker genes His3 , Ura3、Leu2 , Lys2 Connect with the target gene expression frame fragment and upstream and downstream homology arm sequences, and transform into Saccharomyces cerevisiae competent cells. Integrate the gene into the chromosome for overexpression through homologous recombination, and then screen positive clones in the Saccharomyces cerevisiae competent cells in a defective medium lacking histidine, uracil, leucine, and lysine. Alternatively, construct a CRISPR-Cas9 plasmid with a specific recognition site, and transform it into Saccharomyces cerevisiae competent cells together with the corresponding upstream and downstream homology arm sequences and the target gene expression frame sequence to knock out and integrate the gene of Saccharomyces cerevisiae, and screen positive clones on a plate containing geneticin resistance; (4) Inoculate a single colony grown on the plate into YPD liquid culture medium and culture for 16-36 hours. Verify the genome by PCR amplification to obtain a genetically engineered yeast strain of resveratrol.

6. The method for constructing a genetically engineered yeast strain for producing resveratrol according to claim 5, characterized in that: The target gene expression cassette is constructed on the G418 plasmid and obtained by PCR amplification, as follows: (1) Using plasmid G418 as a template, the two proteins were expressed in tandem on plasmid G418. Pc4CL - VtX Gene, RgTAL - VtX Gene, AtCPR1 -At C4H Gene, ARO4-ARO7 Gene, Arol - ARO2 Genes and ACC1 Gene, construct plasmid G418-PV, plasmid G418-TS, plasmid G418- C4H , plasmid G418-Aro47, plasmid G418- AroL 2 and plasmid G418- ACC1 ; (2) Using plasmid G418-PV, plasmid G418-TS, plasmid G418- C4H , plasmid G418-Aro47, plasmid G418- AroL 2 and plasmid G418- ACC1 As a template, the target gene expression cassette was obtained by PCR amplification; The plasmid construction method in step (1) is as follows: The plasmid G418 backbone fragment and the integrated gene fragment were obtained by PCR amplification. After the fragments were mixed, In-fusion Cloning Mixture was added and reacted at 50°C for 50 minutes. The resulting transformation solution was transferred into Escherichia coli competent cells, and single colonies were verified. Finally, the correct plasmid was verified by sequencing.

7. The method for constructing a genetically engineered yeast strain for producing resveratrol according to claim 5, characterized in that: The method for constructing a recombinant strain by screening a tag gene through nutritional deficiency is as follows: Using Saccharomyces cerevisiae BY4742 as the starting strain, the nutritional deficiency genes His3 and Ura3 and Leu2 and Lys2 As screening tags, the target gene expression cassette was integrated into the YORW∆17 site, Ura3 site, Leu2 site, and Lys2 site of the Saccharomyces cerevisiae genome to construct a recombinant strain; The cerevisiae yeast BY4742 is a model strain and cannot grow in a CM medium lacking histidine, leucine, lysine and uracil.

8. The method for constructing a genetically engineered yeast strain for producing resveratrol according to claim 5, characterized in that: The CRISPR-Cas9 plasmid capable of recognizing specific sites is used for CRISPR-Cas9 gene manipulation to knock out the coding gene sequences of the CIT2, LPP1, PDC6 and DPP1 sites on the Saccharomyces cerevisiae genome, and integrate the corresponding RgTAL - VtX , RgTAL - VtX , ACC1 S659A / S1157A and Pc4CL - VtX A gene expression cassette is used to obtain a recombinant engineering strain; Alternatively, the expression cassette of the target gene is inserted into the 1309a, 511b, and 911b sites on the Saccharomyces cerevisiae genome to construct a recombinant engineered bacterium.

9. The method for constructing a genetically engineered yeast strain for producing resveratrol according to claim 8, characterized in that: The CRISPR-Cas9 plasmid capable of recognizing specific sites is used to perform CRISPR-Cas9 gene manipulation, knock out the coding sequence of the PHA2 site on the Saccharomyces cerevisiae genome, and construct a recombinant engineering strain.

10. The method for constructing a genetically engineered yeast strain for producing resveratrol according to claim 7, characterized in that: The CRISPR-Cas9 plasmid capable of recognizing specific sites is constructed as follows: The original pCas plasmid is amplified by PCR or seamlessly cloned using primers with recognition sequences of specific recognition sites to replace the specific 20 bp recognition sequence on the pCas plasmid to obtain the pCas plasmid of the specific site, which is then transformed into competent E. coli cells, and a single colony is picked to be cultured in the culture medium, and the plasmid is extracted and sequenced for verification; The recognition site and its recognition sequence are as follows: CIT2:GTTATGGTCATGCTGTGCTA; LPP1:GCCATGACAGAGATCATCCT; PHA2:TCAGCGACAAAAGTAAACAG; 1309a: CCTGTGGTGACTACGTATCC; 511b: CAGTGTATGCCAGTCAGCCA; PDC6:GATGCGTGCGTAACCATCGG; 911b: GTAATATTGTCTTGTTTCCC; DPP1: GATCGTTGCCAACCTGTTGA.

11. The use of genetically engineered yeast for producing resveratrol according to any one of claims 1 to 4, characterized in that: Used for fermentation synthesis of resveratrol, as follows: Pick a single colony from a plate or inoculate the recombinant engineered bacteria from a glycerol storage tube into 2-20 mL of liquid culture medium, culture for 16-36 hours to obtain a seed solution; inoculate the seed solution into a fermentation medium containing substrate glucose, perform fermentation culture and achieve the synthesis of resveratrol, the culture temperature is 28-33°C, the culture time is 48-156 hours, the pH is 4.5-6.5, and glucose is added during the fermentation process.

Images