Recombinant vectors, recombinant strains, kits, uses thereof and methods of producing aureomycin

By constructing recombinant vectors containing specific promoters and regulatory genes in chlortetracycline-producing strains, the problem of low chlortetracycline yield was solved, high chlortetracycline production was achieved, and the production efficiency of the strains was improved.

CN116083472BActive Publication Date: 2026-05-19JINHE BIOTECHNOLOGY CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202111308338.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-11-05
Publication Date
2026-05-19
Estimated Expiration
2041-11-05

AI Technical Summary

Technical Problem

The yield of chlortetracycline-producing strains in existing technologies is low and cannot meet market demand.

Method used

Recombinant strains were constructed by overexpressing ctcB, ctcS, and ctc1 regulatory genes using specific kasOp* and ermEp* promoters, thereby increasing the yield of chlortetracycline.

Benefits of technology

By constructing recombinant vectors and recombinant strains, high yields of chlortetracycline were achieved, and the yield of chlortetracycline was increased. In particular, the chlortetracycline yield of recombinant strains overexpressing the ctcB, ctcS, and ctc1 genes by the kasOp* promoter increased by 15.8%, and the chlortetracycline yield of recombinant strains overexpressing the ctcS gene by the ermEp* promoter increased by 3.7%.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0003341041850000011
    Figure HDA0003341041850000011
  • Figure HDA0003341041850000021
    Figure HDA0003341041850000021
Patent Text Reader

Abstract

The present application relates to a recombinant vector, a recombinant strain, a kit and its use and a method for producing aureomycin. The recombinant vector comprises: a promoter selected from a kasOp* promoter or an ermEp* promoter; a regulatory gene downstream of the promoter, the regulatory gene comprising: at least one of ctc1, ctcB and ctcS; and the recombinant strain comprises the above-mentioned recombinant vector. The recombinant vector of the present application can overexpress the regulatory gene in the aureomycin-producing strain, thereby achieving high-yield aureomycin production and facilitating the large-scale production of aureomycin.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a recombinant vector, recombinant strain, reagent kit, its uses, and a method for producing chlortetracycline. Background Technology

[0002] Chlortetracycline (CTC) is an important member of the tetracycline antibiotic family. It possesses excellent antibacterial activity and is widely used in animal feed, aquaculture, and clinical treatment. Currently, the demand for chlortetracycline has increased significantly, while the yield of chlortetracycline from original strains is low and can no longer meet the demand.

[0003] Therefore, there is an urgent need to find ways to increase the chlortetracycline production of the strain. Summary of the Invention

[0004] This invention aims to at least partially solve one of the technical problems existing in the prior art. To this end, this invention provides a recombinant vector, a recombinant bacterial strain, a kit, its uses, and a method for producing chlortetracycline. The recombinant vector of this invention can overexpress regulatory genes in chlortetracycline-producing strains, thereby achieving high-yield chlortetracycline production and facilitating the large-scale production of chlortetracycline.

[0005] In one aspect of the invention, a recombinant vector is provided. According to an embodiment of the invention, the recombinant vector comprises: a promoter selected from kasOp* promoter or ermEp* promoter; and a regulatory gene located downstream of the promoter, the regulatory gene comprising at least one of ctc1, ctcB, and ctcS.

[0006] Through numerous experiments, the inventors discovered that the recombinant vector constructed using the aforementioned specific promoter and regulatory gene can overexpress the regulatory gene in chlortetracycline-producing strains, thereby achieving high-yield chlortetracycline production and facilitating the large-scale production of chlortetracycline.

[0007] According to embodiments of the present invention, the recombinant vector may further include at least one of the following additional technical features:

[0008] According to an embodiment of the present invention, the promoter is selected from the kasOp* promoter, and the regulatory gene is selected from ctc1, ctcB, or ctcS; or the promoter is selected from the ermEp* promoter, and the regulatory gene is selected from ctcS.

[0009] Through extensive experiments, the inventors discovered that recombinant strains overexpressing the ctcB, ctcS, and ctc1 regulatory genes via the kasOp* promoter can increase chlortetracycline production, and recombinant strains overexpressing the ctcS regulatory gene via the ermEp* promoter can also increase chlortetracycline production. In particular, recombinant strains overexpressing the ctcB regulatory gene via the kasOp* promoter exhibit better chlortetracycline production, with a chlortetracycline yield increase of 15.8%.

[0010] According to embodiments of the present invention, the kasOp* promoter has the nucleotide sequence shown in SEQ ID NO: 1 or a nucleotide sequence having at least 80% homology thereto; the ermEp* promoter has the nucleotide sequence shown in SEQ ID NO: 2 or a nucleotide sequence having at least 80% homology thereto; the ctc1 gene has the nucleotide sequence shown in SEQ ID NO: 3 or a nucleotide sequence having at least 80% homology thereto; the ctcB gene has the nucleotide sequence shown in SEQ ID NO: 4 or a nucleotide sequence having at least 80% homology thereto; and the ctcS gene has the nucleotide sequence shown in SEQ ID NO: 5 or a nucleotide sequence having at least 80% homology thereto. Thus, transforming the recombinant vector constructed from the above-mentioned regulatory genes and promoters into a chlortetracycline-producing strain yields a recombinant strain with advantages such as high chlortetracycline yield and high stability.

[0011] In another aspect, the present invention provides a recombinant bacterial strain. According to an embodiment of the present invention, the recombinant bacterial strain comprises the aforementioned recombinant vector. Therefore, using this recombinant bacterial strain for fermentation culture can achieve high production of chlortetracycline.

[0012] According to an embodiment of the present invention, the recombinant strain is *Streptomyces aureus* containing the aforementioned recombinant vector. This allows for high-yield production of chlortetracycline.

[0013] In another aspect, the present invention provides a kit. According to an embodiment of the invention, the kit comprises the above-described recombinant vector or the above-described recombinant bacterial strain. Thus, the kit according to an embodiment of the invention can achieve high-yield chlortetracycline production.

[0014] In another method of the present invention, the present invention proposes the use of the above-described recombinant vector, the above-described recombinant strain, or the above-described kit in the production of chlortetracycline. Thus, the recombinant strain obtained from the above-described recombinant vector or the above-described recombinant strain can be used to produce chlortetracycline, and has the advantage of high chlortetracycline yield.

[0015] In another aspect of the invention, a method for producing chlortetracycline is provided. According to an embodiment of the invention, the method includes fermenting the aforementioned recombinant strain. Thus, by using the aforementioned recombinant strain for fermentation, chlortetracycline can be obtained in high yield.

[0016] Additional aspects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. Attached Figure Description

[0017] The above and / or additional aspects and advantages of the present invention will become apparent and readily understood from the description of the embodiments taken in conjunction with the following drawings, in which:

[0018] Figure 1 This is a schematic diagram of the eight recombinant vectors in Embodiment 1 of the present invention;

[0019] Figure 2 This is a bar chart showing the fermentation results of the original strain S. aureofaciens J1-022 and eight recombinant strains in Example 2 of the present invention. Detailed Implementation

[0020] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention.

[0021] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of indicated technical features. Therefore, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. Furthermore, in the description of this invention, unless otherwise stated, "a plurality of" means two or more.

[0022] The present invention will be explained below with reference to embodiments. Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be considered as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.

[0023] The Streptomyces aureofaciens J1-022 (also known as S. aureofaciens J1-022, or J1-022) in this embodiment of the invention was obtained from Streptomyces aureofaciens F3 deposited at the China Center for Type Culture Collection (CCTCC); the accession number is CCTCC NO: M 2013080.

[0024] Preservation information:

[0025] Strain name: Streptomyces aureofaciens F3;

[0026] Date of deposit: March 13, 2013;

[0027] Institution of deposit: China Center for Type Culture Collection (CCTCC);

[0028] Accession number: CCTCC NO: M 2013080;

[0029] Location of the collection: Wuhan University, Wuhan, China.

[0030] References for fermentation culture in this embodiment of the invention: Tao Zhu, Xueqing Cheng, Yuntian Liu, Zixin Deng, Delin You. Deciphering and engineering of the final step halogenase for improved chlortetracycline biosynthesis in industrial Streptomycesaureofaciens[J].Metabolic Engineering,2013,19.

[0031] Example 1: Construction of Recombinant Vector

[0032] The inventors used plasmid pSET152 as the recombinant vector and overexpressed four regulatory genes (ctcA, ctcB, ctcS, and ctc1) using both kasOp* and ermEp* promoters, resulting in eight recombinant vectors. (See [link to documentation]). Figure 1 Specifically, two promoters were ligated to four regulatory genes using PCR to obtain eight long fragments. XbaI and BamHI restriction enzyme sites were introduced at both ends of these long fragments. The eight long fragments and plasmid pSET152 were digested with XbaI and BamHI. The digestion products were then subjected to DNA gel electrophoresis, and the target band was recovered. The eight digested fragments were then ligated to plasmid vector fragments and transformed into E. coli DH10B. Single clones were selected for culture, and the constructed recombinant vector was verified by DNA sequencing. The final results showed that the construction was correct.

[0033] The nucleotide sequence of the kasOp* promoter (SEQ ID NO:1) is shown below:

[0034] TATCGGAACGATCGTTGGCTGTGTTCACATTCGAACCGTCTCTGCTTTGACAACATGCTGTGCGGTGTTGTAAAGTCGTGGCCAGGAGAATACGACAGGTATCTGAAAGGGGATACGCCATATG;

[0035] The nucleotide sequence (SEQ ID NO:2) of the ermEp* promoter is shown below:

[0036] GCGAGTGTCCGTTCGAGTGGCGGCTTGCGCCCGATGCTAGTCGCGGTTGATCGGCGATCGCAGGTG CACGCGGTCGATCTTGACGGCTGGCGAGGTGCGGGGAGGATCTGACCGACGCGGTCCACACGTGGCACCGCGATGCTGTTGTGGGCACAATCGTGCCGGTTGGTAGGATCCA;

[0037] The nucleotide sequence (SEQ ID NO:3) of the ctc1 gene is shown below:

[0038] atgaggacggacacgccgagcgccgacaccgggcagccctgcgcggcggtacgccgcggccggccccgcagcgaggccgccga gcaggccatcttcaccgccgtcgaggacctcatggcggacggcaacacgctgtccgaactcaccatcgagggcatcgccaccgccgccggcgtcggcaaggccaccatctaccggcgctggcccaacaaggaggccctgctggtcgacgtcgtcagccggctggaggagccgatcccggc ccccaccggcggtggcgcccgcgaggacctgatcgcgatggtcgactacatccgccgccgcggcctcgccaagcgcacccgctgggtgctcaaggcggcgctcgggcagatgcagaccctgcccgagctgtacaccgcctaccgagagcgggtgatcaggccgcgccgcgaggtcgggc tgcacctgatccggcgggccgtcgccgagggcgtgatccgcgacgacctcgacgtggaactgctcggcgacctgctgatggggccgatcctctaccgcagcatcctgtcggaggactccgacctggaggacccggagctgtcccgcaaactggtcgactccgtcctcgacggcgtcgccccc cgctag;

[0039] The nucleotide sequence of the ctcB gene (SEQ ID NO: in the following:

[0040] gtgaagttcaacattctgggtccgctggaagtcctcgacaagggaattccgtgcaccccgagcgcgctgaaggtccgctggacgct ggcggtcctgctcatgaacgcgaaccggatcgtggacctcggcctcatcatcgaggagatctggggcagcagcccgccacgcacggtggtcaccaccgcgcagacgtacatctaccaactgcgcaagctctgccgtccgctgggccgcgaggtcatcctcaccaaggcccccggctacgtg ctgctgctgggggaggaggagctggacgcccaggagttcgagcggctgcaccacgagggggaccgactgctggtcgccggccaccccgaggcggccgcccagcggctgcggcaggcgctggacctgtggcggggcaccgccctggcggacatcccggtgggtgctccgctcgccggtcacgtcgccgtcctggaggagatgcgcctgcgcgccctggagcaccgcatcctggccgaccggcagctcgggcgacaccgggaactcatccccgaactgagactgttgaccctgcaccagccgatgaacgagtggtaccacgagcagctcatgctcgccctggacgccgccgggcggcggag cgaggccctgcacgtctaccgcgtgctctaccgccgactcgacgaggacctcggcatcgccccctcccgaccgctgcaggagctgcacaacgacctgctcagcggcacgtcgcccactcggcaggagttccaggcgcttgccgcgcgggcgatggagcagggcctgcgggcccgttcggcc tga;

[0041] The nucleotide sequence of the ctcS gene (SEQ ID NO: 5) is shown below:

[0042] atgaccgatctctcccccgcggccgagaccttgagtgacatcaccacggaactgttcgccgtcaacggagccctgctgcgcgcggg cgacgcgctgtccgcccgcttcgggctcacctccgcgcgctggcaggtcctcgggctgctggccgaggggccacagagcgccgcccacctggcgcgcgagcgcgggctgcgccgccaggccgtccagcagaccgtggtgaagctggtcgaggagggcctggtcagcacctcccccaaccc ggccgaccggcgggccccgctggtctcgctgaccgccaagggcaccgacgccctcgcccggatcgaacccgccgaacgcctgtggatggagcacctcgcgggcggcctggatccggacgacctgaaggccacgctgcggctgctgcgtggccttcgggcggtcctggccgagggcctgcccccggcggcggtcggcggcgcggacgccgccgacgtcacaggtccagcgtga;

[0043] The nucleotide sequence of the ctcA gene (SEQ ID NO: 6) is shown below:

[0044] gtgtcagtcggcaacaaccatccgtcggttctcgtcgtcgaggacaacgtcctgctgcgcacgggcctgcaggccctgctgtcggcc gagcccgacctcgtcctccgcgccgccgtcggcggcgtggacgaagcactcgccgtcatggccgggcaccccgtggacgtcgtggtgtacggagcgggcgagtcggtggccgacaccgagcggggcctcgagcgcctgctcgaccggggcacccgggtggtcgtactgagccggcgggac caccccggcgagatggagacgtacctcagcagcggtgtgcacgcctacctggccgaggacgcggccggggagtgcctcggcttggtgatccggggcctgacctcgggaccgggagcgggtctacatcatggcctcgcgctccggcctcgactggatggccggccagcgcggcaaccgcctgt ccggacgcgagcgggaggtcatgggcctggtcgcgaacgggctgagcaactcggccatcgcgggccggctctgcatctcgcccggcaccgtcaagcgccatctccggaacgtgttcgtcaagctcaacgccgtctcccggatcgacgccgtgaacaaggcccgggccgcttccatgctggt cccggccggccgggcctga.

[0045] Example 2: Construction of recombinant strains overexpressing regulatory genes

[0046] The eight recombinant vectors constructed above were specifically integrated into the original strain S. aureofaciens J1-022 using a triparental conjugation transfer method. The specific operation of the triparental conjugation transfer method is as follows:

[0047] A. Preparation of E. coli

[0048] 1. On the first day, the recombinant vector was transformed into Escherichia coli DH10B, and Escherichia coli ET12567 / pUB307 was activated on an antibiotic plate.

[0049] 2. On the second day, pick the transformed E. coli DH10B and the activated ET12567 / pUB307 single colonies into 5 mL LB medium (with the corresponding antibiotics) and incubate overnight;

[0050] 3. On the third day, take the above-mentioned E. coli DH10B and inoculate it into 5 mL of LB medium (antibiotic dosage halved) at a certain ratio and incubate at 37℃ until OD. 600 Centrifuge at 3500 rpm for 5 min at 0.6–0.8, wash E. coli DH10B twice with an appropriate amount of LB medium, remove the supernatant, and resuspend in 25 μL of LB medium for later use.

[0051] B. Preparation of Streptomyces

[0052] 1. Using a cotton swab, scrape an appropriate amount of *Streptomyces aureus* spores from an oat sporulation medium (3.4% oats, 2.0% agar powder, 0.005% MgSO4, 0.01% KH2PO4, 0.015% (NH4)2HPO4, natural pH, sterilized at 121℃ for 30 min) that has been cultured for 7 days. Resuspend the spores in 5 mL of TES (50 mM, pH = 8.0, sterilized). Heat shock in a 50℃ water bath for 10 min, shaking continuously to keep the spores suspended.

[0053] 2. Add an equal volume of 2× spore pre-germination medium (1% Difco casein amino acids, 1% Difco yeast extract, dissolved and brought to a final volume, then sterilized at 115℃ for 30 min) and 10 mM CaCl2 solution (5 M stock solution concentration), pre-germinate at 37℃ for 2-3 h, dispense, centrifuge to remove supernatant, and set aside for later use;

[0054] 3. Mix the prepared Escherichia coli DH10B and activated ET12567 / pUB307 with the treated S. aureofaciens J1-022 spores and spread them on ABB13 plates (soluble starch 5g / L, calcium carbonate 3g / L, 3-morpholine propanesulfonic acid (MOPS) 2.1g / L, thiamine hydrochloride 0.01g / L, ferrous sulfate heptahydrate 0.046g / L, Difco soybean peptone 5g / L, agar powder 2%, pH adjusted to 7.0, and sterilized at 115℃ for 30min). For the control, spread the spore solution and ET12567 / pUB307 on one plate and spread only the spore solution on another plate. Incubate at 30℃ until the cover time.

[0055] 4. After about 20 hours, dissolve an appropriate concentration of antibiotics and trimethoprim (TMP) in 1 mL of sterile water and pour it onto a plate to completely cover it (shake from side to side; if it is not enough to cover, add an appropriate amount of sterile water to cover it completely). Blow the plate for 1-2 hours until it is completely dry, and then place it in a 30°C incubator to grow zygotes.

[0056] 5. Select zygotes and inoculate them into oat sporulation medium containing the corresponding concentration of antibiotics. Incubate at 30°C for 4 days until plump spores grow. Scrape an appropriate amount of spores to extract total DNA as a PCR template and perform PCR verification.

[0057] The recombinant vector was introduced into S. aureofaciens J1-022, resulting in recombinant strains F4, F5, F6, F7, F8, F9, F10, and F11. After apopramycin resistance verification, recombinant strains F4, F5, F6, and F7, which overexpress ctcA, ctcB, ctcS, and ctc1 via the kasOp* promoter, and recombinant strains F8, F9, F10, and F11, which overexpress ctcA, ctcB, ctcS, and ctc1 via the ermEp* promoter, were successfully obtained.

[0058] Example 3: Validation of Fermentation Results of Recombinant Strains

[0059] Following the method described in the reference, recombinant strains F4, F5, F6, F7, F8, F9, F10, F11 and the original control strain *S. aureofaciens* J1-022 were fermented separately. Equal amounts of seed culture were inoculated at inoculation, and shake-flask fermentation was performed under identical environmental conditions. The results are as follows: Figure 2 As shown.

[0060] The results showed that, compared with the original control strains, the chlortetracycline production of recombinant strains F5, F6, and F7 was increased. Specifically, recombinant strains overexpressing the ctcB, ctcS, and ctc1 genes via the kasOp* promoter all resulted in increased chlortetracycline production, increasing by 15.8%, 3.2%, and 5.0% respectively compared to the original control strains. Compared with the original control strains, the chlortetracycline production of recombinant strain F10 was also increased. Specifically, the chlortetracycline production of recombinant strain F10 overexpressing the ctcS gene via the ermEp* promoter was increased by 3.7% compared to the original control strain, which is comparable to the increase achieved by overexpressing this gene via the kasOp* promoter. However, the chlortetracycline production of recombinant strain F11 decreased significantly, indicating that the chlortetracycline production of recombinant strain F11 overexpressing the ctc1 gene via the ermEp* promoter was reduced. Compared with the original control strains, the chlortetracycline production of recombinant strains F4 and F8 decreased, indicating that overexpression of the ctcA gene always leads to a decrease in chlortetracycline production.

[0061] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "example," "specific example," or "some examples," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0062] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention. SEQUENCE LISTING <110> Jinhe Biotechnology Co., Ltd. <120> Recombinant vectors, recombinant strains, kits, their uses, and methods for producing chlortetracycline. <130> BI3211358 <160> 6 <170> PatentIn version 3.5 <210> 1 <211> 124 <212> DNA <213> Artificial Sequence <220> <223> 1 <400> 1 tatcggaacg atcgttggct gtgttcacat tcgaaccgtc tctgctttga caacatgctg 60 tgcggtgttg taaagtcgtg gccaggagaa tacgacaggt atctgaaagg ggatacgcca 120 tatg 124 <210> 2 <211> 180 <212> DNA <213> Artificial Sequence <220> <223> 2 <400> 2 gcgagtgtcc gttcgagtgg cggcttgcgc ccgatgctag tcgcggttga tcggcgatcg 60 caggtgcacg cggtcgatct tgacggctgg cgagaggtgc ggggaggatc tgaccgacgc 120 ggtccacacg tggcaccgcg atgctgttgt gggcacaatc gtgccggttg gtaggatcca 180 <210> 3 <211> 630 <212> DNA <213> Artificial Sequence <220> <223> 3 <400> 3 atgaggacgg acacgccgag cgccgacacc gggcagccct gcgcggcggt acgccgcggc 60 cggccccgca gcgaggccgc cgagcaggcc atcttcaccg ccgtcgagga cctcatggcg 120 gacggcaaca cgctgtccga actcaccatc gagggcatcg ccaccgccgc cggcgtcggc 180 aaggccacca tctaccggcg ctggcccaac aaggaggccc tgctggtcga cgtcgtcagc 240 cggctggagg agccgatccc ggcccccacc ggcggtggcg cccgcgagga cctgatcgcg 300 atggtcgact acatccgccg ccgcggcctc gccaagcgca cccgctgggt gctcaaggcg 360 gcgctcgggc agatgcagac cctgcccgag ctgtacaccg cctaccgaga gcgggtgatc 420 aggccgcgcc gcgaggtcgg gctgcacctg atccggcggg ccgtcgccga gggcgtgatc 480 cgcgacgacc tcgacgtgga actgctcggc gacctgctga tggggccgat cctctaccgc 540 agcatcctgt cggaggactc cgacctggag gacccggagc tgtcccgcaa actggtcgac 600 tccgtcctcg acggcgtcgc cccccgctag 630 <210> 4 <211> 810 <212> DNA <213> Artificial Sequence <220> <223> 4 <400> 4 gtgaagttca acattctggg tccgctgga gtcctcgaca agggaattcc gtgcaccccg agcgcgctga aggtccgctg gacgctggcg gtcctgctca tgaacgcgaa ccggatcgtg gacctcggcc tcatcatcga ggagatctgg ggcagcagcc cgccacgcac ggtggtcacc 180 accgcgcaga cgtacatcta ccaactgcgc aagctctgcc gtccgctggg ccgcgaggtc 240 atcctcacca aggcccccgg ctacgtgctg ctgctggggg aggaggagct ggacgcccag 360. gagttcgagc ggctgcacca cgagggggac cgactgctgg tcgccggcca ccccgaggcg 360 gccgcccagc ggctgcggca ggcgctggac ctgtggcggg gcaccgccct ggcggacatc 420 ccggtgggtg ctccgctcgc cggtcacgtc gccgtcctgg aggagatgcg cctgcgcgcc 480 ctggagcacc gcatcctggc cgaccggcag ctcggggcgac accgggaact catccccgaa540 ctgagactgt tgaccctgca ccagccgatg aacgagtggt accacgagca gctcatgctc gccctggacg ccgccggggcg gcggagcg gccctgcacg tctaccgcgt gctctaccgc 660 cgactcgacg aggacctcgg catcgcccc tcccgaccgc tgcaggagct gcacaacgac 720 ctgctcagcg gcacgtcgcc cactcggcag gagttccagg cgcttgccgc gcgggcgatg 780 gagcagggcc tgcggggcccg ttcggcctga 810 <210> 5 <211> 498 <212> DNA <213> Artificial Sequence <220> <223> 5 <400> 5 atgaccgatc tctccccgc ggccgagacc ttgagtgaca tcaccacgga actgttcgcc gtcaacggag ccctgctgcg cgcgggcgac gcgctgtccg cccgcttcgg gctcacctcc 120 gcgcgctggc aggtcctcgg gctgctggcc gaggggccac agagcgccgc ccacctggcg 180 cgcgagcgcg ggctgcgccg ccaggccgtc cagcagaccg tggtgaagct ggtcgaggag 240 ggcctggtca gcacctcccc caacccggcc gaccggcggg ccccgctggt ctcgctgacc 300 gccaagggca ccgacgccct cgcccggatc gaacccgccg aacgcctgtg gatggagcac 360 ctcgcgggcg gcctggatcc ggacgacctg aaggccacgc tgcggctgct gcgtggcctt 420 cgggcggtcc tggccgaggg cctgcccccg gcggcggtcg gcggcgcgga cgccgccgac 480 gtcacaggtc cagcgtga 498 <210> 6 <211> 648 <212> DNA <213> Artificial Sequence <220> <223> 6 <400> 6 gtgtcagtcg gcaacaacca tccgtcggtt ctcgtcgtcg aggacaacgt cctgctgcgc 60 acgggcctgc aggccctgct gtcggccgag cccgacctcg tcctccgcgc cgccgtcggc 120 ggcgtggacg aagcactcgc cgtcatggcc gggcaccccg tggacgtcgt ggtgtacgga 180 gcgggcgagt cggtggccga caccgagcgg ggcctcgagc gcctgctcga ccggggcacc 240 cgggtggtcg tactgagccg gcgggaccac cccggcgaga tggagacgta cctcagcagc 300 ggtgtgcacg cctacctggc cgaggacgcg gccggggagt gcctcggctt ggtgatccgg 360 ggcctgacct cggaccggga gcgggtctac atcatggcct cgcgctccgg cctcgactgg 420 atggccggcc agcgcggcaa ccgcctgtcc ggacgcgagc gggaggtcat gggcctggtc 480 gcgaacgggc tgagcaactc ggccatcgcg ggccggctct gcatctcgcc cggcaccgtc 540 aagcgccatc tccggaacgt gttcgtcaag ctcaacgccg tctcccggat cgacgccgtg 600 aacaaggccc gggccgcttc catgctggtc ccggccggcc gggcctga 648

Claims

1. A recombinant vector, characterized in that, include: Promoter, the promoter selected from kasOp* promoter or ermEp* promoter; Regulatory genes, wherein the regulatory genes are located downstream of the promoter, and the promoter is selected from... kasOp* Promoter, the regulatory gene is selected from ctc1 , ctcB or ctcS Or the promoter is selected from ermEp* Promoter, the regulatory gene is selected from ctcS; The kasOp* The nucleotide sequence of the promoter is shown in SEQ ID NO: 1; The ermEp* The nucleotide sequence of the promoter is shown in SEQ ID NO: 2; The ctc1 The nucleotide sequence of the gene is shown in SEQ ID NO: 3; The ctcB The nucleotide sequence of the gene is shown in SEQ ID NO: 4; The ctcS The nucleotide sequence of the gene is shown in SEQ ID NO:

5.

2. A recombinant bacterial strain, characterized in that, include: The recombinant vector according to claim 1.

3. The recombinant strain according to claim 2, characterized in that, The recombinant strain is *Streptomyces aureus* containing the recombinant vector described in claim 1.

4. A reagent kit, characterized in that, include: The recombinant vector according to claim 1 or the recombinant strain according to any one of claims 2 to 3.

5. Use of the recombinant vector of claim 1, the recombinant strain of claim 2 or 3, or the kit of claim 4 in the production of chlortetracycline.

6. A method for producing chlortetracycline, characterized in that, include: The recombinant strain described in claim 2 or 3 is fermented.