SNP markers linked to bitter gourd resistance to root-knot nematode and applications thereof

By identifying resistance to root-knot nematode disease in bitter gourd using SNP markers in the coding region of the SEC8 gene, the problem of screening germplasm resources resistant to root-knot nematode disease in bitter gourd has been solved in existing technologies. This has enabled rapid and accurate breeding identification, reduced the use of chemical control, and improved breeding efficiency.

CN116083639BActive Publication Date: 2026-05-08TROPICAL CORP STRAIN RESOURCE INST CHINESE ACAD OF TROPICAL AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310212803.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-03-07
Publication Date
2026-05-08
Estimated Expiration
2043-03-07

AI Technical Summary

Technical Problem

Existing technologies make it difficult to efficiently screen bitter gourd germplasm resources resistant to root-knot nematode disease, resulting in nematode disease severely affecting the yield and quality of bitter gourd. Furthermore, chemical control methods involve resource waste and environmental pollution.

Method used

A SNP marker located in the coding region of the bitter gourd SEC8 gene, at the Chr4-25401664 locus, was developed for rapid identification of resistance to root-knot nematode disease in bitter gourd varieties. PCR amplification of Chr4-25401664-CGF, Chr4-25401664R, Chr4-25401664-CAF, and Chr4-25401664R was performed using designed primers to determine the bitter gourd genotype for breeding assistance.

Benefits of technology

This technology enables rapid and accurate identification of resistance to root-knot nematode disease in bitter gourd seedlings, supports marker-assisted breeding, improves breeding efficiency, and reduces the use of chemical control.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116083639B_ABST
    Figure CN116083639B_ABST
Patent Text Reader

Abstract

The application discloses a SNP marker linked with Momordica charantia resistance to Meloidogyne enterolobii and application. The application finds that a SNP site (G / A) exists at 2122 bases of a coding region of a SEC8 gene of Momordica charantia, and the specific position is Chr4-25401664, through identification of Meloidogyne enterolobii of 192 Momordica charantia germplasms collected from all over the world and whole genome association analysis. The resistance of the tested Momordica charantia sample to Meloidogyne enterolobii is determined by designing primers to amplify and detect bands. The application can quickly and accurately analyze the resistance of different Momordica charantia germplasms to Meloidogyne enterolobii, and accelerates application of a molecular marker assisted selection technology in Momordica charantia disease resistance breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and in particular to the SNP markers and applications linked to bitter gourd's resistance to root-knot nematode disease in bean. Background Technology

[0002] Bitter melon is one of the important winter gourd vegetables in Hainan Province. Rich in vitamins, it possesses medicinal value, including lowering blood sugar and blood pressure, anti-tumor properties, and anti-HIV effects. In recent years, its planting area has expanded annually, making it an indispensable vegetable on the public's table. However, due to its high multiple cropping index and severe continuous cropping obstacles, root-knot nematode disease of the bean weevil is widespread and worsening year by year, seriously affecting the yield and quality of bitter melon. The bean weevil was first discovered in 1983 on bean trees in Danzhou City, Hainan Province, my country, and for more than 20 years afterward, it was considered a minor or insignificant species and was largely ignored.

[0003] The bean root-knot nematode (Meloidogyne enterolobii) has a wide host range, including various vegetables such as bitter melon, cucumber, pepper, and tomato. Unlike the southern root-knot nematode (M. incognita) and the northern root-knot nematode (M. hapla), the bean root-knot nematode is insensitive to nematode resistance genes such as Mi, N, and Rk, and can parasitize and reproduce on resistant tomatoes and peppers, causing huge crop losses. In 2020, Koutsovoulos et al. performed whole-genome sequencing on the bean root-knot nematode. The bean root-knot nematode genome is 240 Mbp in size, and 59,733 coding genes, 4,068 non-coding genes, and 10,944 transposon elements were annotated, laying the foundation for research on resistance to the bean root-knot nematode. Huang Weiming et al. found bean root-knot nematode disease in various cucurbitaceous vegetables, including cucumber, bitter melon, loofah, and pumpkin, in Wenchang, Lingshui, and Dongfang, Hainan. Recent research results indicate that the root-knot nematode of the bean weevil is widely distributed in Hainan Island and has become an important nematode species for local crops, especially cucurbit vegetables. Therefore, how to effectively control the root-knot nematode disease of the bean weevil has become a key issue that urgently needs to be addressed in bitter gourd production.

[0004] Existing research indicates that continuous heavy irrigation, crop rotation with nematode-resistant bitter gourd, and the use of chemical pesticides can effectively control bitter gourd root-knot nematode disease. However, water scarcity and crop rotation with nematode-resistant crops can lead to economic losses, while chemical pesticides are expensive, pollute the environment, and pose food security risks. Therefore, the above research suggests that screening for nematode-resistant bitter gourd germplasm from existing bitter gourd germplasm resources is crucial. Summary of the Invention

[0005] In view of this, the present invention provides an SNP marker linked to bitter gourd resistance to root-knot nematode disease of *Cypripedium spp.* and its application. Based on this invention, disease resistance can be detected by sampling during the seedling stage of bitter gourd, providing support for the application of molecular marker-assisted breeding technology in bitter gourd breeding.

[0006] This invention, through identification and genome-wide association analysis of 192 bitter gourd germplasms collected from around the world for the disease of *Elephant Ear Root-Knot Nematode*, discovered an SNP marker linked to resistance to *Elephant Ear Root-Knot Nematode* in bitter gourd. This SNP is located at base 2122 in the coding region of the bitter gourd SEC8 gene, specifically at Chr4-25401664, and the base is either G or A.

[0007] The sequences containing the aforementioned SNP sites are shown in SEQ ID NO:4 (Sequence 1) and SEQ ID NO:5 (Sequence 2) in the sequence listing. The SNP site is located at position 251 of the sequence shown in SEQ ID NO:4 or SEQ ID NO:5. Sequence 1 is closely linked to susceptibility to *Heliotropium indicum* root-knot nematode disease, and Sequence 2 is closely linked to resistance to *Heliotropium indicum* root-knot nematode disease.

[0008] Furthermore, the present invention also provides a primer pair for amplifying the above-mentioned SNP marker, including a first primer pair and a second primer pair, wherein the first primer pair includes primer Chr4-25401664-CGF and primer Chr4-25401664R, and the second primer pair includes primer Chr4-25401664-CAF and primer Chr4-25401664R;

[0009] The nucleotide sequence of primer Chr4-25401664-CGF is: GGACTTGCCAAATTGTTTTAGGTCG (SEQ ID NO:1);

[0010] The nucleotide sequence of primer Chr4-25401664R is: AGAGCAGCAGACAAGGAACA (SEQ ID NO:2);

[0011] The nucleotide sequence of primer Chr4-25401664-CAF is: GGACTTGCCAAATTGTTTTAGGTCA (SEQ ID NO:3).

[0012] Furthermore, the present invention provides the application of the SNP marker or the primer pair in identifying resistance to root-knot nematode disease in bitter gourd and bean.

[0013] The method for determining the resistance of bitter gourd to root-knot nematode disease includes: amplifying bitter gourd genomic DNA using the primer pairs described above. If the product amplified using the first primer pair shows a band while the product amplified using the second primer pair shows no band, it indicates that the DNA sample being tested is of the G / G genotype and the material being tested is a low-resistance material (susceptible to disease). If the product amplified using the first primer pair shows no band while the product amplified using the second primer pair shows a band, it indicates that the DNA sample being tested is of the A / A genotype and the material being tested is a high-resistance material (resistant to disease). If both the first and second primer pairs show bands, it indicates that the material being tested has moderate resistance.

[0014] Compared with the prior art, the beneficial effects of the present invention are:

[0015] This invention provides a SNP molecular marker closely linked to resistance to root-knot nematode disease in bitter gourd. This SNP marker is located at position 2122 of the coding region of the bitter gourd SEC8 gene, specifically at Chr4-25401664. Using the SNP marker provided by this invention, the resistance to root-knot nematode disease in different bitter gourd germplasms can be rapidly and accurately analyzed, accelerating the application of marker-assisted selection technology in disease-resistant breeding of bitter gourd. Attached Figure Description

[0016] Figure 1 Electrophoresis image of PCR amplification products. Genomic DNA of different bitter gourd germplasms was amplified using primer pairs consisting of Chr4-25401664-CGF and Chr4-25401664R and Chr4-25401664-CAF and Chr4-25401664R. The results showed that: disease-resistant germplasms had no band on the left and a band on the right: 11, 18, 62, 136, 184, 192; disease-susceptible germplasms had a band on the left and no band on the right: 113, 122, 135, 144, 151, 189. Detailed Implementation

[0017] To better understand the technical content of this invention, the invention will be further described below with reference to specific embodiments.

[0018] Identification of resistance to root-knot nematode in bitter melon and soybean:

[0019] Soak bitter gourd seeds in warm water overnight, then wrap them in a damp cloth and place them in a 37℃ incubator for two days to germinate. After germination, sow them in seedling trays. Resistance was assessed using the diseased soil method. Diseased soil used to breed root-knot nematodes was mixed with sterilized nutrient soil in a 1:1 ratio and placed in 6cm×7.5cm plastic boxes. When seedlings reached two leaves and a central bud, they were transplanted into the plastic boxes, one seedling per box, with six replicates per sample. The plastic boxes were placed on trays and incubated at 28℃ for 45 days. Afterward, the bitter gourd roots were washed with water and dried. The fresh weight of the roots and the percentage of root knots were measured. The root knot grading system was based on Zhang Mingzhen's (2017) standard: Grade 0: no root knots in the entire root system; Grade 1: 1%–5% of the roots have root knots; Grade 2: 6%–25% of the roots have root knots; Grade 3: 26%–50% of the roots have root knots; Grade 4: 51%–75% of the roots have root knots; Grade 5: more than 75% of the roots have root knots. The corresponding disease index (DI) was calculated according to the methods of Shen Di et al. (2007) and Niu Xiaoping et al. (2013); the root knot index (GI) was calculated according to Nyczepir et al. (1999).

[0020] Disease Index (DI) = ∑(Number of diseased plants at each level × Disease level) / (Total number of plants surveyed × Highest disease level) × 100;

[0021] Root knot index (GI) = Number of root knots per bitter gourd plant / Fresh weight of root system per bitter gourd plant;

[0022] Experimental steps

[0023] (1) Genomic DNA was extracted from the bitter gourd germplasm to be tested using the Kangwei Century Plant DNA Extraction Kit (CW0531M), and the DNA concentration was adjusted to 50 ng / μL.

[0024] (2) Using the extracted genomic DNA as a template, polymerase chain reaction (PCR) was performed using primer pairs consisting of Chr4-25401664-CGF and Chr4-25401664R and Chr4-25401664-CAF and Chr4-25401664R to obtain PCR products.

[0025] Chr4-25401664-CGF:GGACTTGCCAAATTGTTTTAGGTCG;

[0026] Chr4-25401664R:AGAGCAGCAGACAAGGAACA;

[0027] Chr4-25401664-CAF: GGACTTGCCAAATTGTTTTAGGTCA;

[0028] (3) The PCR reaction system is 20 μL. PCR Master Mix (Shanghai Yisheng Biotechnology Co., Ltd.): 10 μL, forward primer Chr4-25401664-CGF / Chr4-25401664-CAF: 0.5 μL, reverse primer Chr4-25401664R: 0.5 μL, genomic DNA: 1 μL, ddH2O: 8 μL.

[0029] (4) PCR amplification reaction program: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 40 s, 35 cycles; 72℃ extension for 5 min, 16℃ for 5 min.

[0030] (5) The amplified PCR products were analyzed by agarose gel electrophoresis. For the same DNA sample, the amplified products of Chr4-25401664-CGF and Chr4-25401664R and the amplified products of Chr4-25401664-CAF and Chr4-25401664R were loaded into different gel wells. When the amplified products of Chr4-25401664-CGF and Chr4-25401664R showed bands while the amplified products of Chr4-25401664-CAF and Chr4-25401664R showed no bands, it indicated that the DNA sample was of the G / G genotype and the sample was susceptible to disease. Conversely, when both primer pairs showed bands, it indicated that the DNA sample was of the A / G genotype and the sample was resistant to disease.

[0031] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. An SNP marker linked to bitter gourd resistance to root-knot nematode disease in bean mulberry, characterized in that, It is located at the 251st base of the sequence shown in SEQ ID NO:4 or SEQ ID NO:5, and the base is G or A.

2. A primer pair for amplifying the SNP marker of claim 1, characterized in that: It includes a first primer pair and a second primer pair. The first primer pair includes primer Chr4-25401664-CGF and primer Chr4-25401664R, and the second primer pair includes primer Chr4-25401664-CAF and primer Chr4-25401664R. The nucleotide sequence of primer Chr4-25401664-CGF is: GGACTTGCCAAATTGTTTTAGGTCG; The nucleotide sequence of primer Chr4-25401664R is: AGAGCAGCAGACAAGGAACA; The nucleotide sequence of primer Chr4-25401664-CAF is: GGACTTGCCAAATTGTTTTAGGTCA.

3. The application of the SNP marker of claim 1 or the primer pair of claim 2 in identifying resistance to root-knot nematode disease in bitter gourd and bean.

4. The application according to claim 3, characterized in that, The method for determining the resistance of bitter gourd to root-knot nematode disease includes: amplifying bitter gourd genomic DNA using the primer pair described in claim 2; if the product amplified using the first primer pair has a band but the product amplified using the second primer pair has no band, the material to be tested is a low-resistance material; if the product amplified using the first primer pair has no band but the product amplified using the second primer pair has a band, the material to be tested is a high-resistance material; if both the amplification products of the first primer pair and the second primer pair have bands, it indicates that the material to be tested has moderate resistance.