An adeno-associated virus mutant that specifically infects l6 cells

Abstract

The present application relates to the packaging and screening of viral vectors, in particular to the packaging and screening of AAV mutants, specifically an adenovirus associated virus mutant specifically infecting L6 cells; the present application constructs a peptide segment mutation library of AAV9, and obtains a new AAV9 mutant with 7 inserted amino acids through screening verification, the mutant can effectively infect L6 cells under the condition of MOI=1E+5, and the infection effect is higher than that of the natural AAV9 serotype under the condition of MOI=1E+5, the effect of AAV9-L601 obtained through screening is the best, under the same MOI condition, the infection positive rate is obviously improved compared with the control AAV9 serotype, the multiple of the luciferase (RLU) value is 10.8 times through detection and statistics, the use amount of AAV infected cells is effectively reduced, and the experimental cost is saved.

Description

Technical Field

[0001] This invention relates to the packaging and screening of viral vectors, and more particularly to the packaging and screening of AAV mutants, specifically an adeno-associated virus mutant that specifically infects L6 cells. Background Technology

[0002] Adeno-associated virus (AAV) is a small, non-enveloped virus with an icosahedral structure, and is currently the simplest single-stranded DNA-deficient virus discovered. Due to its good safety profile, broad host cell range (dividing and non-dividing cells), low immunogenicity, and long duration of exogenous gene expression in vivo, it has gradually become an important platform for in vivo gene therapy delivery. As a powerful tool for gene therapy delivery, the development and modification of AAV has become a focus of industry attention. Modifying AAV serotypes can enhance AAV viral transduction efficiency and inhibit immune responses to the AAV capsid; current techniques for modifying AAV capsid proteins mainly include targeted modification, rational design, and computer-aided design.

[0003] L6 cells are rat myoblasts, a cell line isolated by Yaffe from the first two generations of primary cultured rat thigh muscle cells in the presence of methylcholanthrene. In culture, they fuse to form multinucleated myotubes and striated muscle fibers. Myoblasts are precursor cells found in skeletal muscle tissue that reconstruct muscle tissue after injury. However, the efficiency of currently available AAV viruses in infecting this cell line is relatively low, which limits the use of AAV viruses in in vitro testing, resulting in a large amount of AAV required for in vitro detection. Summary of the Invention

[0004] To address the shortcomings of existing technologies, this invention designs and modifies the AAV9 Cap sequence by randomly inserting seven amino acid fragments after amino acid 588, thereby constructing a library of AAV9 peptide mutants. These mutants are then screened in L6 cells to obtain new AAV serotypes that can efficiently infect myoblasts, thus meeting the needs of L6 cell lines for in vitro research applications and expanding the clinical options for treating muscle diseases with AAV.

[0005] The objective of this invention is achieved through the following solution:

[0006] This invention discloses an AAV9 serum-type capsid protein mutant with inserted heteropeptide;

[0007] The heteropeptide is a polypeptide whose amino acid sequence is ANLKKDV (SEQ ID NO:12);

[0008] The heteropeptide is inserted between amino acids 588 and 589 of the AAV9 serum-type capsid protein.

[0009] This invention discloses a nucleic acid molecule encoding the above-mentioned AAV9 serum capsid protein mutant.

[0010] This invention discloses a nucleic acid vector that can operatively link the above-mentioned nucleic acid molecules.

[0011] This invention discloses a host cell containing the above-mentioned nucleic acid vector.

[0012] This invention discloses a composition or kit containing the above-mentioned AAV9 serum capsid protein mutant, nucleic acid molecule or nucleic acid vector.

[0013] This invention discloses the use of the above-mentioned AAV9 serum capsid protein mutant, nucleic acid molecule or nucleic acid vector for infecting L6 cells, wherein the use is for non-diagnostic and non-therapeutic purposes.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] This technical solution constructs a peptide mutant library of AAV9 and, after screening and verification, obtains a new AAV9 mutant with 7 inserted amino acids. The mutant can effectively infect L6 cells at MOI=1E+5, achieving a higher infection effect than the natural AAV9 serotype at MOI=1E+5. The AAV9-L601 obtained after screening showed the best effect. Under the same MOI conditions, the infection positivity rate was significantly improved compared to the control AAV9 serotype, with a fold increase of 10.8 times as measured by luciferase (RLU) value detection. This effectively reduces the amount of AAV-infected cells required and saves experimental costs. Attached Figure Description

[0016] Figure 1 This is a flowchart illustrating the expression pAAV-shortUBC-mScarlet-polyA-P40-AAV9-Cap-FLEX-SV40polyA in Example 1;

[0017] Figure 2 The vector spectrum of pAAV-shortUBC-mScarlet-polyA-P40-AAV9-Cap-FLEX-SV40polyA in Example 1;

[0018] Figure 3 Flowchart for AAV9 library construction and screening;

[0019] Figure 4 Fluorescence images of L6 cells infected with different serotypes in Example 2;

[0020] Figure 5 The graph shows the luciferin (RLU) values ​​of L6 firefly cells infected with different serotypes in Example 2. Detailed Implementation

[0021] The present invention is further illustrated below by way of embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.

[0022] Example 1: Construction of AAV97-mer random peptide insertion library:

[0023] The library consists of the following media:

[0024] Library shuttle: pAAV-shortUBC-mScarlet-polyA-P40-AAV9-Cap-FLEX-SV40polyA, such as Figure 1 As shown.

[0025] Example 2: AAV9 library construction and screening process:

[0026] By constructing a random mutant library of AAV9 peptides, novel AAV9 mutants with the insertion of 7 amino acids were screened, such as... Figure 3 As shown.

[0027] 1. Preparation of mutant libraries

[0028] 1.1 Chemical synthesis of the following two fragments of AAV9-7mer-NNS:

[0029] 5'CCACCAGAGTGCCCAANNSNNSNNSNNSNNSNNSGCACAGGCGCAG 3'(S EQ ID NO:1);

[0030] 5'CGGTCTGCGCCTGTGCSNNSNNSNNSNNSNSNSNNTTTGGGCACTCTG 3'(SE Q ID NO:2);

[0031] NNS represents a random encoded sequence.

[0032] 1.2 10 μL each of the synthesized AAV9-7mer-NNS positive and reverse strand primers (final primer concentration 10 mM) were added and annealed to obtain the AAV9-7mer-NNS template. The annealing program was: 95℃, 5 min; 95℃, 1 min; 92 min, 1 min; 4℃, 60 min. In steps two and three, the temperature was decreased by 3℃ for each cycle, for a total of 25 cycles.

[0033] 1.3 The plasmid pAAV-short UBC-mScarlet-polyA-P40-AAV9-Cap-FLEX-SV40 polyA (its structure and insertion site are as follows) was prepared. Figure 2 As shown in Table 1, BsmBI was used for single enzyme digestion. The digestion system (50 μL) is shown in Table 1.

[0034] Table 1

[0035]

[0036]

[0037] After enzyme digestion at 55℃ for 4 hours, 1% agarose gel electrophoresis was performed. Large fragments were cut off under UV light and purified by blade.

[0038] 1.4 The purified enzyme digestion product obtained in step 1.3 and the AAV9-7mer-NNS nucleotide sequence obtained in step 1.2 were ligated using T4 DNA ligase. The ligation was performed using Takara's T4 DNA ligase, with a 10 μL reaction volume as shown in Table 2, and incubated overnight at 4°C.

[0039] Table 2

[0040]

[0041] 1.5 Add 10 μL of enzyme ligation product to 50 μL of library-specific electroporation competent cells (purchased from Lucigen), mix well, and transfer to a pre-cooled electrode cup. Electroporate using a Bio-Rad electroporator. After electroporation, add 1 mL of preheated SOC liquid culture medium at 37°C, and then thaw at 37°C for 1 hour before centrifugation and plating.

[0042] 1.6 Repeat steps 1.4-1.5 until the number of clones reaches 5 × 10⁻⁶. 11 .

[0043] 2. Library virus packaging and screening

[0044] 2.1 Packaging of AAV mutant library virus: 1.5 × 10⁻⁶ cells / plate 7Two 293AAV packaging cells were seeded into 15cm cell culture dishes and cultured for 18-24 hours. Transfection could begin once the cells adhered. Using PEI transfection reagent, a pAAV-short UBC-mScarlet-polyA-P40-AAV9-Cap-FLEX-SV40polyA–insertion expression vector library containing the AAV9-7mer-NNS insert fragment was packaged with a helper plasmid and transfected into 293AAV cells. 72 hours after transfection, the proportion of AAV-293 cells containing the vector library was counted under a fluorescence microscope to determine the viral packaging efficiency. After viral packaging was complete, the cells were repeatedly pipetted to completely detach them from the culture dish, and all cell samples were collected.

[0045] 2.2 Virus purification: The collected cell samples were repeatedly frozen and thawed at -80℃ and 37℃, centrifuged, and the cell supernatant was collected. Cell debris was removed using a 0.45μm PVDF filter. Subsequently, the collected recombinant AAV virus was purified using an AAV purification kit to obtain recombinant AAV virus.

[0046] 2.3 Determination of recombinant AAV virus titer: Take 20 μL of concentrated virus solution, add 1 μL of RNase-free DNase, mix well, incubate at 37℃ for 30 min, centrifuge at 10000 rpm for 10 min, take 20 μL of supernatant, add 80 μL of dilution buffer to another sterile tube, mix well, and react in a metal bath at 100℃ for 10 min. Allow to cool naturally to room temperature, add 3 μL of proteinase K, incubate at 37℃ for 60 min, react in a metal bath at 100℃ for 10 min, and cool to room temperature. Dilute the above sample and use it as a template to determine the recombinant AAV virus titer using real-time quantitative PCR. The qPCR reaction system and conditions are: 95℃, 10 min; 95℃, 30 s; 60℃, 30 s, 35 cycles.

[0047] 2.4 AAV virus infection of L6 cells:

[0048] 2.4.1 Cell Plating: L6 cells were seeded into 10cm cell culture dishes at a confluence of 40%, with 5 × 10⁶ cells per dish. 6 The cells are plated into multiple cell culture dishes.

[0049] 2.4.2 Viral infection: L6 cells were infected with the virus from the pAAV-short UBC-mScarlet-polyA-P40-AAV9-Cap-FLEX-SV40polyA–insertion expression vector library.

[0050] 2.5 Collect infected cells and perform fluorescence sorting using a flow cytometer. Select the cells with the highest red fluorescence intensity (top 5%) as the target cells for collection. After sorting and collecting, plate the cells into cell culture dishes, amplify them, and then collect the cells.

[0051] 2.6 After extracting the genome from the collected cells, PCR amplification was performed, and the PCR products were sequenced in high throughput.

[0052] Amplification primers:

[0053] AAV9-F: AACTACTAACCCGGTAGCAACGG (SEQ ID NO:3) (Forward primer on the vector)

[0054] AAV9-R: CGTCCGTGTGAGGAATTTTGG (SEQ ID NO:4) (Reverse primer on the vector)

[0055] The primers used for high-throughput sequencing with adapters and index sequences are as follows:

[0056] NGS-AAV9-F:

[0057] TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGAAACTACTAACCCGGTAGCAACGG(SEQ ID NO:5)

[0058] NGS-R1:

[0059] GTTCGTCTTCTGCCGTATGCTCTACACTGACCTCAAGTCTGCACACGAGAAGGCTAGCGAGTAATCGTCCGTGTGAGGAATTTTGG(SEQ ID NO:6)

[0060] NGS-R2:

[0061] GTTCGTCTTCTGCCGTATGCTCTACACTGACCTCAAGTCTGCACACGAGAAGGCTAGTCTCCGGACGTCCGTGTGAGGAATTTTGG(SEQ ID NO:7)

[0062] NGS-R3:

[0063] GTTCGTCTTCTGCCGTATGCTCTACACTGACCTCAAGTCTGCACACGAGAAGGCTAGAATGAGCGCGTCCGTGTGAGGAATTTTGG(SEQ ID NO:8)

[0064] NGS-R4:

[0065] GTTCGTCTTCTGCCGTATGCTCTACACTGACCTCAAGTCTGCACACGAGAAGGCTAGGGAATCTCCGTCCGTGTGAGGAATTTTGG(SEQ ID NO:9)

[0066] NGS-R5:

[0067] GTTCGTCTTCTGCCGTATGCTCTACACTGACCTCAAGTCTGCACACGAGAAGGCT AGTTCTGAATTTCCGTCCGTGTGAGGAATTTTGG(SEQ ID NO:10)

[0068] The expected sequencing sequence is:

[0069] AACTACTAACCCGGTAGCAACGGAGTCCTATGGACAAGTGGCCACAAACCACCAGAGTGCCCAANNSNNSNNSNNSNNSNNSNNSGCACAGGCGCAGACCGGCTGGGTTCAAAACCAAGGAATACTTCCGGGTATGGTTTGGCAGGACAGAGATGTGTACCTGCAAGGACCCATTTGGGCCAAAATTCCTCACACGGACG (SEQ ID NO: 11)

[0070] Analysis of high-throughput sequencing results led to the naming of frequently occurring mutants as AAV9-L6xx; for example, peptide 01 was named AAV9-L601.

[0071] 3. Screening and validation of AAV9 mutants

[0072] 3.1 Construction of AAV9 mutant

[0073] Using the natural serotype AAV9 as a vector, candidate mutant fragments such as AAV9-L6xx were inserted at amino acid positions 588-589 to obtain new serotype vectors such as AAV9-L6xx. Based on the results of high-throughput sequencing, more than 30 mutants were constructed.

[0074] 3.2 Using the shuttle vector pAAV-CBh-mScarlet-P2A-Luc2, various mutant serotypes of AAV virus were obtained by packaging with AAV9-L6xx and other serotype vectors.

[0075] 3.3 The viral titers of the above viruses were determined using WPRE primers, and the expression of viral VP1, VP2, and VP3 was confirmed using coccidial assay.

[0076] 3.4 Viruses such as pAAV-CBh-mScarlet-P2A-Luc2 containing AAV9-L6xx are classified with an MOI of 1×10⁻⁶. 5 The fluorescence images of L6 cells infected separately and the control AAV9 at 72 hours are shown below. Figure 4 As shown, the infection efficiency of the AAV9-L601 mutant serotype virus was significantly higher than that of the control AAV9. Simultaneously, the luciferase (RLU) value of cells was detected using firefly luciferase assays. Figure 5 As shown, under the same MOI conditions, the infection efficiency of AAV9-L601 was higher than that of the control AAV9. According to the statistical analysis of luciferase (RLU) value, the RLU value was 10.8 times higher than that of the control group AAV9.

Claims

1. An AAV9 serotype capsid protein mutant into which a heterologous peptide is inserted, characterized in that, the heterologous peptide is a polypeptide consisting of an amino acid sequence of ANLKKDV; the AAV9 serotype capsid protein has a sequence length of 736 amino acids; and the heterologous peptide is inserted between the 588th and 589th amino acids of the AAV9 serotype capsid protein.

2. A nucleic acid molecule encoding the AAV9 serotype capsid protein mutant of claim 1.

3. A nucleic acid vector into which the nucleic acid molecule of claim 2 is operably linked.

4. A composition comprising the nucleic acid vector of claim 3.

2. A nucleic acid molecule, characterized in that, 5. A composition or kit comprising the AAV9 serotype capsid protein mutant of claim 1, the nucleic acid molecule of claim 2, or the nucleic acid vector of claim 3.

6. Use of the AAV9 serotype capsid protein mutant of claim 1, the nucleic acid molecule of claim 2, or the nucleic acid vector of claim 3 for infecting L6 cells for non-diagnostic and therapeutic purposes.

4. A host cell characterized in that, ​ ​ ​

Images