Circular gRNA and its related biomaterials and applications

By designing a circular gRNA structure, the problem of insufficient gRNA stability in the CRISPR/Cas9 system was solved, achieving a more efficient genome editing effect.

CN116103284BActive Publication Date: 2025-09-23TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202111324163.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-11-09
Publication Date
2025-09-23
Estimated Expiration
2041-11-09

AI Technical Summary

Technical Problem

gRNA has poor stability in the CRISPR/Cas9 system and is easily degraded by nucleases, which limits the stability and efficiency of the system.

Method used

A circular gRNA design is adopted, by introducing a 3' intron, a 3' splice site, an insert, a gRNA encoding gene, a 5' splice site and a 5' intron into the gRNA encoding gene to form a circular structure to improve stability, and is used in combination with the Cas9 protein.

Benefits of technology

The stability and genome editing efficiency of the CRISPR/Cas9 system were improved, and the resistance of gRNA to exonuclease degradation was enhanced.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0003345670690000011
    Figure HDA0003345670690000011
  • Figure HDA0003345670690000012
    Figure HDA0003345670690000012
  • Figure HDA0003345670690000013
    Figure HDA0003345670690000013
Patent Text Reader

Abstract

The present invention discloses a circular gRNA and its related biomaterials and applications. The coding gene of the circular gRNA includes a 3' intron, a 3' splice site, a gRNA coding gene, a 5' splice site and a 5' intron in sequence, wherein the 3' splice site sequence is as shown in positions 2810-2814 of SEQ ID No.1, and the 5' splice site sequence is as shown in positions 2917-2930 of SEQ ID No.1. The circular gRNA is not attacked by nucleases, thereby improving the stability of the CRISPR / cas9 system.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to circular gRNA and related biomaterials and applications. Background Art

[0002] CRISPR / Cas9 is a genome editing tool consisting of the Cas9 protein and a guide RNA (gRNA). CRISPR / Cas9 has a variety of applications: first, treating genetic diseases caused by single gene mutations, including cystic fibrosis, Duchenne muscular dystrophy, and hemoglobinopathies; second, treating HIV; and third, combining it with CAR-T for cancer therapy. Genome editing typically employs two strategies: transfecting cells with a DNA fragment containing the gRNA and Cas9 coding sequence, or transfecting cells with a ribonucleoprotein (RNP) complex containing the Cas9 and gRNA.

[0003] The gRNA is a relatively unstable component of the CRISPR / Cas9 complex. Due to its inherent properties and the ubiquitous presence of RNases, it is easily degraded, a major limitation to improving system stability. Ryan et al. modified the 3' and 5' terminal nucleotides of the gRNA with 2'-methylphosphonate (MP) to protect the gRNA from exonuclease degradation. However, most available strategies involve chemical modifications and specialized processing, making them impractical and expensive to perform in the laboratory. Summary of the Invention

[0004] One of the purposes of the present invention is to improve the stability of gRNA.

[0005] The present invention provides a circular gRNA, wherein the circular gRNA is circular.

[0006] Optionally, the circular gRNA described above is prepared from the following coding genes.

[0007] The circular gRNA sequence may be as shown in any one of SEQ ID No. 4-7. The circular gRNA sequence may also be a sequence obtained by replacing N20 (i.e., positions 1-20) of the aforementioned circular gRNA sequence with an RNA sequence transcribed from any one of SEQ ID No. 11-19, with the other sequences remaining unchanged.

[0008] The present invention also provides a circular gRNA encoding gene, which includes a 3' intron, a 3' splice site, an insert, a gRNA encoding gene, a 5' splice site and a 5' intron in sequence, wherein the 3' splice site sequence is shown as positions 2810-2814 of SEQ ID No.1, and the 5' splice site sequence is shown as positions 2917-2930 of SEQ ID No.1.

[0009] Optionally, based on the above-mentioned coding gene, the length of the inserted fragment is 109-251 bp. For example, the inserted fragment cannot form a secondary structure with other transcribed elements and interfere with the formation of secondary structures of other elements.

[0010] Optionally, according to the above-mentioned coding gene, a homology arm 2 is further included, wherein the homology arm 2 is located between the gRNA coding gene and the 5' splice site, and the homology arm 2 sequence is reverse complementary to positions 1-19 of the insert sequence. Positions 1-19 of the insert sequence are also referred to as homology arm 1.

[0011] Optionally, the 3' intron sequence is shown as positions 2581-2809 of SEQ ID No. 1.

[0012] Optionally, the 5' intron sequence is shown as positions 2931-3095 of SEQ ID No. 1.

[0013] Optionally, the insert sequence is shown as SEQ ID No. 2 or SEQ ID No. 3.

[0014] Optionally, the gRNA encoding gene includes N20 and RNA fold, and the sequence is shown in positions 2819-2916 of SEQ ID No.1, wherein positions 2819-2838 are N20 sequences and positions 2839-2916 are RNA fold sequences. The gRNA encoding gene sequence may also be a sequence obtained by replacing the N20 sequence in the aforementioned gRNA encoding gene sequence with any of the sequences described in SEQ ID No.11-19, while keeping the other sequences unchanged.

[0015] Optionally, the coding gene sequence of the circular gRNA is any one of the following:

[0016] 1) As shown in positions 2581-3095 of SEQ ID No. 1, wherein positions 2581-2809 are 3' introns, positions 2810-2814 are 3' splice sites, positions 2815-2818 are splicing sequences, positions 2819-2916 are gRNA encoding genes (wherein positions 2819-2838 are N20 sequences, and positions 2839-2916 are RNA fold sequences), positions 2917-2930 are 5' splice sites, and positions 2931-3095 are 5' introns;

[0017] 2) inserting the sequence shown in SEQ ID No. 2 between the 3' splice site and the splicing sequence in the sequence described in 1) (i.e., between positions 2814 and 2815 of SEQ ID No. 1), while the other sequences remain unchanged;

[0018] 3) inserting the sequence shown in SEQ ID No. 3 between the 3' splice site and the splicing sequence in the sequence described in 1) (i.e., between positions 2814 and 2815 of SEQ ID No. 1), while the other sequences remain unchanged;

[0019] 4) inserting the sequence of SEQ ID No. 3 between the 3' splice site and the splicing sequence (i.e., between positions 2814-2815 of SEQ ID No. 1) in the sequence described in 1), and inserting the reverse complementary sequence of positions 1-19 of SEQ ID No. 3 between the gRNA encoding gene and the 5' splice site (i.e., between positions 3171-3172 of SEQ ID No. 1), while the other sequences remain unchanged;

[0020] 5) The N20 sequence in the sequences A11)-A14) is replaced with any one of the sequences described in SEQ ID No. 11-19, and the other sequences remain unchanged.

[0021] The biological materials related to the above-mentioned circular gRNA also fall within the scope of protection of the present invention.

[0022] The relevant biological material is any one of the following:

[0023] A1) an expression cassette containing the above-mentioned encoding gene;

[0024] A2) a recombinant vector containing the above-mentioned encoding gene, or a recombinant vector containing the expression cassette described in A1);

[0025] A3) a recombinant microorganism containing the aforementioned encoding gene, or a recombinant microorganism containing the expression cassette described in A1), or a recombinant microorganism containing the recombinant vector described in A3);

[0026] A4) Precursor RNA transcribed from the above-mentioned coding gene.

[0027] In the above-mentioned biological materials, the expression cassette refers to DNA capable of expressing a gene in a host cell, which may include not only a promoter for initiating gene transcription but also a terminator for terminating gene transcription. Furthermore, the expression cassette may also include an enhancer sequence.

[0028] For example, A1) the expression cassette sequence is any of the following:

[0029] A11) As shown in positions 2537-3095 of SEQ ID No. 1, wherein positions 2537-2580 are the promoter, positions 2581-2809 are the 3' intron, positions 2810-2814 are the 3' splice site, positions 2815-2818 are the splicing sequence, positions 2819-2916 are the gRNA encoding gene (wherein positions 2819-2838 are the N20 sequence, and positions 2839-2916 are the RNA fold sequence), positions 2917-2930 are the 5' splice site, and positions 2931-3095 are the 5' intron;

[0030] A12) inserting the sequence of SEQ ID No. 2 between the 3' splice site and the splicing sequence (i.e., between positions 2814-2815 of SEQ ID No. 1) in the sequence of A11), while the rest of the sequence remains unchanged;

[0031] A13) inserting the sequence of SEQ ID No. 3 between the 3' splice site and the splicing sequence (i.e., between positions 2814-2815 of SEQ ID No. 1) in the sequence of A11), while the rest of the sequence remains unchanged;

[0032] A14) inserting the sequence of SEQ ID No. 3 between the 3' splice site and the splicing sequence (i.e., between positions 2814-2815 of SEQ ID No. 1) in the sequence described in A11), and inserting the reverse complementary sequence of positions 1-19 of SEQ ID No. 3 between the gRNA encoding gene and the 5' splice site (i.e., between positions 3171-3172 of SEQ ID No. 1), while the other sequences remain unchanged;

[0033] A15) The N20 sequence in the sequences A11)-A14) is replaced with any one of the sequences described in SEQ ID No. 11-19, and the other sequences remain unchanged.

[0034] The present invention also provides a CRISPR / CAS9 system, which is any of the following:

[0035] (b1) comprising the aforementioned circular gRNA and Cas9 protein;

[0036] (b2) a fusion protein comprising the aforementioned circular gRNA, Cas9 protein, and cytosine dehydrogenase;

[0037] (b3) comprising the above-mentioned coding gene and Cas9 protein gene;

[0038] (b4) comprising a fusion protein gene comprising the above-mentioned coding gene and Cas9 protein and cytosine dehydrogenase;

[0039] (b5) comprising a plasmid having the above-mentioned coding gene and a plasmid having a Cas9 protein gene;

[0040] (b6) includes a plasmid having the above-mentioned coding gene and a plasmid having a Cas9 protein gene and a cytosine dehydrogenase gene.

[0041] The preparation method of the above-mentioned circular gRNA also falls within the scope of protection of the present invention, and the preparation method is M1 or M2.

[0042] M1 includes introducing the above-mentioned coding gene into a recipient cell to obtain the recombinant cell, and culturing the recombinant cell to obtain the circular gRNA.

[0043] The recipient cell may be any of the following:

[0044] C1) prokaryotic microbial cells;

[0045] C2) Gram-negative bacterial cells;

[0046] C3) Escherichia bacterial cells;

[0047] C4) Escherichia coli MG1655 cells;

[0048] C5) Eukaryotic cells, such as 392T, etc.

[0049] For example, M1 includes introducing the above-mentioned coding gene and a plasmid having a Cas9 protein gene and a cytosine dehydrogenase gene (such as the cytosine base editing plasmid described in the following examples) into a recipient cell to obtain the recombinant cell, and culturing the recombinant cell to obtain the circular gRNA.

[0050] M2 includes transcribing a transcription template to obtain a circular gRNA, wherein the transcription template consists of a promoter and the above-mentioned coding gene.

[0051] For example, M2 includes transcribing the transcription template to obtain a reaction product, treating the reaction product with DNase I, and purifying the reaction product with a column to obtain a purified product, wherein the purified product contains the circular gRNA. The reaction product can be specifically obtained by transcribing the transcription template to obtain a precursor RNA, and the precursor RNA is then obtained by a splicing reaction catalyzed by G-OH. If the precursor RNA does not contain guanosine or guanylate, 2mM guanosine triphosphate (GTP) can also be added to the precursor RNA to catalyze the splicing reaction.

[0052] In M2, the purified product may be treated with RNase R after the DNase I treatment.

[0053] In M2, the DNase I treatment may be followed by a treatment at 55° C. for 15 min.

[0054] For example, M2 includes transcribing a transcription template to obtain a reaction product, treating the reaction product with DNase I, treating the reaction product at 55° C. for 15 min, treating the reaction product with RNase R, and purifying the reaction product with a column to obtain a purified product, wherein the purified product contains the circular gRNA.

[0055] The application of the above-mentioned coding gene, the above-mentioned precursor RNA, the above-mentioned circular gRNA, the above-mentioned related biological materials or the above-mentioned CRISPR / CAS9 system also falls within the scope of protection of the present invention, and the application is specifically the application in the preparation of products for genome editing or genome editing.

[0056] The circular gRNA provided by the present invention is not attacked by nucleases, thereby improving the stability of the CRISPR / Cas9 system. The circular gRNA provided by the present invention, combined with Cas9, can efficiently edit genomic sequences and improve the base editing efficiency of CRISPR / Cas9. BRIEF DESCRIPTION OF THE DRAWINGS

[0057] Figure 1 Schematic diagram of the circular gRNA looping mechanism and the window for binding to cas9 to edit the genome.

[0058] Figure 2 The primers used in Example 1 were used to amplify gRNA.

[0059] Figure 3 This is the looping efficiency of the three gRNAs in Example 1.

[0060] Figure 4 The experimental results of Example 2 are shown.

[0061] Figure 5 This is the in vitro circularization efficiency of the three gRNAs in Example 3.

[0062] Figure 6 This is the experimental result of Example 3.

[0063] Figure 7 This is the experimental result of Example 4.

[0064] **Indicates P<0.01. DETAILED DESCRIPTION

[0065] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0066] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0067] Escherichia coli MG1655, laboratory-conserved, described in Glycosylase base editors enable C-to-A and C-to-G base changes, Nature Biotechnology volume 39, pages 35-40 (2021).

[0068] In the following examples, RNAprep Pure Cultured Cell / Bacteria Total RNA Extraction Kit (DP430) is a product of TIANGEN; Rever Tra Ace qPCR RT kit cDNA Synthesis Kit (FSQ-101) is a product of TOYOBO.

[0069] In the following examples, 2xEs Taq MasterMix (containing dye) (CW0690H) is a product of Beijing Kangwei Century Company.

[0070] In the following examples, the culture medium used is as follows:

[0071] Liquid LB medium is a sterile medium made of tryptone, yeast extract, NaCl and deionized water. The contents of tryptone, yeast extract and yeast extract are as follows: 10 g / L tryptone, 5 g / L yeast extract and 10 g / L NaCl.

[0072] Liquid LB medium with an apramycin sulfate concentration of 50 μg / mL is a sterile medium made of apramycin sulfate, tryptone, yeast extract, NaCl, and deionized water. The contents of apramycin sulfate, tryptone, yeast extract, and yeast extract are as follows: 50 μg / mL apramycin sulfate, 10 g / L tryptone, 5 g / L yeast extract, and 10 g / L NaCl.

[0073] The liquid LB medium with an apramycin sulfate concentration of 50 μg / mL and a chloramphenicol concentration of 60 μg / mL is a sterile medium made of chloramphenicol, tryptone, yeast extract, NaCl and deionized water. The contents of apramycin sulfate, chloramphenicol, tryptone, yeast extract and yeast extract are as follows: 50 μg / mL apramycin sulfate, 60 μg / mL chloramphenicol, 10 g / L tryptone, 5 g / L yeast extract and 10 g / L NaCl.

[0074] Solid LB medium is a sterile medium made of agar, tryptone, yeast extract, NaCl and deionized water. The contents of agar, tryptone, yeast extract and yeast extract are as follows: 15 g / L agar, 10 g / L tryptone, 5 g / L yeast extract and 10 g / L NaCl.

[0075] Solid LB medium with an apramycin sulfate concentration of 50 μg / mL is a sterile medium made of apramycin sulfate, agar, tryptone, yeast extract, NaCl, and deionized water. The contents of apramycin sulfate, agar, tryptone, yeast extract, and yeast extract are as follows: 50 μg / mL apramycin sulfate, 15 g / L agar, 10 g / L tryptone, 5 g / L yeast extract, and 10 g / L NaCl.

[0076] The solid LB medium with an apramycin sulfate concentration of 50 μg / mL and a chloramphenicol concentration of 60 μg / mL is a sterile medium made of apramycin sulfate, chloramphenicol, agar, tryptone, yeast extract, NaCl and deionized water. The contents of apramycin sulfate, chloramphenicol, agar, tryptone, yeast extract and yeast extract are as follows: 50 μg / mL apramycin sulfate, 60 μg / mL chloramphenicol, 15 g / L agar, 10 g / L tryptone, 5 g / L yeast extract and 10 g / L NaCl.

[0077] The circular gRNA ring formation mechanism prepared in the following examples and the schematic diagram of genome editing combined with cas9 are shown in FIG. Figure 1 As shown. A circular gRNA expression cassette (Circular gRNA expression cassette) of the implementation scheme includes a constitutive promoter, a 3' intron (3'intron), a 3' splice site (3'ss), a homology arm 1 (HA1) in the insert, an insert (Inserted sequence) excluding homology arm 1, a gRNA encoding gene (gRNA), homology arm 2 (HA2), a 5' splice site (5'ss) and a 5' intron (5'intron). The transcription product of the circular gRNA expression cassette is a precursor RNA (pre-cgRNA). In the precursor RNA, the 3' intron and the 5' intron form a splicing bubble through the complementary base pairing of homology arm 1 and homology arm 2, and a splicing reaction occurs through G-OH catalysis, and then forms a ring to produce a mature circular RNA molecule, which is referred to as fcgRNA (formed circular gRNA). Circular gRNA is not attacked by nuclease exonucleases, and the stability of the CRISPR / cas9 system is improved after combining with cas9.

[0078] Example 1. Length optimization of circular gRNA

[0079] The gRNA plasmids were obtained by inserting 0 bp, 109 bp and 251 bp rfp sequences (i.e., insert fragments) between the 3' splice site and the gRNA encoding gene. The constructed plasmids were named pcirgRNA, pcir109gRNA and pcir251gRNA, respectively. The sequence of pcirgRNA is shown in SEQ ID No. 1, wherein positions 2537-2580 are the promoter, positions 2581-2809 are the 3' intron, positions 2810-2814 are the 3'ss (splice site), positions 2815-2818 are the splicing sequence, positions 2819-2916 are the gRNA encoding gene (wherein positions 2819-2838 are the N20 sequence, and positions 2839-2916 are the RNA fold sequence), positions 2917-2930 are the 5'ss (splice site), positions 2931-3095 are the 5' intron, positions 1-483 are the terminator for terminating transcription of the circular gRNA expression cassette, and positions 484-1103 are the replication initiation site. The sequence of pcir109gRNA was obtained by inserting a 109bp RFP sequence (SEQ ID No. 2) between the 3' splice site and splice sequence of the pcirgRNA sequence (i.e., between positions 2814-2815 of SEQ ID No. 1). The sequence of pcir251gRNA was obtained by inserting a 251bp RFP sequence (SEQ ID No. 3) between the 3' splice site and splice sequence of the pcirgRNA sequence (i.e., between positions 2814-2815 of SEQ ID No. 1).

[0080] The three constructed circular gRNA plasmids and the cytosine base editing plasmid (described in Glycosylase base editors enable C-to-A and C-to-G base changes) were transformed into Escherichia coli MG1655 and screened on solid LB medium containing 50 μg / mL apramycin sulfate and 60 μg / mL chloramphenicol to obtain positive transformants of E. coli BL21 (DE3). Positive transformants of E. coli MG1655 contained plasmids pcir gRNA, pcir109 gRNA, and pcir251 gRNA, respectively. Positive transformants of E. coli MG1655 were transferred into liquid LB medium containing 50 μg / mL apramycin sulfate and 60 μg / mL chloramphenicol, cultured at 37°C to an OD600nm of ≈0.1, induced with 0.4 mM isopropyl-β-D-thiogalactopyranoside (IPTG) for 12 hours, and the cells were harvested. The total RNA of Escherichia coli MG1655 positive transformants was extracted using RNAprep Pure cultured cells / bacteria total RNA extraction kit.

[0081] Total RNA was reverse transcribed into cDNA using the Rever TraAce qPCR RT kit cDNA synthesis kit according to the instructions.

[0082] Primer pairs RT0cg-F and RT0cg-R were used to verify the circularization rate of 0cgRNA expressed by pcirgRNA, and RT0cg-F and RT251cgRNA-R were used to verify the circularization rates of 109cgRNA and 251cgRNA expressed by pcir109gRNA and pcir251gRNA, respectively. Figure 2 As shown in the upper figure, using the cDNA reverse transcribed from 0cgRNA expressed by pcirgRNA as a template, the primers RTcDNA-F and RTcDNA-R amplified a fragment size of 112bp, which was used to detect the total amount of 0cgRNA. Using the cDNA reverse transcribed from 109cgRNA and 251cgRNA expressed by pcir109gRNA and pcir251gRNA respectively as a template, the primers RTcDNA-F and RTcDNA-R amplified a fragment size of 112bp, which was used to detect the total amount of 109cgRNA and 251cgRNA. If the cgRNAs expressed by the plasmids above form a circle, primers RT0cg-F and RT0cg-R will amplify a 103bp cDNA fragment using cDNA transcribed from the 0cgRNA fragment expressed by pcirgRNA as a template. RT0cg-F and RT251cgRNA-R will amplify a 120bp fragment using cDNA transcribed from the 109cgRNA or 251cgRNA expressed by pcir109gRNA and pcir251gRNA as templates. If the cgRNAs expressed by the plasmids above do not form a circle, primers RT0cg-F and RT0cg-R will not amplify a band using cDNA transcribed from the 0cgRNA expressed by pcirgRNA as a template. RT0cg-F and RT251cgRNA-R will not amplify a band using cDNA reverse-transcribed from the 109cgRNA or 251cgRNA expressed by pcir109gRNA and pcir251gRNA as a template.

[0083] RTcDNA-F:gcccggtaaacagcacgttg

[0084] RT cDNA-R: acctgagatcATCCAAGCACCG

[0085] RT0Cg-F:AGGCTAGTCCGTTATCAACTTGAAAAAAGT

[0086] RT0Cg-R:CTAGCTCTAAAACTCATACTGCACCGG

[0087] RTC251g-R: CATACGAACTTTGAAACGCATGAACTC

[0088] The DNA polymerase used for verification was 2xEs Taq MasterMix (containing dye). The samples after PCR reaction were run on gel, and the electrophoresis pattern is shown in Figure 2 The lower figure in the figure, where lane M is MARKER, and from lane M onwards are the products amplified using RTcDNA-F and RTcDNA-R with cDNA transcribed from 0cgRNA expressed by pcirgRNA as template, the fragment amplified using RTcDNA-F and RTcDNA-R with cDNA transcribed from 109cgRNA expressed by pcir109gRNA as template, and the fragment amplified using RTcDNA-F and RTcDNA-R with cDNA transcribed from 251cgRNA expressed by pcir251gRNA as template. Gel running results of the fragments amplified using DNA-R, the fragments amplified using RT0cg-F and RT0cg-R as templates for cDNA transcribed from 0cgRNA expressed by pcirgRNA, the fragments amplified using RT0cg-F and RT251cgRNA-R as templates for cDNA transcribed from 109cgRNA expressed by pcir109gRNA, and the fragments amplified using RT0cg-F and RT251cgRNA-R as templates for cDNA transcribed from 251cgRNA expressed by pcir251gRNA.

[0089] The fragments amplified using RT0cg-F and RT0cg-R or RT0cg-F and RT251cgRNA-R were sent for sequencing. Sanger sequencing of the cgRNA splice junction revealed that the 5' splice site was connected to the 3' splice site, indicating that the cgRNA had formed a loop.

[0090] Image J was used to quantitatively analyze the bands representing the total amount of expressed cgRNA (i.e., fragments amplified with RTcDNA-F and RTcDNA-R) and the bands representing circular gRNA (i.e., fragments amplified with RT0cg-F and RT0cg-R / RT251cgRNA-R) in the electrophoresis diagram, and the respective molar numbers were calculated. The circularization rate = molar number of circular gRNA / molar number of total expressed cgRNA × 100%.

[0091] Ringing efficiency Figure 3As shown, the looping efficiency of 0cgRNA expressed by pcirgRNA is 0%, the looping efficiency of 109cgRNA expressed by pcirg109RNA is 5%, and the looping efficiency of 251cgRNA expressed by pcir251gRNA is the highest, reaching 35%.

[0092] In the following examples, the circular gRNA is collectively referred to as circular gRNA (fcgRNA, formed circular gRNA).

[0093] In summary, the circular gRNA in the pcirgRNA expression product is called OfcgRNA, the OfcgRNA sequence is shown in SEQ ID No. 4, positions 1-20 are the N20 sequence, positions 21-98 are the RNA fold sequence, positions 103-112 are the 5'ss transcription sequence, and positions 113-117 are the 3'ss transcription sequence. The circular gRNA in the pcir109gRNA expression product is called 109fcgRNA, the 109fcgRNA sequence is shown in SEQ ID No. 5, positions 1-20 are the N20 sequence, and positions 21-98 are the RNA fold sequence. The circular gRNA in the pcir251gRNA expression product is called 251fcgRNA, the 251fcgRNA sequence is shown in SEQ ID No. 6, and positions 1-20 are the N20 sequence.

[0094] Example 2: In vivo editing of circular gRNA

[0095] In Escherichia coli cells, the editing efficiency of cytosine base editors using circular gRNA was improved compared with that of unmodified gRNA, with the highest increase being 197%.

[0096] Experimental process:

[0097] The sequence of linear pAgRNA (laboratory preservation) is shown in SEQ ID No. 20, wherein positions 2537-2580 are promoters, positions 2581-2584 are splicing sequences, positions 2585-2604 are N20 sequences, positions 2605-2682 are RNA fold sequences, positions 1_483 are terminators for terminating transcription of the gRNA expression cassette, and positions 484-1103 are replication initiation sites. The N20 sequences of pAgRNA were replaced with the following N20 sequences by primer embedding and Golden Gate to construct linear gRNA plasmids of 9 sites. The linear gRNA plasmids express the corresponding linear gRNAs.

[0098] The N20 sequences of the plasmids pcirgRNA, pcir109gRNA, and pcir251gRNA prepared in Example 1 were replaced with the following N20 sequences, respectively, to construct a 9-site circular gRNA plasmid. One of the expression products of the circular gRNA plasmid was the corresponding circular gRNA.

[0099] 9 N20 sequences:

[0100] adhE ACCCTGAGCATCGTTCGTAA (SEQ ID No. 11);

[0101] dcuA GCCCAGCAGGAACAGCCAGA (SEQ ID No. 12);

[0102] ldhA GCCCGGTAAACAGCACGTTG (SEQ ID No. 13);

[0103] spoT site1TCCCGCCACCTACCAGGATA(SEQ ID No.14);

[0104] spoT site2 ACCCACAACATGCGCACGCT(SEQ ID No.15);

[0105] pfIB GCCCATACCACCGATAGATT(SEQ ID No.16);

[0106] rpoSACCCTGCAGCATCGGCCCGA(SEQ ID No.17):

[0107] dcuB ACCCCGGCAGAATAAAGCTG (SEQ ID No. 18);

[0108] lacZ TCCCGCCCGGTGCAGTATGA (SEQ ID No. 19).

[0109] 1 μL of the circular gRNA plasmid or linear gRNA plasmid at a concentration of 50 ng / μL and 1 μL of the cytosine base editor plasmid at a concentration of 50 ng / μL were transformed into Escherichia coli MG1655 competent cells and screened on solid LB medium containing 50 μg / mL apramycin sulfate and 60 μg / mL chloramphenicol to obtain positive transformants of E. coli BL21(DE3). The positive transformants of E. coli MG1655 were transferred into liquid LB medium containing 50 μg / mL apramycin sulfate and 60 μg / mL chloramphenicol and cultured at 37°C to an OD600 nm of ≈0.1. The cells were induced with 0.4 mM isopropyl-β-D-thiogalactopyranoside (IPTG) for 12 h, and 1 μL of the bacterial solution was used for PCR using Taq DNA polymerase (Kangwei Century, China). The PCR products were subjected to high-throughput sequencing to calculate the editing efficiency (Jinweizhi, China).

[0110] To calculate the base editing efficiency of the gRNA, the bacterial culture was amplified by PCR using primers targeting N20s. A series of 8-nt barcodes were designed and added to the 5′ end of the forward primer. 100 ng of PCR products were mixed to construct a 150-nt single-paired-end library, which was then sequenced using Illumina high-throughput sequencing (Baimaike, China).

[0111] For paired-end sequencing results, reads 1 and 2 were merged based on overlapping regions to create a complete sequence, generating a FASTA-formatted file. Data were segmented based on barcodes. The merged sequence was aligned to the reference sequence using BWA software (version 0.7.12). Target sites with 100,000 to 1,000,000 independent reads were selected, and significant base substitutions were observed only at the target base editing site. The base substitution frequency was calculated by dividing the number of base substitution reads by the total number of reads.

[0112] The experimental results are as follows Figure 4As shown, nine different genomic sites, ldhA, dcuA, dcuB, rpoS, spoT-site1, spoT-site2, pfIB, adhE, and lacZ, were selected. C2, C3, and C4 represent the second, third, and fourth C positions on the N20 sequence, respectively. gRNA represents the result of base editing using a linear gRNA plasmid, 0cgRNA represents the result of base editing using a circular gRNA plasmid constructed with pcirgRNA, 109cgRNA represents the result of base editing using a circular gRNA plasmid constructed with pcir109gRNA, and 251cgRNA represents the result of base editing using a circular gRNA plasmid constructed with pcir251gRNA. The results showed that the editing efficiency of 251cgRNA at the second C position (C2) at the four sites of dcuA, spoT site1, ropS, and lacZ was 1.1 to 4.2 times that of gRNA, with an average increase of 80%. At the third C position, the editing efficiency of 251c gRNA was 1.2 to 2.8 times that of gRNA, with an average increase of 107%. At the fourth C position, the editing efficiency of 251gRNA was 1 to 6.5 times that of gRNA, with an average increase of 197%.

[0113] Example 3. In vitro cleavage of circular gRNA

[0114] The linear gRNA transcription template consists of a T7 promoter and a linear gRNA encoding gene (sequence shown in SEQ ID No. 20, positions 2537-2682). The N20 sequence of the linear gRNA encoding gene was replaced with the pfIB N20 sequence (SEQ ID No. 16), spoT-site2 N20 sequence (SEQ ID No. 15), and lacZ N20 sequence (SEQ ID No. 19) to construct a linear gRNA transcription template expressing the corresponding gRNA.

[0115] The 0cgRNA transcription template consists of a T7 promoter and the 0cgRNA encoding gene. The 0cgRNA encoding gene sequence is shown in SEQ ID No. 1, positions 2581-3095, of which positions 2581-2809 are the 3' intron, positions 2810-2814 are the 3' splice site, positions 2815-2818 are the splicing sequence, positions 2819-2916 are the gRNA encoding gene (of which positions 2819-2838 are the N20 sequence, and positions 2839-2916 are the RNA fold sequence), positions 2917-2930 are the 5' splice site, and positions 2931-3095 are the 5' intron. The N20 sequence was replaced with the pfIB N20 sequence (SEQ ID No. 16), spoT-site2 N20 sequence (SEQ ID No. 15), and lacZ N20 sequence (SEQ ID No. 19) to construct an OcgRNA transcription template expressing the corresponding cgRNA.

[0116] The 109cgRNA transcription template consists of a T7 promoter and the 109cgRNA encoding gene. The 109cgRNA encoding gene sequence was inserted into the 0cgRNA encoding gene sequence between the 3' splice site and the splicing sequence (i.e., between positions 2814-2815 of SEQ ID No. 1) with the sequence shown in SEQ ID No. 2, while the other sequences remained unchanged. The N20 sequence was replaced with the pfIB N20 sequence (SEQ ID No. 16), spoT-site2 N20 sequence (SEQ ID No. 15), and lacZ N20 sequence (SEQ ID No. 19) to construct a 109cgRNA transcription template expressing the corresponding cgRNA.

[0117] The 251cgRNA transcription template consists of a T7 promoter and the 251cgRNA encoding gene. The 251cgRNA encoding gene sequence is inserted between the 3' splice site and the splicing sequence of the 0cgRNA encoding gene sequence (i.e., between positions 2814-2815 of SEQ ID No. 1), with the sequence shown in SEQ ID No. 3, while the other sequences remain unchanged. The N20 sequence is replaced with the pfIB N20 sequence (SEQ ID No. 16), spoT-site2 N20 sequence (SEQ ID No. 15), and lacZ N20 sequence (SEQ ID No. 19) to construct a 251cgRNA transcription template expressing the corresponding cgRNA.

[0118] The linear gRNA transcription template, 0cgRNA transcription template, 109cgRNA transcription template and 251cgRNA transcription template gRNA were transcribed using the TranscriptAid T7 High Yield Transcription Kit according to the instructions.

[0119] The same method as in Example 1 was used to detect the looping rate of gRNA. Figure 5 As shown, the circularization rate of gRNA (cgRNA) transcribed from 0cgRNA transcription template is 0%, the circularization rate of gRNA (109cgRNA) transcribed from 109cgRNA transcription template is 8.5%, and the circularization rate of gRNA (251cgRNA) transcribed from 251cgRNA transcription template is 47%.

[0120] The gRNA was treated with DNase I (18047019, Thermo) at 37°C for 20 minutes and 55°C for 15 minutes (to increase the circularization rate) and column-purified (RNA Purification Kit, TIANGEN, DP412). After incubation at 37°C for 0, 8, 16, or 24 hours, the cleavage reaction was performed. A 20 μL reaction system contained 150 ng of cleavage substrate (i.e., pfIB, spoT-site2, or lacZ gene fragment), 150 nM of gRNA, and 20 nM of cas9 (Z03469, Genscript). The reaction was performed at 37°C for 2 hours. After completion of the reaction, gel electrophoresis was performed, and band intensity was semi-quantified using Image J to determine the molar number of cleaved template (U mole) and the molar number of approximately 1000 bp fragment generated (D1 mole). The corresponding cleavage efficiency was calculated as: D1 mole / (U mole + D1 mole) × 100%.

[0121] The sequence of the pfIB gene fragment is shown in SEQ ID No.8, the sequence of the spoT-site2 gene fragment is shown in SEQ ID No.9, and the sequence of the lacZ gene fragment is shown in SEQ ID No.10.

[0122] Some experimental results are as follows Figure 6The upper figure shows the cutting efficiency statistics, and the lower figure shows the electrophoresis diagram. The time in the figure is the static time of the gRNA, band U is the cutting template, band D1 is a fragment of about 1000bp produced by cutting, and band D2 is a fragment of about 500bp produced by cutting. The results showed that after being placed at 37°C for 8 hours, the activity of the unmodified gRNA was almost completely lost. For 251cgRNA, after being placed at 37°C for 8 hours, the cutting efficiency at pfIB was 71.6% ± 3.4%, the cutting efficiency at spoT-site2 was 94.5% ± 5.5%, and the cutting efficiency at lacZ was 96.5% ± 3.4%, with an average cutting efficiency of 87.5% ± 11.3%. After being placed at 37°C for 24 hours, 251cgRNA maintained an average cutting efficiency of 25.8% ± 11.2%, indicating that the stability of circular gRNA in vitro is significantly higher than that of linear gRNA. At 37°C, the half-life of circular gRNA is 24 hours, and the half-life of linear gRNA is 4 hours.

[0123] Example 4: In vitro cleavage of 251cgRNA′

[0124] Based on the structure of the pCir251 gRNA, a reverse complementary sequence of RFP was inserted between the gRNA encoding gene sequence and the 5' splice site sequence to construct the pCir251 gRNA' plasmid. Specifically, the sequence of the pCir251 gRNA' plasmid was obtained by inserting a 251 bp RFP sequence (SEQ ID No. 3) between the 3' splice site and the splice sequence in the pCir gRNA sequence (i.e., between positions 2814-2815 of SEQ ID No. 1), and inserting a 19 bp reverse complementary sequence of the RFP partial sequence (positions 1-19 of SEQ ID No. 3) between the gRNA encoding gene and the 5' splice site (i.e., between positions 3171-3172 of SEQ ID No. 1). One of the expression products was the circular gRNA251fcgRNA' (SEQ ID No. 7).

[0125] Detected by the method described in Example 1, the circularization rate of the gRNA transcribed from the pcir251gRNA′ plasmid was close to 100%.

[0126] The 251cgRNA′ transcription template consists of a T7 promoter and the 251cgRNA′ coding gene. The 251cgRNA′ coding gene sequence consists of the sequence shown in SEQ ID No. 3 inserted between the 3' splice site and the splice sequence of the 0cg coding gene (i.e., between positions 2814-2815 of SEQ ID No. 1). The reverse complement of positions 1-19 of SEQ ID No. 3 is inserted between the gRNA coding gene and the 5' splice site (i.e., between positions 3171-3172 of SEQ ID No. 1). All other sequences remain unchanged. The N20 sequence of the 251cgRNA′ coding gene was replaced with the pfIB N20 sequence (SEQ ID No. 16), spoT-site2 N20 sequence (SEQ ID No. 15), and lacZ N20 sequence (SEQ ID No. 19) to construct a 251cgRNA′ transcription template expressing the corresponding cgRNA.

[0127] The TranscriptAid T7 High Yield Transcription Kit was used to transcribe the linear gRNA transcription template constructed in Example 3, the 251cgRNA transcription template, and the gRNA of the 251cgRNA′ transcription template constructed above according to the instruction manual. It was divided into two treatment groups, a control group and an experimental group. The control group gRNA was treated with DNase I at 37°C for 20 min and then at 55°C for 15 min, and then column purified (RNA purification kit, TIANGEN, DP412). The experimental group gRNA was treated with DNase I at 37°C for 20 min and 55°C for 15 min, and then RNase R (Epicentre) (1 U can digest 1 μg of linear gRNA) was used, treated at 37°C for 15 min, and then column purified. The gRNA was placed at 37 degrees for a period of time, and the three sites of pfIB, spoT-site2, and lacZ were selected for cleavage reaction. The cleavage reaction conditions and the cleavage efficiency calculation method were the same as in Example 3.

[0128] The experimental results are as follows Figure 7The upper figure is the shearing efficiency statistics, and the lower figure is the electrophoresis diagram. The time in the figure is the static time of gRNA or circular gRNA, band U is the cutting template, band D1 is the fragment of about 1000bp produced by cutting, and band D2 is the fragment of about 500bp produced by cutting. gRNA (1) represents the cutting reaction result of gRNA transcribed from the linear gRNA transcription template of the control group, and purified251cgRNA (2) represents the cutting reaction result of cgRNA transcribed from the 251cgRNA transcription template of the experimental group after RNaseR digestion. The corresponding results are shown in Figure 2. 251cgRNA′(3) represents the result of the cleavage reaction of the cgRNA transcribed from the 251cgRNA′ transcription template in the control group, and Purified251cgRNA′(4) represents the result of the cleavage reaction of the cgRNA transcribed from the 251cgRNA′ transcription template in the experimental group. At the pfIB, spoT-site2, and lacZ sites, the activities of the purified 251cgRNA at 37°C for 24 hours were 3.26, 2.64, and 1.55 times higher than those of the unpurified 251cgRNA, respectively. This shows that there is no significant difference in the cleavage efficiency of the 251cgRNA′ purified by the column and the 251cgRNA′ purified by RNase R treatment.

[0129] Comparison of the shearing efficiency of 251cgRNA purified by the column in Example 3 and 251cgRNA purified by RNase R treatment in Example 4 shows that the shearing efficiency of 251cgRNA purified by RNase R digestion increased by 326% compared with that of 251cgRNA purified by the column.

[0130] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims. Sequence Listing <110> Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences <120> Circular gRNA and its related biomaterials and applications <130> 212558 <160> 20 <170> SIPOSequenceListing 1.0 <210> 1 <211> 3095 <212> DNA <213> Artificial Sequence <400> 1 tagcatccaa actcgagtaa ggatctccag gcatcaaata aaacgaaagg ctcagtcgaa 60 agactgggcc tttcgtttta tctgttgttt gtcggtgaac gctctctact agagtcacac 120 tggctcacct tcgggtgggc ctttctgcgt ttatacctag ggcgttcggc tgcggctcta 180 [[ID=...]] cttttgtttg ttagtcttga tgcttcactg atagatacaa gagccataag aacctcagat 240 ccttccgtat ttagccagta tgttctctag tgtggttcgt tgagcgacag atcgctgaga 300 taggtgcctc actgattaag cattggtaac tgtcagacca agtttactca tatatacttt 360 agattgattt aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata 420 atctcatgac caaaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag 480 aaaagatcaa aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa 540 caaaaaaacc accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt 600 ttccgaaggt aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc 660 cgtagttagg ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa 720 tcctgttacc agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa 780 gacgatagtt accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc 840 ccagcttgga gcgaacgacc tacaccgaac tgagatacct acagcgtgag ctatgagaaa 900 gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa 960 caggagagcg cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg 1020 ggttcgcca cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc 1080 tatggaaaaa cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg 1140 ctcacatgtt ctttcctgcg attaaattt aattaagtgt aggctggagc tgcttcgaag 1200 ttcctatact ttctagagaa taggaacttc ggaataggaa cttcaagatc ccctcacgct 1260 gccgcaagca cgtgatcgaa atccagatcc ttgacccgca gttgcaaacc ctcactgatc 1320 cggctcacgg taactgatgc cgtatttgca gtaccagcgt acggcccaca gaatgatgtc 1380 acgctgaaaa tgccggcctt tgaatgggtt catgtgcagc tccatcagca aaaggggatg 1440 ataagtttat caccaccgac tatttgcaac agtgccgttg atcgtgctat gatcgactga 1500 tgtcatcagc ggtggagtgc aatgtcgtgc aatacgaatg gcgaaaagcc gagctcatcg 1560 gtcagcttct caaccttggg gttacccccg gcggtgtgct gctggtccac agctccttcc 1620 gtagcgtccg gcccctcgaa gatgggccac ttggactgat cgaggccctg cgtgctgcgc 1680 tgggtccggg agggacgctc gtcatgccct cgtggtcagg tctggacgac gagccgttcg 1740 atcctgccac gtcgcccgtt acaccggacc ttggagttgt ctctgacaca ttctggcgcc 1800 tgccaaatgt aaagcgcagc gcccatccat ttgcctttgc ggcagcgggg ccacaggcag 1860 agcagatcat ctctgatcca ttgcccctgc cacctcactc gcctgcaagc ccggtcgccc 1920 gtgtccatga actcgatggg caggtacttc tcctcggcgt gggacacgat gccaacacga 1980 cgctgcatct tgccgagttg atggcaaagg ttccctatgg ggtgccgaga cactgcacca 2040 ttcttcagga tggcaagttg gtacgcgtcg attatcga gaatgaccac tgctgtgagc 2100 gctttgcctt ggcggacagg tggctcaagg agaagagcct tcagaaggaa ggtccagtcg 2160 gtcatgcctt tgctcggttg atccgctccc gcgacattgt ggcgacagcc ctgggtcaac 2220 tgggccgaga tccgttgatc ttcctgcatc cgccagaggg cgggatgcga agaatgcgat 2280 gccgctcgcc agtcgattgg ctgagctcat gagcggagaa cgagatgacg ttggaggggc 2340 aaggtcgcgc tgattgctgg ggcaacacgt gaaaggcgag atcaccaagg tagtcggcaa 2400 ataatgcta acaattcgtt caagccgacg ccgcttcgcg gcggctta actcaagcgt 2460 tagatgcact aagcacataa ttgctcacag ccaaactatc aggtcaagtc tgctctagca 2520 cctgaagtca gcctgtctag gtttatacat aggcgagtac tctgttatgg agtcagatct 2580 aattctagag aaaatttcgt ctggattagt tacttatcgt gtaaaatctg ataaatggaa 2640 ttggttctac ataaatgcct aacgactatc cctttgggga gtagggtcaa gtgactcgaa 2700 acgatagaca acttgcttta acaagttgga gatatagtct gctctgcatg gtgacatgca 2760 gctggatata attccggggt aagattaacg accttatctg aacataatgc tacctgcttc 2820 ccgcccggtg cagtatgagt tttagagcta gaaatagcaa gttaaaataa ggctagtccg 2880 ttatcaactt gaaaaagtgg caccgagtcg gtgcttggat gatctcaggt caattgaggc 2940 ctgagtataa ggtgacttat acttgtaatc tatctaaacg gggaacctct ctagtagaca 3000 atcccgtgct aaattgtagg actgcccttt aataaatact tctatattta aagaggtatt 3060 tatgaaaagc ggaatttatc agattaaaaa tactt 3095 <210> 2 <211> 109 <212> DNA <213> Artificial Sequence <400> 2 ttagcgagta gcgaagacgt tatcaaagag ttcatgcgtt tcaaagttcg tatggaaggt 60 tccgttaacg gtcacgagtt cgaaatcgaa ggtgaaggtg aaggtcgtc 109 <210> 3 <211> 251 <212> DNA <213> Artificial Sequence <400> 3 ttagcgagta gcgaagacgt tatcaaagag ttcatgcgtt tcaaagttcg tatggaaggt 60 tccgttaacg gtcacgagtt cgaaatcgaa ggtgaaggtg aaggtcgtcc gtacgaaggt 120 acccagaccg ctaaactgaa agttaccaaa ggtggtccgc tgccgttcgc ttgggacatc 180 ctgtccccgc agttccagta cggttccaaa gcttacgtta aacacccggc tgacatcccg 240 gactacctga a 251 <210> 4 <211> 121 <212> RNA <213> Artificial Sequence <400> 4 gcccgguaaa cagcacguug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuugg augaucucag gucuaccugc 120 u 121 <210> 5 <211> 230 <212> RNA[[ID=二十九]] <213> Artificial Sequence <400> 5 gcccgguaaa cagcacguug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuugg augaucucag gucuaccuua 120 gcgaguagcg aagacguuau caaagaguuc augcguuuca aaguucguau ggaagguucc 180 It should be noted that there may be some inaccuracies in the above translation due to the complexity and potential ambiguity of the original text which seems to be some kind of genetic sequence related content. You may need to double-check with the source or relevant experts for more accurate understanding and refinement.guuaacgguc acgaguucga aaucgaaggu gaaggugaag gucgucugcu 230 <210> 6 <211> 372 <212> RNA <213> Artificial Sequence <400> 6 gcccgguaaa cagcacguug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuugg augaucucag gucuaccuua 120 gcgaguagcg aagacguuau caaagaguuc augcguuuca aaguucguau ggaagguucc 180 guuaacgguc acgaguucga aaucgaaggu gaaggugaag gucguccgua cgaagguacc 240 cagaccgcua aacugaaagu uaccaaaggu gguccgcugc cguucgcuug ggacauccug 300 uccccgcagu uccaguacgg uuccaaagcu uacguuaaac acccggcuga caucccggac 360 uaccugaaug cu 372 <210> 7 <211> 391 <212> RNA <213> Artificial Sequence <400> 7 gcccgguaaa cagcacguug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuugg aucgucuucg cuacucgcua 120 agaucucagg ucuaccuuag cgaguagcga agacguuauc aaagaguuca ugcguuucaa 180 aguucguaug gaagguuccg uuaacgguca cgaguucgaa aucgaaggug aaggugaagg 240 ucguccguac gaagguaccc agaccgcuaa acugaaaguu accaaaggug guccgcugcc 300 guucgcuugg gacauccugu ccccgcaguu ccaguacggu uccaaagcuu acguuaaaca 360 cccggcugac aucccggacu accugaaugc u 391 <210> 8 <211> 2081 <212> DNA <213> Artificial Sequence <400> 8 cgtgttcgac gtttacactc cggacatcct gcgttgccgt aaatctggtg ttctgaccgg 60 tctgccagat gcatatggcc gtggccgtat catcggtgac taccgtcgcg ttgcgctgta 120 cggtatcgac tacctgatga aagacaaact ggcacagttc acttctctgc aggctgatct 180 ggaaaacggc gtaaacctgg aacagactat ccgtctgcgc gaagaaatcg ctgaacagca 240 ccgcgctctg ggtcagatga aagaaatggc tgcgaaatac ggctacgaca tctctggtcc 300 ggctaccaac gctcaggaag ctatccagtg gacttacttc ggctacctgg ctgctgttaa 360 gtctcagaac ggtgctgcaa tgtccttcgg tcgtacctcc accttcctgg atgtgtacat 420 cgaacgtgac ctgaaagctg gcaagatcac cgaacaagaa gcgcaggaaa tggttgacca 480 cctggtcatg aaactgcgta tggttcgctt cctgcgtact ccggaatacg atgaactgtt 540 ctctggcgac ccgatctggg caaccgaatc tatcggtggt atgggcctcg acggtcgtac 600 cctggttacc aaaacagct tccgtttcct gaacaccctg tacaccatgg gtccgtctcc 660 ggaaccgaac atgaccattc tgtggtctga aaaactgccg ctgaacttca agaaattcgc 720 cgctaaagtg tccatcgaca cctcttctct gcagtatgag aacgatgacc tgatgcgtcc 780 ggacttcaac aacgatgact acgctattgc ttgctgcgta agcccgatga tcgttggtaa 840 acaaatgcag ttcttcggtg cgcgtgcaaa cctggcgaaa accatgctgt acgcaatcaa 900 cggcggcgtt gacgaaaaac tgaaaatgca ggttggtccg aagtctgaac cgatcaaagg 960 cgatgtcctg aactatgatg aagtgatgga gcgcatggat cacttcatgg actggctggc 1020 taaacagtac atcactgcac tgaacatcat ccactacatg cacgacaagt acagctacga 1080 agcctctctg atggcgctgc acgaccgtga cgttatccgc accatggcgt gtggtatcgc 1140 tggtctgtcc gttgctgctg actccctgtc tgcaatcaaa tatgcgaaag ttaaaccgat 1200 tcgtgacgaa gacggtctgg ctatcgactt cgaaatcgaa ggcgaatacc cgcagtttgg 1260 taacaatgat ccgcgtgtag atgacctggc tgttgacctg gtagaacgtt tcatgaagaa 1320 aattcagaaa ctgcacacct accgtgacgc tatcccgact cagtctgttc tgaccatcac 1380 ttctaacgtt gtgtatggta agaaaacggg taacacccca gacggtcgtc gtgctggcgc 1440 gccgttcgga ccgggtgcta acccgatgca cggtcgtgac cagaaaggtg gcctgcctc 1500 tctgacttcc gttgctaaac tgccgtttgc ttacgtaaa gatggtatct cctacacctt 1560 ctctatcgtt ccgaacgcac tgggtaaaga cgacgaagtt cgtaagacca acctggctgg 1620 tctgatggat ggttacttcc accacgaagc atccatcgaa ggtggtcagc acctgaacgt 1680 taacgtgatg aaccgtgaaa tgctgctcga cgcgatggaa aacccggaaa aatatccgca 1740 gctgaccatc cgtgtatctg gctacgcagt acgtttcaac tcgctgacta aagaacagca 1800 gcaggacgtt attactcgta ccttcactca atctatgtaa ttagatttga ctgaaatcgt 1860 acagtaaaaa gcgtacaata aaggctccac gaaagtgggg ccttttttag cgcgagagcc 1920 ttttttgtca gctatctata ctttaaggtg actgccaaaa cagactcgac gtagccttcg 1980 agctgcgcac caacacggcc tcagatgggc cacatctgga gaaacaccgc aatgtcagtt 2040 attggtcgca ttcactcctt tgaatcctgt ggaaccgtag a 2081 <210> 9 <211> 2070 <212> DNA <213> Artificial Sequence <400> 9 cgccgtgctc tttataagcc cagtgcgcgg caacacccat ctccgccatc tggtccatat 60 cttcggtacg gatctggacc tcaaccggca caccgtgcgg gccgatcatc gaggtgtgca 120 aagactgata gccgttcgct tttggaatgg cgatatagtc tttcacgcgg cccggacgcg 180 gcttgtacag gctgtgcatc tggcccagca cgcgataaca ggtgtcagaa tcattgacga 240 tcacgcggaa agcgtagatg tccatgatcg agtgaaaacg ctgctctttg agcaccattt 300 tgcagtaaat cgaataaaga tgcttctcgc gaccactgac gcggcacggt attcccgctt 360 cctgcaaacg cccttcgatt tcagaaagaa tcttctggat catctcttta cggttgccgc 420 gcgcggcttt caccacttct ttgattacgc gataacggtt gggatacagc gcctcaaaac 480 ccagctcttc gagttcggtt ttaatgtggt ggatacctaa acggtgcgcc agcgggctat 540 aaatttcgag agtttcacgg gcgatgcggc gacgtttgtc cgggcgaagt gagcccagcg 600 tgcgcatgtt gtgggtacgg tcggcaagtt tgatgaggat gacgcggata tcctgcacca 660 tcgccataat catcttgcga aagttttcgg cctgcgcctc tttcttatcg cggaacttga 720 gtttatcaag tttcgacacc ccctctacca gctcggcgac gcttttacca aaaagctgtt 780 ccatatcctg gtaggtggcg ggagtatctt caatcacgtc atgcagcagc gccgccatca 840 gcgtttcata gtcgagtttc atctcggcca gaatgcaggc aaccgctacc gggtgcgtga 900 tatagggttc accgcttgaa cgtgtttgcc cctcgtgagc atcacgtgca acgagatacg 960 cctgccgcag acgcttgatt tggtcttccg gcaggtaggt ttgaatcagt tgattcaggc 1020 tttcaaacag atacaagggc gacccgcttt gtgattaacg acgaccttca gcaatagcgg 1080 taacggcttg taattcagcg gcttcctgct cttgctgttc ctggcgttcg cgaacgtcga 1140 ggatctggtt gttgatcaga ccttcttcga tttcgcgcag cgcgattaca gtggttttat 1200 cgttttttc cggtaccagc ggatcctttc cgctacctg catctgacga gcgcgacgcg 1260 cggcgaccag taccaggtca aaacggttac caattttctc tacagcgtcc tgaacagtta 1320 cgcgtgccat acttaaaaag ctccacaggt gaagaaatga ctgggcatga tactgaaatc 1380 aggttcagtc tgccaacaat ttgctgatta aagcgtcatg acgctgcttt tggcggctca 1440 tgcgcagacg ttcggcgcga ataatggtct tcaaatcggt caacgcggta tcgaagtcat 1500 cattcacaat cagataatca tattcggcgt aatggctcat ttctgcaaca gcttgcgcca 1560 tacgctttgc aatgacctct tcgctgtcct gaccgcgacc gcgtagacgg cggtccagtt 1620 caattttgga cggcggtaaa ataaagatac tccgcgcgtg cggcatcttc tggcgaattt 1680 gctgcgcgcc ctgccagtcg atatcgagaa aaacatcgac accggtcgcc agtacttgct 1740 caatggcctc acgcgaagtg ccatagtaat taccaaaaac ttctgcgtgt tcgaggaacg 1800 catctctgct aatcatttct ttaaattcat catgattaac aaagaaataa tgttcaccgt 1860 ggacttcacc aggacgcggt tggcgtgtgg tgtgtgaaac agaaacctgg gtgtcataca 1920 acggttgggt ttttaataaa gcctgaatca ggctggattt acccgcgcca ctgggggcag 1980 aaacaatata aagcgtgcct tgagccatga gtatctttcg tatgtgatta gcgaaataaa 2040 gcctacatac gagcttatta tacacggcgc 2070 <210> 10 <211> 2030 <212> DNA <213> Artificial Sequence <400> 10 agttgcgtga ctacctacgg gtaacagttt ctttatggca gggtgaaacg caggtcgcca 60 gcggcaccgc gcctttcggc ggtgaaatta tcgatgagcg tggtggttat gccgatcgcg 120 tcacactacg tctgaacgtc gaaaacccga aactgtggag cgccgaaatc ccgaatctct 180 atcgtgcggt ggttgaactg cacaccgccg acggcacgct gattgaagca gaagcctgcg 240 atgtcggttt ccgcgaggtg cggattgaaa atggtctgct gctgctgaac ggcaagccgt 300 tgctgattcg aggcgttaac cgtcacgagc atcatcctct gcatggtcag gtcatggatg 360 agcagacgat ggtgcaggat atcctgctga tgaagcagaa caactttaac gccgtgcgct 420 gttcgcatta tccgaaccat ccgctgtggt acacgctgtg cgaccgctac ggcctgtatg 480 tggtggatga agccaatatt gaaacccacg gcatggtgcc aatgaatcgt ctgaccgatg 540 atccgcgctg gctaccggcg atgagcgaac gcgtaacgcg aatggtgcag cgcgatcgta 600 atcacccgag tgtgatcatc tggtcgctgg ggaatgaatc aggccacggc gctaatcacg 660 acgcgctgta tcgctggatc aaatctgtcg atccttcccg cccggtgcag tatgaaggcg 720 gcggagccga caccacggcc accgatatta tttgcccgat gtacgcgcgc gtggatgaag 780 accagccctt cccggctgtg ccgaaatggt ccatcaaaaa atggctttcg ctacctggag 840 agacgcgccc gctgatcctt tgcgaatacg cccacgcgat gggtaacagt cttggcggtt 900 tcgctaaata ctggcaggcg tttcgtcagt atccccgttt acagggcggc ttcgtctggg 960 actgggtgga tcagtcgctg attaaatatg atgaaaacgg caacccgtgg tcggcttacg 1020 gcggtgattt tggcgatacg ccgaacgatc gccagttctg tatgaacggt ctggtctttg 1080 ccgaccgcac gccgcatcca gcgctgacgg aagcaaaaca ccagcagcag tttttccagt 1140 tccgtttatc cgggcaaacc atcgaagtga ccagcgaata cctgttccgt catagcgata 1200 acgagctcct gcactggatg gtggcgctgg atggtaagcc gctggcaagc ggtgaagtgc 1260 ctctggatgt cgctccacaa ggtaaacagt tgattgaact gcctgaacta ccgcagccgg 1320 agagcgccgg gcaactctgg ctcacagtac gcgtagtgca accgaacgcg accgcatggt 1380 cagaagccgg gcacatcagc gcctggcagc agtggcgtct ggcggaaaac ctcagtgtga 1440 cgctccccgc cgcgtcccac gccatcccgc atctgaccac cagcgaaatg gatttttgca 1500 tcgagctggg taataagcgt tggcaattta accgccagtc aggctttctt tcacagatgt 1560 ggattggcga taaaaaacaa ctgctgacgc cgctgcgcga tcagttcacc cgtgcaccgc 1620 tggataacga cattggcgta agtgaagcga cccgcattga ccctaacgcc tgggtcgaac 1680 gctggaaggc ggcgggccat taccaggccg aagcagcgtt gttgcagtgc acggcagata 1740 cacttgctga tgcggtgctg attacgaccg ctcacgcgtg gcagcatcag gggaaaacct tatttatcag ccggaaaacc taccggattg atggtagtgg tcaaatggcg attaccgttg atgttgaagt ggcgagcgat acaccgcatc cggcgcggat tggcctgaac tgccagctgg 1920. cgcaggtagc agagcgggta aactggctcg gattagggcc gcaagaaaac tatcccgacc 1980. gccttactgc cgcctgtttt gaccgctggg atctgccatt gtcagacatg <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <400> 11 accctgagca tcgttcgtaa <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <400> 12 gcccagcagg aacagccaga <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <400> 13 gcccggtaaa cagcacgttg <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <400> 14 tcccgccacc taccaggata 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <400> 15 acccacaaca tgcgcacgct 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <400> 16 gcccatacca ccgatagatt 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <400> 17 accctgcagc atcggcccga 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <400> 18 accccggcag aataaagctg 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <400> 19 tcccgcccgg tgcagtatga 20 <210> 20 <211> 2048 <212> DNA <213> Artificial Sequence <400> 20 aaatttaatt aagtgtaggc tggagctgct tcgaagttcc tatactttct agagaatagg 60 aacttcggaa taggaacttc aagatcccct cacgctgccg caagcacgtg atcgaaatcc 120 agatccttga cccgcagttg caaaccctca ctgatccggc tcacggtaac tgatgccgta 180 tttgcagtac cagcgtacgg cccacagaat gatgtcacgc tgaaaatgcc ggcctttgaa 240 tgggttcatg tgcagctcca tcagcaaaag gggatgataa gtttatcacc accgactatt 300 tgcaacagtg ccgttgatcg tgctatgatc gactgatgtc atcagcggtg gagtgcaatg 360 tcgtgcaata cgaatggcga aaagccgagc tcatcggtca gcttctcaac cttggggtta 420 cccccggcgg tgtgctgctg gtccacagct ccttccgtag cgtccggccc ctcgaagaatg 480 ggccacttgg actgatcgag gccctgcgtg ctgcgctggg tccgggagg acgctcgtca 540 tgccctcgtg gtcaggtctg gacgacgagc cgttcgatcc tgccacgtcg cccgttacac 600 cggaccttgg agttgtctct gacacattct ggcgcctgcc aaatgtaaag cgcagcgccc 660 atccatttgc ctttgcggca gcggggccac aggcagagca gatcatctct gatccattgc 720 ccctgccacc tcactcgcct gcaagcccgg tcgcccgtgt ccatgaactc gatgggcagg 780 tacttctcct cggcgtggga cacgatgcca acacgacgct gcatcttgcc gagttgatgg 840 caaaggttcc ctatggggtg ccgagacact gcaccattct tcaggatggc aagttggtac 900 gcgtcgatta tctcgagaat gaccactgct gtgagcgctt tgccttggcg gacaggtggc 960 tcaaggagaa gagccttcag aaggaaggtc cagtcggtca tgcctttgct cggttgatcc 1020 gctcccgga cattgtggcg acagccctgg gtcaactggg ccgagatccg ttgatcttcc 1080 tgcatccgcc agagggcggg atgcgaagaa tgcgatgccg ctcgccagtc gattggctga 1140 gctcatgagc ggagaacgag atgacgttgg aggggcaagg tcgcgctgat tgctggggca 1200 acacgtgaaa ggcgagatca ccaaggtagt cggcaaataa tgtctaacaa ttcgttcaag 1260 ccgacgcgcg ttcgcggcgc ggcttaactc aagcgttaga tgcactaagc acataattgc 1320 tcacagccaa actatcaggt caagtctgct ctagcacctg aagtcagcct gttaatacga 1380 ctcactatag ggtcccgccc ggtgcagtat gagttttaga gctagaaata gcaagttaaa 1440 ataaggctag tccgttatca acttgaaaaa gtggcaccga gtcggtgctt agcatccaaa 1500 ctcgagtaag gatctccagg catcaaataa aacgaaaggc tcagtcgaaa gactgggcct 1560 ttcgttttat ctgttgtttg tcggtgaacg ctctctacta gagtcacact ggctcacctt 1620 cgggtgggcc tttctgcgtt tatacctagg gcgttcggct gcggctctac ttttgtttgt 1680 tagtcttgat gcttcactga tagatacaag agccataaga acctcagatc cttccgtatt 1740 tagccagtat gttctctagt gtggttcgtt gagcgacaga tcgctgagat aggtgcctca 1800 ctgattaagc attggtaact gtcagaccaa gtttactcat atatacttta gattgattta 1860 aaacttcatt tttaatttaa aaggatctag gtgaagatcc tttttgataa tctcatgacc 1920 aaaatccctt aacgtgagtt ttcgttccac tgagcgtcag accccgtaga aaagatcaaa 1980 ggatcttctt gagatcctttt ttttctgcgc gtaatctgct gcttgcaaac aaaaaacca 2040 ccgctacc 2048

Claims

1. A circular gRNA, characterized in that: The circular gRNA is circular and is prepared from a coding gene, wherein the coding gene sequentially includes a 3' intron, a 3' splice site, an insert, a gRNA encoding gene, a homology arm 2, a 5' splice site, and a 5' intron, wherein the 3' splice site sequence is as shown in positions 2810-2814 of SEQ ID No. 1, and the 5' splice site sequence is as shown in positions 2917-2930 of SEQ ID No. 1, and the homology arm 2 sequence is reverse complementary to positions 1-19 of the insert sequence.

2. The circular gRNA according to claim 1, wherein: The length of the inserted fragments ranged from 109 to 251 bp.

3. A gene encoding a circular gRNA, characterized in that: It includes a 3' intron, a 3' splice site, an insert, a gRNA encoding gene, a homology arm 2, a 5' splice site and a 5' intron in sequence, wherein the 3' splice site sequence is as shown in positions 2810-2814 of SEQ ID No.1, and the 5' splice site sequence is as shown in positions 2917-2930 of SEQ ID No.1; the homology arm 2 sequence is reverse complementary to positions 1-19 of the insert sequence.

4. The coding gene according to claim 3, characterized in that: The length of the inserted fragments ranged from 109 to 251 bp.

5. The biological material related to the circular gRNA according to claim 1 or 2, characterized in that: The relevant biological material is any one of the following: A1) an expression cassette containing the encoding gene according to claim 3 or 4; A2) a recombinant vector containing the encoding gene according to claim 3 or 4, or a recombinant vector containing the expression cassette according to A1); A3) a recombinant microorganism containing the encoding gene according to claim 3 or 4; A4) Precursor RNA transcribed from the coding gene according to claim 3 or 4.

6. CRISPR / CAS9 system, characterized by: Any of the following: (b1) comprising the circular gRNA and Cas9 protein according to claim 1 or 2; (b2) comprising the circular gRNA of claim 1 or 2 and a fusion protein consisting of a Cas9 protein and a cytosine dehydrogenase; (b3) comprising the coding gene according to claim 3 or 4 and the Cas9 protein gene; (b4) comprising a coding gene according to claim 3 or 4 and a fusion protein gene consisting of a Cas9 protein and a cytosine dehydrogenase; (b5) comprising a plasmid having the coding gene according to claim 3 or 4 and a plasmid having a Cas9 protein gene; (b6) comprises a plasmid having the coding gene according to claim 3 or 4 and a plasmid having a Cas9 protein gene and a cytosine dehydrogenase gene.

7. A method for preparing circular gRNA, characterized in that: The preparation method is M1 or M2, M1 comprises introducing the encoding gene according to claim 3 or 4 into a recipient cell to obtain a recombinant cell, and culturing the recombinant cell to obtain the circular gRNA; M2 includes a transcription template to obtain the circular gRNA, wherein the transcription template consists of a promoter and the coding gene according to claim 3 or 4.

8. The preparation method according to claim 7, characterized in that: The recipient cell is any one of the following: C1) prokaryotic microbial cells; C2) Eukaryotic cells.

9. The preparation method according to claim 8, characterized in that: The prokaryotic microbial cells are Gram-negative bacterial cells.

10. The preparation method according to claim 9, characterized in that: The Gram-negative bacterial cells are Escherichia bacterial cells.

11. The preparation method according to claim 10, characterized in that: The Escherichia bacterial cells are Escherichia coli MG1655 cells.

12. Use of the circular gRNA of claim 1 or 2, the encoding gene of claim 3 or 4, the related biological material of claim 5, or the CRISPR / CAS9 system of claim 6, wherein the use is in the preparation of a product for genome editing or genome editing.

Citation Information

Patent Citations

  • Compositions comprising circular polyribonucleotides and uses thereof

    CN112567038A