Application of OsADF1 and coding gene thereof in regulation and control of plant salt tolerance

Abstract

The invention discloses application of OsADF1 and a coding gene thereof in regulating and controlling salt tolerance of plants. The invention provides an application of a protein OsADF1 or a related biological material thereof in regulating and controlling the salt tolerance of plants. The protein OsADF1 comprises a protein of an amino acid residue as shown in SEQ ID No.3; the invention proves that the OsADF1 protein and the coding gene thereof regulate and control the plant salt stress response, and compared with a wild type Kitaake, a knockout strain obtained by knocking out the OsADF1 gene shows remarkable salt tolerance. Therefore, the OsADF1 protein and the coding gene thereof are proved to negatively regulate the salt tolerance or the salt stress response of the plant.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to the application of OsADF1 and its encoding gene in regulating plant salt tolerance. Background Art

[0002] Soil salinity is an environmental factor that has a serious negative impact on crop growth and productivity. Rice is an important cereal crop that feeds half of the world's population and is very sensitive to salt stress. Long-term salinity leads to the depletion of sodium ions (Na2+) in rice aboveground tissues. + Excessive accumulation of salt ( ) affects the normal function of plant cells in many ways, causing continuous osmotic and oxidative stress on plants, significantly reducing rice productivity. Therefore, improving rice salt tolerance is crucial to global food security.

[0003] Thanks to the rapid development of molecular biology, genomics, genetics, biochemistry and gene editing technology, research on the molecular mechanisms of plant response to salt stress has been continuously updated.

[0004] Therefore, it is necessary to discover genes that regulate salt tolerance in plants. Summary of the Invention

[0005] The technical problem solved by the present invention is how to regulate plant salt tolerance.

[0006] In order to solve the above technical problems, the first aspect of the present invention provides the use of protein OsADF1 or related biological materials in regulating plant salt tolerance: The protein OsADF1 is the following A1) or A2) or A3): A1) a protein comprising the amino acid residues shown in SEQ ID No. 3; A2) A plant-derived protein having the same biological function as the protein of A1) obtained by substitution and / or deletion and / or addition of one or more amino acid residues; A3) A protein that has 80% or more identity with the amino acid sequence defined in A1) and is derived from a plant and has the same biological function; A4) A fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of any of the proteins shown in A1) to A3).

[0007] In the applications described above, the above-mentioned protein is derived from rice.

[0008] The above proteins can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0009] In the above-mentioned proteins, the tag is a protein tag, which refers to a polypeptide or protein that is fused and expressed with the target protein using in vitro DNA recombination technology to facilitate the expression, detection, tracing, and / or purification of the target protein. The protein tag can be a Flag tag, His tag, MBP tag, HA tag, Myc tag, GST tag, and / or SUMO tag, etc.

[0010] The protein shown in A1) above may be a protein consisting of the amino acid sequence shown in SEQ ID No. 3; In the protein shown in A2) above, the substitution and / or deletion and / or addition of one or several amino acid residues is a substitution and / or deletion and / or addition of no more than 10 amino acid residues.

[0011] The gene encoding the protein shown in A2) above can be obtained by deleting one or several codons for amino acid residues from the DNA sequence shown in SEQ ID No. 1 or SEQ ID No. 2, and / or performing missense mutations of one or several base pairs, and / or attaching a coding sequence with a tag at its 5′ and / or 3′ end.

[0012] For the protein shown in A3) above, identity refers to amino acid sequence identity. Amino acid sequence identity can be determined using an internet identity search site, such as the BLAST page on the NCBI homepage. For example, using Advanced BLAST 2.1, you can calculate the identity of a pair of amino acid sequences by using blastp as the program, setting the Expect value to 10, all filters to OFF, using BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively. The identity value (%) can be calculated.

[0013] In the above proteins, the above 80% or greater identity may be at least 81%, 82%, 85%, 86%, 88%, 90%, 91%, 92%, 95%, 96%, 98%, 99% or 100% identity.

[0014] In the above application, the protein OsADF1-related biological material is any one of B1) to B7): B1) a nucleic acid molecule encoding the protein OsADF1; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5) a transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2); B6) transgenic plant tissue containing the nucleic acid molecule described in B1), or transgenic plant tissue containing the expression cassette described in B2); B7) A transgenic plant organ containing the nucleic acid molecule described in B1) or a transgenic plant organ containing the expression cassette described in B2).

[0015] In the above application, the nucleic acid molecule encoding the protein OsADF1 is a DNA molecule shown in any one of C1) to C4): C1) the coding region (CDS) includes the DNA molecule shown in SEQ ID NO: 1 or SEQ ID NO: 2; C2) a DNA molecule whose nucleotide sequence includes SEQ ID NO: 1 or SEQ ID NO: 2; C3) a DNA molecule having 75% or more identity with the nucleotide sequence defined in C1) or C2), derived from a plant and encoding the protein OsADF1 described in the first aspect; C4) A DNA molecule that hybridizes under stringent conditions with the nucleotide sequence defined in C1) or C2) and is derived from a plant and encodes the protein OsADF1 described in the first aspect.

[0016] In the nucleic acid molecules described above, C1) may be a DNA molecule whose coding region is represented by SEQ ID NO: 1 or SEQ ID NO: 2.

[0017] In the nucleic acid molecules described above, C2) may be a DNA molecule having a nucleotide sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0018] Specifically, SEQ ID NO: 2 in the above C1) is genomic DNA; SEQ ID NO: 1 in the above C1) is cDNA.

[0019] The terms "nucleic acid", "nucleic acid sequence", "nucleotide", "nucleic acid molecule" or "polynucleotide" used in the present invention are meant to include isolated DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., messenger RNA), natural types, mutant types, synthetic DNA or RNA molecules, DNA or RNA molecules composed of nucleotide analogs, single-stranded or double-stranded structures. These nucleic acids or polynucleotides include gene coding sequences, antisense sequences and regulatory sequences of non-coding regions, but are not limited to these. These terms include a gene. "Gene" or "gene sequence" is widely used to refer to a functional DNA nucleic acid sequence. Therefore, a gene may include introns and exons in a genomic sequence, and / or include a coding sequence in a cDNA, and / or include a cDNA and its regulatory sequences. In specific embodiments, such as with respect to an isolated nucleic acid sequence, it is preferably assumed to be cDNA. A person of ordinary skill in the art can easily use known methods, such as gene editing methods, to mutate the nucleotide sequence encoding the protein Pm26 of the present invention. Any artificially modified nucleotides that have 75% or higher identity with the nucleotide sequence of the protein Pm26 isolated according to the present invention, as long as they encode the protein Pm26, are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention.

[0020] The term "identity" refers to sequence similarity to a naturally occurring nucleic acid sequence. Identity can be assessed visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to assess the identity between related sequences. The 75% or greater identity can mean at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identity.

[0021] The above stringent conditions are hybridization and washing twice at 68°C in a 2×SSC, 0.1% SDS solution for 5 minutes each, and hybridization and washing twice at 68°C in a 0.5×SSC, 0.1% SDS solution for 15 minutes each; or hybridization and washing at 65°C in a 0.1×SSPE (or 0.1×SSC), 0.1% SDS solution.

[0022] As described above, the expression cassette containing a nucleic acid molecule refers to a DNA sequence capable of expressing the aforementioned proteins in a host cell. The expression cassette may also include a single-stranded or double-stranded nucleic acid molecule containing all regulatory sequences necessary to express the nucleic acid molecule for any of the aforementioned proteins. The regulatory sequences are capable of directing the expression of any of the aforementioned proteins from the coding sequence in a suitable host cell under compatible conditions. The regulatory sequences include, but are not limited to, a leader sequence, a polyadenylation sequence, a propeptide sequence, a promoter, a signal sequence, and a transcription terminator. At a minimum, the regulatory sequences include a promoter and termination signals for transcription and translation. To introduce specific restriction enzyme sites into the vector for ligating the regulatory sequences to the coding region of the protein-encoding nucleic acid sequence, the regulatory sequences may be provided with linkers. The regulatory sequence may be a suitable promoter sequence, i.e., a nucleic acid sequence recognized by the host cell in which the nucleic acid sequence is to be expressed. The promoter sequence contains transcriptional regulatory sequences that mediate protein expression. The promoter may be any nucleic acid sequence that is transcriptionally active in the selected host cell, including mutant, truncated, and hybrid promoters, and may be derived from genes encoding extracellular or intracellular proteins that are homologous or heterologous to the host cell. A regulatory sequence may also be a suitable transcription terminator sequence, i.e., a sequence recognized by the host cell to terminate transcription. The terminator sequence may be operably linked to the 3' end of the nucleic acid sequence encoding the protein. Any terminator that is functional in the selected host cell may be used in the present invention. A regulatory sequence may also be a suitable leader sequence, i.e., an untranslated region of an mRNA that is important for translation in the host cell. The leader sequence may be operably linked to the 5' end of the nucleic acid sequence encoding the protein. Any leader sequence that is functional in the selected host cell may be used in the present invention. A regulatory sequence may also be a signal peptide coding region, which encodes an amino acid sequence attached to the amino terminus of the protein that directs the encoded protein into the cell's secretory pathway. Any signal peptide coding region that directs the expressed protein into the secretory pathway of the selected host cell may be used in the present invention. It may also be desirable to add regulatory sequences that can regulate protein expression based on the growth conditions of the host cells. Examples of regulatory sequences are those that can turn gene expression on or off in response to chemical or physical stimuli (including in the presence of regulatory compounds). Other examples of regulatory sequences are those that enable gene amplification. In these instances, the protein-encoding nucleic acid sequence should be operably linked to the regulatory sequences.

[0023] Existing plant expression vectors can be used to construct a recombinant expression vector containing the protein encoding gene expression cassette.

[0024] When preparing an expression vector, a nucleic acid molecule encoding any of the above-mentioned proteins can be located in the vector so as to be operably linked to an appropriate expression control sequence. The recombinant expression vector can be any vector (e.g., a plasmid or virus) that is convenient for recombinant DNA manipulation and expression of the nucleic acid sequence. The choice of vector generally depends on the compatibility of the vector with the host cell into which it is to be introduced. The vector can be a linear or closed-loop plasmid. The vector can be an autonomously replicating vector (i.e., a complete structure present outside the chromosome that can replicate independently of the chromosome), such as a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector can contain any mechanism that ensures self-replication. Alternatively, the vector is one that, when introduced into the host cell, will be integrated into the genome and replicated together with the chromosome into which it is integrated. In addition, a single vector or plasmid can be used, or two or more vectors or plasmids, or transposons, that collectively contain the entire DNA that will be introduced into the host cell genome can be used. The vector contains one or more selectable markers that facilitate the selection of transformed cells. A selectable marker is a gene whose product confers resistance to biocides or viruses, resistance to heavy metals, or confers prototrophy to auxotrophs, etc. Examples of bacterial selectable markers include the dal genes of Bacillus subtilis or Bacillus licheniformis, or resistance markers for antibiotics such as ampicillin, kanamycin, chloramphenicol, or tetracycline. Vectors contain elements that enable stable integration of the vector into the host cell genome or autonomous replication of the vector within the cell, independent of the cellular genome. In the case of autonomous replication, the vector may also contain an origin of replication, enabling the vector to replicate autonomously in the target host cell. The origin of replication may contain a mutation that renders the vector temperature-sensitive in the host cell. More than one copy of a nucleic acid molecule encoding any of the above-described proteins of the present invention may be inserted into the host cell to increase the yield of the gene product. The copy number of the nucleic acid molecule can be increased by inserting at least one additional copy of the nucleic acid molecule into the host cell genome, or by inserting an amplifiable selectable marker along with the nucleic acid molecule. Cells containing amplified copies of the selectable marker gene, and thus the additional copies of the nucleic acid molecule, can be selected by culturing the cells in the presence of a suitable selective agent. The operations for ligating the above-mentioned elements to construct the recombinant expression vector of the present invention are well known to those skilled in the art (see, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989).

[0025] The term "operably linked" is defined herein as a configuration in which a regulatory sequence is appropriately positioned relative to the coding sequence of a DNA sequence such that the regulatory sequence directs the expression of a protein.

[0026] In the above-mentioned biological materials, the recombinant microorganism can specifically be yeast, bacteria, algae or fungi.

[0027] In a second aspect, the present invention provides use of a substance that inhibits the activity of the OsADF1 protein in the first aspect or a substance that inhibits the expression of the nucleic acid encoding the OsADF1 protein in the first aspect in any of the following D1)-D2); D1) Improve plant salt tolerance; D2) Cultivate salt-tolerant plants.

[0028] In the applications described above, the inhibition of nucleic acid molecule expression can be achieved by gene knockout or gene silencing.

[0029] Gene knockout refers to the inactivation of a specific target gene through homologous recombination. Gene knockout is the inactivation of a specific target gene through changes in the DNA sequence.

[0030] Gene silencing refers to the phenomenon of suppressing or under-expressing a gene without damaging the original DNA. Gene silencing, predicated on not altering the DNA sequence, results in suppressing or under-expressing the gene. Gene silencing can occur at two levels: transcriptional gene silencing due to factors such as DNA methylation, heterochromatinization, and position effects; and post-transcriptional gene silencing, which inactivates the gene after transcription through specific inhibition of target RNA. This includes antisense RNA, co-suppression, gene quelling, RNA interference (RNAi), and microRNA (miRNA)-mediated translational inhibition.

[0031] In the applications described above, the substance that inhibits the biological function (activity) of the protein described in the first aspect or the substance that inhibits the expression of the nucleic acid molecule can be an agent that inhibits or reduces the expression of the nucleic acid molecule. The agent that inhibits or reduces the expression of the nucleic acid molecule can include, for example, an agent that knocks out the gene via homologous recombination or an agent that knocks out the gene via CRISPR / Cas9. The agent that inhibits or reduces the expression of the nucleic acid molecule can include a polynucleotide that targets the gene, such as siRNA, shRNA, sgRNA, miRNA, or antisense RNA.

[0032] Furthermore, the substance that inhibits the biological function (activity) of the protein described in the first aspect or the substance that inhibits the expression of the nucleic acid molecule is specifically a sgRNA or a vector expressing the same. Furthermore, the sgRNA targets positions 145-167 from the 5' end of SEQ ID No: 2, and the vector expressing the sgRNA is pCAMBIA1305.1-OsADF1.

[0033] In a third aspect, the present invention provides a method for improving plant salt tolerance, comprising the steps of reducing the content or activity of the protein OsADF1 in the first aspect in a recipient plant, thereby improving plant salt tolerance.

[0034] In a fourth aspect, the present invention provides a method for improving plant salt tolerance, comprising the steps of reducing the expression of the nucleic acid molecule encoding the protein OsADF1 described in the first aspect in a recipient plant, thereby improving plant salt tolerance.

[0035] In a fifth aspect, the present invention provides a method for improving plant salt tolerance, comprising the following steps: performing gene editing on the nucleic acid molecule encoding the protein OsADF1 described in the first aspect in a recipient plant to terminate its translation prematurely, thereby improving plant salt tolerance.

[0036] In a sixth aspect, the present invention provides a method for cultivating salt-tolerant plants, comprising the steps of reducing the content or activity of the protein OsADF1 described in the first aspect in a recipient plant to obtain a transgenic plant, namely, the target plant.

[0037] In a seventh aspect, the present invention provides a method for cultivating salt-tolerant plants, comprising the steps of reducing the expression of the nucleic acid molecule encoding the protein OsADF1 described in the first aspect in a recipient plant to obtain a transgenic plant, namely, the target plant.

[0038] In an eighth aspect, the present invention provides a method for cultivating salt-tolerant plants, comprising the following steps: performing gene editing on the nucleic acid molecule encoding the protein OsADF1 described in the first aspect in the recipient plant to terminate its translation prematurely, thereby obtaining a transgenic plant, namely the target plant.

[0039] In the above, the recipient plant contains a nucleic acid molecule encoding the protein OsADF1.

[0040] In the above, the plant is as follows: N1) or N2) or N3): N1) Monocots or dicots; N2) Grasses; N3) Rice.

[0041] The rice may be japonica rice, more specifically japonica rice Kitaake.

[0042] The experiments of the present invention have shown that OsADF1 protein and its coding gene regulate plant salt stress response, and knocking out OsADF1 Compared with the wild-type Kitaake, the knockout strains obtained by the gene showed significant salt tolerance, thus proving that the OsADF1 protein and its encoding gene negatively regulate plant salt tolerance or salt stress response. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 This is the sequence map of the gene editing vector pCAMBIA1305.1.

[0044] Figure 2 Identification of OsADF1 knockout.

[0045] Figure 3 Wild-type Kitaake and Osadf1 Performance of knockout lines. DETAILED DESCRIPTION

[0046] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0047] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0048] Unless otherwise specified, the quantitative tests in the following examples were performed three times, and the results were averaged.

[0049] Vector pCAMBIA1305.1 (eg Figure 1 ) is described in the following literature: Jun Zhang, Mian Gu1, Ruisuhua Liang, Xinyu Shi, Lingling Chen, Xu Hu, Shichao Wang, Xiaoli Dai, Hongye Qu1, Huanhuan Li and Guohua Xu. OsWRKY21 and OsWRKY108 function redundantly to promote phosphate accumulation by maintaining the constitutive expression of OsPHT1;1 under phosphate-replete conditions. New Phytologist 2021, 229: 1598–1614. The vector pCAMBIA1305.1 contains the pH-Ubi-cas9-7 expression system and the pOs-sgRNA scaffold for inserting the target sequence.

[0050] OsADF1 The cDNA nucleotide sequence of the gene is shown in SEQ ID NO: 1, and the genomic nucleotide sequence is shown in SEQ ID NO: 2; OsADF1 The protein encoded by the gene is named OsADF1, and the amino acid sequence of the protein is SEQ ID NO: 3.

[0051] Example 1 OsADF1 Application of genes in regulating plant salt tolerance one, OsADF1 Acquisition of knockout strains In this study, we first designed a target for rice ADF family members in japonica rice variety Kitaake by using CRIPSR-Cas9 (knockout vector using pCAMBIA1305.1 vector from our laboratory) OsADF1 Gene editing was performed (target sequence: CCGGGTGAGAGCTATGACGACTT, i.e., positions 145-167 from the 5' end of SEQ ID No: 2).

[0052] 1. Obtaining the recombinant plasmid pCAMBIA1305.1-OsADF1 1) Design and synthesize the following primers according to the target Target1: primer OsADF1-CAS9-1-F: 5′AGATGATCCGTGAATTCggtgagagctatgacgacttCCCGGGAGAGCTATGC-3′ and primer OsADF1-CAS9-1-R: 5′GCATAGCTCTCCCGGGaagtcgtcatagctctcaccGAATTCACGGATCATCT-3′; 2. Dilute the primers OsADF1-CAS9-1-F / OsADF1-CAS9-1-R and anneal them to obtain a double-stranded DNA fragment gRNA with vector homology arms.

[0053] 3. Take the vector pCAMBIA1305.1, digest it with restriction endonucleases EcoR I and Sma I, and recover the vector backbone.

[0054] 4. The vector backbone recovered in step 3 and the double-stranded DNA fragment gRNA with vector homology arms obtained in step 2 were ligated to obtain the recombinant plasmid pCAMBIA1305.1-OsADF1-gRNA.

[0055] The recombinant plasmid pCAMBIA1305.1-OsADF1-gRNA was sequenced. The sequencing results showed that the recombinant plasmid pCAMBIA1305.1-OsADF1-gRNA was obtained by inserting the double-stranded DNA fragment gRNA molecule with vector homology arms obtained in step 2 into the recognition sites of the restriction endonucleases EcoR I and Sma I in the vector pCAMBIA1305.1.

[0056] 2. Obtaining CRISPR-OsADF1 mutants 1. The recombinant plasmid pCAMBIA1305.1-OsADF1-gRNA was transferred to Agrobacterium tumefaciens EHA105 by liquid nitrogen freezing to obtain recombinant Agrobacterium.

[0057] 2. The recombinant Agrobacterium was transformed into the callus tissue induced by Kitaake seeds of japonica rice (recorded in the following literature: Guotian Li. et al. The Sequences of 1504 Mutants in the Model Rice Variety Kitaake Facilitate Rapid Functional Genomic Studies. Plant cell. 29(6):1218-1231 (2017)). After screening, differentiation and rooting, T0 generation pseudo-transgenic rice was obtained. The specific method is referred to the following literature: Jia HF, Ren HY, Gu M, Zhao JN, Sun SB, Zhang X, Chen JY, Wu P, Xu GH, Phosphate transporter gene, OsPht1;8, is involved in phosphate homeostasis in rice, Plant Physiology, 156: 1164–1175. He, Y., Cai, Z., Lin, Y., and Chen, H. (2018). Rapid transformation of rice mediated by Agrobacterium tumefaciens. Bio-101:e1010176. DOI:10.21769 / BioProtoc.1010176. 3. The total DNA extracted from the leaves of each T0 generation transgenic rice was used as a template for PCR amplification. The specific method is as follows: (1) Take about 0.2 g of rice leaves, place them in a 2.0 mL test tube containing steel balls, and freeze them in liquid nitrogen for 5 minutes. Place them on a sample grinder and crush the sample; (2) Add 600 μL of CTAB extraction solution and incubate in a water bath at 65°C for 30 minutes; (3) Add 900 μL of chloroform, mix thoroughly, and centrifuge at 12,000 rpm for 3 minutes; (4) Transfer all the supernatant to a 1.5 mL test tube, add 600 μL of isopropanol, mix well, and centrifuge at 12,000 rpm for 5 minutes; 5. Discard the supernatant, rinse the precipitate once with 70% ethanol, and dry it at room temperature; 6. Add 100 μL of pure water to dissolve the DNA; 7. Take 2 μL of total DNA, check the DNA quality by electrophoresis, and determine the concentration using a spectrophotometer.

[0058] (5) Dilute the extracted DNA to approximately 50 ng / μL and use it as a template for PCR amplification; The PCR reaction system for PCR amplification (10 μL) was as follows: DNA (20 ng / μL) 1 μL, OsADF1-criF primer (2 pmol / μL) 1 μL, OsADF1-criR primer (2 pmol / μL) 1 μL, 10× Buffer (MgCl2-free) 1 μL, dNTP (10 mM) 0.2 μL, MgCl2 (25 mM) 0.6 μL, Taq (5 u / μL) 0.1 μL, and ddH2O 5.1 μL, for a total of 10 μL reaction system.

[0059] PCR reaction program: denaturation at 95.0°C for 5 minutes; denaturation at 95.0°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 1 minute, for a total of 33 cycles; extension at 72°C for 5 minutes; storage at 10°C.

[0060] Primer OsADF1-criF: 5′-CATCAACCATGGTGAGTGCAGT-3′ Primer OsADF1-criR: 5′-GACAAAAGTGCAGTTAACCCATCCT-3′ The PCR amplification products were subjected to Sanger sequencing, and the sequencing results were consistent with OsADF1 The target sequences of the gene (shown in SEQ ID No: 2) were aligned and the mutation types were counted.

[0061] Two T0 generation heterozygous mutants were obtained from T0 transgenic rice transformed with pCAMBIA1305.1-OsADF1-gRNA. Osadf1 #1 and Osadf1 #2.

[0062] T0 generation heterozygous mutant strains Osadf1 The sequencing results of #1 are as follows Figure 2 As shown, the genome of wild-type japonica rice Kitaake OsADF1Compared with gene (SEQ ID No: 2), Osadf1 The region corresponding to the OsADF1 gene on only one homologous chromosome in the #1 genome underwent the following changes: 10 bases were deleted from positions 147 to 156 of SEQ ID No: 2 from the 5' end, causing a frameshift and leading to premature termination of protein translation; the region corresponding to the OsADF1 gene on the other homologous chromosome was altered. OsADF1 The region corresponding to the gene is the same as that of wild-type japonica rice Kitaake.

[0063] T0 generation heterozygous mutant strains Osadf1 The sequencing results of #2 are as follows Figure 2 As shown, the genome of wild-type japonica rice Kitaake OsADF1 Compared with genes, Osadf1 #2 On the same chromosome in the genome OsADF1 The region corresponding to the gene has undergone the following changes: a T is inserted from position 150 to 151 from the 5' end of SEQ ID No: 2, causing a frameshift and leading to premature termination of protein translation; OsADF The region corresponding to the 1 gene is the same as that of wild-type japonica rice Kitaake.

[0064] 4. The T0 generation heterozygous mutant strains obtained in step 3 are self-pollinated to obtain seeds that are T1 generation seeds, and the plants grown from the T1 generation seeds are T1 generation plants; the T1 generation plants are self-pollinated to obtain seeds that are T2 generation seeds, and the plants grown from the T2 generation seeds are T2 generation plants.

[0065] 5. Using the genomic DNA of T2 plant leaves as templates, PCR amplification was performed using the primer pair consisting of primers OsADF1-criF: 5'CATCAACCATGGTGAGTGCAGT-3' and primer OsADF1-criR: 5'-GACAAAAGTGCAGTTAACCCATCCT-3' to obtain the corresponding PCR amplification products. The PCR amplification products were subjected to Sanger sequencing. The sequencing results were consistent with those of the OsADF1 The Cas9 target sequence of the gene (shown in SEQ ID No: 2) was aligned and the mutation types were counted.

[0066] Two homozygous mutant strains were obtained and named as T2 generation homozygous mutant strains Osadf1 #1 and T2 generation homozygous mutant strains Osadf1 #2.

[0067] T2 generation homozygous mutant strains Osadf1 The sequencing results of #1 showed that the OsADF1 Compared with genes, Osadf1 #1 On two homologous chromosomes on the genome OsADF1 The corresponding regions of the genes all underwent the following changes: SEQ ID No: 2 deleted 10 bases from position 147 to 156 from the 5' end, causing a frameshift and leading to premature termination of protein translation, resulting in loss of function of the protein OsADF1.

[0068] T2 generation homozygous mutant strains Osadf1 The sequencing results of #2 showed that the OsADF1 Compared with genes, Osadf1 #2 On two homologous chromosomes on the genome OsADF1 The following changes occurred in the corresponding regions of the genes: a T was inserted from position 150 to 151 from the 5' end of SEQ ID No: 2, which caused a frameshift and premature termination of protein translation, resulting in the loss of function of the protein OsADF1.

[0069] 6. The homozygous mutant obtained in step 5 is self-pollinated to obtain seeds that are T3 generation seeds, and the plants grown from T3 generation seeds are T3 generation homozygous mutants. Osadf1 #1 and T3 generation homozygous mutants Osadf1 #2.

[0070] three, OsADF1 Application of genes in plant salt tolerance OsADF1 knockout rice lines were T3 generation homozygous mutants Osadf1 #1 (or Osadf1- #1) and T3 generation homozygous mutants Osadf1 #2 (or Osadf1- #2).

[0071] Kitaake and OsADF1 knockout rice seeds (Kitaake as a control) were soaked in deionized water at 37°C and germinated in the dark for three days. White rice seeds were planted in rice nutrient solution (Cat: NSP1040-250 g, COOLABER SCIENCE & TECHNOLOGY) in one liter per hydroponic box. The incubator was set at 25°C for 8 hours at night and 30°C for 16 hours during the day. After approximately 14 days of growth (three-leaf stage), the nutrient solution was replaced with a rice nutrient solution containing 180 mM NaCl (salt-stress nutrient solution, prepared by adding NaCl to Yoshida rice nutrient solution, resulting in a NaCl concentration of 180 mM) in one liter per hydroponic box. After approximately 72 hours of growth, the salt-stress nutrient solution was replaced with normal rice nutrient solution. Phenotypes were observed after approximately 8 days of recovery.

[0072] Screening criteria: Observe the survival and growth changes of rice. The results are as follows Figure 3As shown, A is the status of rice seedlings of each line after 14 days of normal growth before salt stress treatment, and B is the status of rice seedlings of each line after 8 days of recovery growth in normal rice nutrient solution after salt stress treatment. Under the condition of 180 mM NaCl treatment, OsADF1 knockout rice line (T3 generation homozygous mutant) Osadf1 #1 and T3 generation homozygous mutants Osadf1 #2) Shows a phenotype that is more tolerant to salt stress than wild-type Kitaake.

[0073] Statistical survival rate Figure 3 As shown in C, it can be seen that under the condition of 180 mM Nacl treatment, the OsADF1 knockout mutant showed a higher survival rate than the wild-type Kitaake (WT).

[0074] The above results indicate that knocking out OsADF1 can improve plant salt tolerance.

[0075] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

Claims

1. Application of protein OsADF1 or its related biomaterials in regulating plant salt tolerance: The protein OsADF1 is the following A1) or A2) or A3): A1) a protein comprising the amino acid residues shown in SEQ ID No. 3; A2) A plant-derived protein having the same biological function as the protein of A1) obtained by substitution and / or deletion and / or addition of one or more amino acid residues; A3) A protein that has 80% or more identity with the amino acid sequence defined in A1) and is derived from a plant and has the same biological function; A4) A fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of any of the proteins shown in A1) to A3).

2. The use according to claim 1, characterized in that: The protein OsADF1-related biological material is any one of B1) to B7): B1) a nucleic acid molecule encoding the protein OsADF1; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5) a transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2); B6) transgenic plant tissue containing the nucleic acid molecule described in B1), or transgenic plant tissue containing the expression cassette described in B2); B7) A transgenic plant organ containing the nucleic acid molecule described in B1) or a transgenic plant organ containing the expression cassette described in B2).

3. The use according to claim 2, characterized in that: The nucleic acid molecule encoding the protein OsADF1 is a DNA molecule shown in any one of C1) to C4): C1) The coding region includes a DNA molecule shown in SEQ ID NO: 1 or SEQ ID NO: 2; C2) a DNA molecule whose nucleotide sequence includes SEQ ID NO: 1 or SEQ ID NO: 2; C3) a DNA molecule having 75% or more identity with the nucleotide sequence defined in C1) or C2), derived from a plant and encoding the protein OsADF1 of claim 1; C4) A DNA molecule that hybridizes under stringent conditions with the nucleotide sequence defined in C1) or C2) and encodes the protein OsADF1 according to claim 1 and is derived from a plant.

4. Use of a substance that inhibits the activity of the OsADF1 protein of claim 1 or a substance that inhibits the expression of the nucleic acid encoding the OsADF1 protein of claim 1 in any of the following D1) to D2); D1) Improve plant salt tolerance; D2) Cultivate salt-tolerant plants.

5. A method for improving plant salt tolerance, comprising the steps of: reducing the content or activity of the protein OsADF1 according to claim 1 in a recipient plant, thereby improving the plant salt tolerance.

6. A method for improving plant salt tolerance, comprising the steps of: reducing the expression of the nucleic acid molecule encoding the protein OsADF1 according to claim 2 in a recipient plant, thereby improving the plant salt tolerance.

7. A method for improving plant salt tolerance, comprising the following steps: gene editing the nucleic acid molecule encoding the protein OsADF1 as claimed in claim 2 in a recipient plant to terminate its translation early, thereby improving the plant salt tolerance.

8. A method for cultivating salt-tolerant plants, comprising the steps of: reducing the content or activity of the protein OsADF1 according to claim 1 in a recipient plant to obtain a transgenic plant, namely the target plant.

9. A method for cultivating salt-tolerant plants, comprising the steps of: reducing the expression of the nucleic acid molecule encoding the protein OsADF1 according to claim 2 in a recipient plant to obtain a transgenic plant, namely the target plant.

10. A method for cultivating salt-tolerant plants, comprising the following steps: editing the nucleic acid molecule encoding the protein OsADF1 according to claim 2 in a recipient plant to terminate its translation prematurely, thereby obtaining a transgenic plant, namely, the target plant.

Images