Attenuated Pasteurella multocida and its construction method and application

Abstract

The present invention belongs to the field of genetic engineering technology and specifically relates to an attenuated Pasteurella multocida strain, a method for its construction, and applications. The attenuated Pasteurella multocida strain lacks the arcA and gatA genes of Pasteurella multocida. The arcA gene of Pasteurella multocida is numbered A0R64_00400. The arcA and gatA double-gene mutant strain constructed by the present invention is highly attenuated in ducks and has a certain level of in vivo colonization, demonstrating its potential as an attenuated live vaccine. Oral immunization with this mutant strain does not affect the production performance of ducks and can provide immune protection against a lethal dose of Pasteurella multocida. The present invention provides a new strategy for developing a live attenuated vaccine against Pasteurella multocida or other bacteria.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and particularly relates to attenuated Pasteurella multocida and a construction method and application thereof. Background Art

[0002] Pasteurella multocida is a major livestock and poultry pathogen belonging to the family Pasteurellaceae, genus Pasteurella, subspecies multocida. It has a wide host spectrum and can cause contact infections in a variety of animals, including ducks, chickens, cattle, and pigs. In poultry, it manifests as fowl cholera. Its lipopolysaccharide (LPS) outer core oligosaccharide gene cluster is divided into eight LPS types (L1-L8), with the L1 type being the most common cause of fowl cholera. Fowl cholera is characterized by high morbidity and mortality in poultry such as chickens, ducks, and geese, causing significant economic losses to my country's poultry industry. For a long time, treatment for fowl cholera in my country has primarily relied on antibiotics. However, with the increasing severity of antibiotic resistance and residual antibiotics, the development of a safe and effective fowl cholera vaccine has become an urgent need for disease prevention and control. Currently, commercial vaccines for the disease are primarily inactivated oil-emulsion vaccines, but these suffer from drawbacks such as high immunization doses, significant side effects, and weak cross-protection. Genetically engineered live attenuated vaccines have the advantages of clear genetic background, oral or nasal administration, induction of balanced immune responses, and strong cross-protection, making them an ideal form of vaccine.

[0003] Screening for appropriate virulence genes is a prerequisite for constructing genetically engineered live attenuated vaccines. After invading the body, bacteria encounter a variety of extreme environments, such as oxidative stress, iron deficiency, hypoxia, and low acidity. Adapting to these changes is crucial for bacterial survival. Studies have found that regulatory factors associated with bacterial adaptation to extreme environments are often closely linked to bacterial virulence. Studies on Gram-negative bacteria, such as Escherichia coli and Haemophilus influenzae, have demonstrated that the global regulatory factor ArcA (Aerobic respiratory control) plays an important role in the adaptation of various bacteria to aerobic and anaerobic environments and their transitions, and in some bacteria, it has a certain impact on virulence. However, this gene and its function remain unknown in Pasteurella multocida. Summary of the Invention

[0004] The purpose of the present invention is to overcome the deficiencies of the prior art and provide an attenuated Pasteurella multocida and a construction method and application thereof.

[0005] The object of the present invention is achieved by the following technical solution: an attenuated Pasteurella multocida, wherein the attenuated Pasteurella multocida lacks the arcA gene and gatA gene of Pasteurella multocida, the gene number of the arcA gene of Pasteurella multocida is A0R64_00400, and the sequence of A0R64_00400 is as follows:

[0006] ATGGGAACGCCACAAATTTTAATTGTTGAAGACGAAGCAATCACCAGAAATACCTT

[0007] AAAAAGTATTTTTGAGGCGGAGGGTTATGAAGTATTTGAGGCGGCAGACGGCGCACAGA

[0008] TGCACCGTATTCTGTCTAATAAAGTGATTAATCTTGTCATTTATGGATATCAACTTACCCGGT

[0009] AAGAATGGACTCATGCTCGCCCGCGAACTACGAGAAACGACCAATACCGCCATTAATGTT

[0010] TTTAACTGGTCGCGATAATGAAGTGGATAAAATTCTTGGTCTAGAAATCGGTGCGGATGA

[0011] TTACATCACAAAACCATTCAATCCAAGAGAATTAACCATTCGTGCACGAAATTTTATTACA

[0012] ACGCACGATGCAAGAAAATAGTAAAGATAGCCATCATCCTATTGAGCAATATCGCTTTAA

[0013] TGGCTGGACACTAGACTTAAATAGCCGCACGTTAATTAATCCAGAAGGGGAAGAATATA

[0014] AACTTCCACGCAGTGAATTCCGTGCGATGTTACATTTCTGTGAAAACCCGGGCAAAATT

[0015] CAAACCCGTGAAGAATTATTGAAGAAAATGACGGGACGTGAATTAAAGCCACAAGATC

[0016] GGACAGTAGATGTCACTATTCGTCGTATTCGTAAACATTTTGAAGATCATCCAGAAACCC

[0017] CAGAGATTATCGCCACGATCCATGGTGAAGGTTATCGTTTCTGTGGTGAATTAGAATAA

[0018] Deleting two or more virulence genes can significantly reduce the chance of mutant strains reverting to virulence, ensuring the safety of the vaccine strain and providing an effective strategy for constructing genetically engineered live attenuated vaccines. Previous studies have confirmed that the L1 type of Pasteurella multocida LPS outer core oligosaccharide is a virulence factor of Pasteurella multocida, and that deleting the glycosyltransferases hptE or gatA involved in its synthesis can reduce the virulence of the bacterium in chickens. However, because these mutant strains were constructed via single crossover insertion, they reverted to wild-type revertants in vivo. The present invention constructed a stable gatA mutant strain via suicide plasmid-mediated homologous recombination and demonstrated its high attenuation in ducks.

[0019] The present invention constructed an arcA and gatA double gene mutant (ΔgatAΔarcA) on the wild-type Pasteurella multocida strain PM0818, tested its virulence and immune protection potential in ducks, and confirmed that the mutant strain has high safety and provides good immune protection efficacy against virulent Pasteurella multocida strains.

[0020] Furthermore, the construction method includes: constructing a Pasteurella multocida lacking the arcA gene and gatA gene of Pasteurella multocida by suicide plasmid-mediated homologous recombination.

[0021] Furthermore, the homologous recombination method comprises the following steps:

[0022] S1, construct suicide plasmids with arcA gene and gatA gene deleted respectively;

[0023] S2, transferring the suicide plasmid constructed in step S1 into competent Escherichia coli, performing conjugation transfer with Pasteurella multocida, and screening positive colonies;

[0024] S3, obtaining Pasteurella multocida lacking the arcA gene and gatA gene of Pasteurella multocida by PCR screening. Further, in step S1, the method for constructing suicide plasmids lacking the arcA gene and gatA gene respectively comprises:

[0025] 1) Based on the sequence information of Pasteurella multocida and the plasmid, primers were designed to amplify the upstream and downstream homology arms of the arcA gene, the upstream and downstream homology arms of the gatA gene, and the kanamycin and erythromycin resistance gene fragments between the homology arms. The resistance gene fragments and the upstream and downstream homology arms fragments each have a 15±2 bp repeat sequence;

[0026] 2) Using the whole genome of Pasteurella multocida as a template, the arcA gene and the upstream and downstream homology arms of the gatA gene were amplified, and using the plasmid as a template, the kanamycin and erythromycin resistance genes were amplified;

[0027] 3) performing PCR amplification on the product obtained by step 2) using primers and a high-fidelity enzyme to obtain a fusion fragment;

[0028] 4) After the plasmid is digested with enzymes, it is ligated with the fusion fragment and transformed into competent E. coli cells. PCR identification is performed to obtain a suicide plasmid with positive deletions of the arcA gene and the gatA gene.

[0029] Furthermore, the primers involved in the homologous recombination method are shown in SEQ ID NO: 14 to SEQ ID NO: 35.

[0030] The present invention screened for arcA gene homologs from Pasteurella multocida using the blast method, finding that their coding sequence shared high homology with ArcA from other bacteria. Subsequently, an arcA gene-deficient strain of Pasteurella multocida L1 was constructed using suicide plasmid-mediated homologous recombination. This deletion strain was confirmed to be highly attenuated in a duck model, demonstrating that arcA is a virulence gene of Pasteurella multocida.

[0031] The present invention also provides an application of the arcA gene for attenuating Pasteurella multocida.

[0032] Furthermore, the application method includes: constructing a Pasteurella multocida lacking the arcA gene by suicide plasmid-mediated homologous recombination.

[0033] Furthermore, the application method specifically includes:

[0034] S1, construction of a suicide plasmid lacking the arcA gene;

[0035] S2, transferring the suicide plasmid constructed in step S1 into competent Escherichia coli, performing conjugation transfer with Pasteurella multocida, and screening positive colonies;

[0036] S3. Pasteurella multocida lacking the arcA gene was obtained by PCR screening.

[0037] Furthermore, in step S1, the method for constructing a suicide plasmid lacking the arcA gene includes:

[0038] 1) Based on the sequence information of Pasteurella multocida and the plasmid, primers were designed to amplify the upstream and downstream homology arms of arcA, as well as the kanamycin resistance gene fragment between the homology arms. The resistance gene fragment and the upstream and downstream homology arms of the arcA gene have a 15±2 bp repetitive sequence, respectively;

[0039] 2) The arcA upstream and downstream homology arms were amplified using the complete genome of Pasteurella multocida as a template, and the kanamycin resistance gene was amplified using a plasmid as a template;

[0040] 3) performing PCR amplification on the product obtained by step 2) using primers and a high-fidelity enzyme to obtain a fusion fragment;

[0041] 4) After the plasmid is digested with enzymes, it is ligated with the fusion fragment and transformed into competent E. coli cells. PCR identification is performed to obtain a suicide plasmid with a positive deletion of the arcA gene.

[0042] Furthermore, the primers involved in the suicide plasmid-mediated homologous recombination method are shown in SEQ ID NO: 2 to SEQ ID NO: 13.

[0043] The present invention also provides the Pasteurella multocida lacking the arcA gene or the Pasteurella multocida lacking both the arcA gene and the gatA gene.

[0044] The present invention also provides a use of the above-mentioned Pasteurella multocida lacking the arcA gene or the above-mentioned Pasteurella multocida lacking the arcA gene and gatA gene as a live attenuated vaccine for poultry.

[0045] The principle involved in this invention is that screening for appropriate virulence genes and constructing stable gene-deficient strains of Pasteurella multocida are key to developing a genetically engineered live attenuated vaccine. Based on existing advanced gene mutation technology, the present invention, using the wild-type duck-derived Pasteurella multocida strain PM0818 as its foundation and suicide plasmid-mediated homologous recombination as its technical foundation, first constructs homology arm fragments carrying resistance genes. These fusion fragments are then ligated to the suicide plasmid pRE112. The recombinant plasmid is then introduced into Pasteurella multocida via conjugative transfer. Homologous recombination of the fragments is then used to replace the missing gene with the resistance gene, thereby constructing a gene-deficient vaccine strain. This invention screened for the first time the arcA gene of Pasteurella multocida and confirmed its identity as a virulence gene by constructing a mutant strain. To ensure the safety of the mutant strain as an attenuated vaccine strain, the present invention also deleted the LPS outer core oligosaccharide glycosyltransferase gene, gatA, completing the construction of the double-gene mutant strain ΔgatAΔarcA. Immunoprotection tests in ducks confirmed that the Pasteurella multocida gene-deficient strain, ΔgatAΔarcA, is highly safe and can be used to prevent infection with Pasteurella multocida in ducks. This invention provides a new strategy for developing live attenuated vaccines against Pasteurella multocida and other bacteria, and lays a theoretical foundation for the further development of live attenuated vaccines based on regulatory factors and lipopolysaccharides.

[0046] The beneficial effects of the present invention are:

[0047] 1. The arcA and gatA double-gene mutant strain constructed in this invention is highly attenuated in ducks and has a certain level of in vivo colonization, demonstrating its potential as a live attenuated vaccine. Oral immunization with this mutant strain does not affect duck production performance and provides immune protection against a lethal dose of Pasteurella multocida. This invention provides a new strategy for developing live attenuated vaccines against Pasteurella multocida and other bacteria.

[0048] 2. This study screened and identified a homolog of the arcA gene of Pasteurella multocida for the first time. The coding sequence was found to have high homology with ArcA from other bacteria. A strain was constructed using suicide plasmid-mediated homologous recombination, and the deletion strain was confirmed to be highly attenuated in a duck model, confirming that A0R64_00400 is the arcA gene of Pasteurella multocida. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 amino acid sequence alignment of ArcA homologs from Pasteurella multocida and other bacteria;

[0050] Figure 2 Lane 1 is the amplification product of the arcA gene upstream homology arm; Lane 2 is the amplification product of the resistance gene; Lane 3 is the amplification product of the arcA gene downstream homology arm;

[0051] Figure 3 is the fusion of fragments; lane M is DL4500 DNA marker, lane 1 is the fusion fragment;

[0052] Figure 4 Identification of arcA gene deletion strains; Lane M is DL15000 marker, Lanes 1 and 2 are amplifications of the kanamycin resistance gene, Lanes 3 and 4 are amplifications of the arcA gene, Lanes 5 and 6 are amplifications of the upstream homology arm of the arcA gene and part of the kanamycin resistance gene, and Lanes 7 and 8 are amplifications of the downstream homology arm of the arcA gene and part of the kanamycin resistance gene;

[0053] Figure 5 Lane 1 is the amplification product of the upstream homology arm of the gatA gene, lane 2 is the amplification product of the downstream homology arm of the gatA gene, and lane 3 is the amplification product of the kanamycin resistance gene.

[0054] Figure 6 is the fusion of fragments; lane M is DL4500 DNA marker, lane 1 is the fusion fragment;

[0055] Figure 7PCR identification of Pasteurella multocida ΔgatAΔarcA mutants and complemented strains; Lane M is a DL2000 DNA marker, Lanes 1, 2, 3, and 4 are amplified products of the gatA gene; Lanes 5 and 6 are amplified products of the arcA gene; Lanes 7, 8, and 9 are amplified products of the upstream homologous arm of the gatA gene and part of the kanamycin resistance gene; Lanes 10, 11, and 12 are amplified products of the downstream homologous arm of the gatA gene and part of the kanamycin resistance gene; Lanes 13 and 14 are amplified products of the upstream homologous arm of the arcA gene and part of the erythromycin resistance gene; Lanes 15 and 16 are amplified products of the downstream homologous arm of the arcA gene and part of the erythromycin resistance gene; Lanes 17 and 18 are amplified products of the kanamycin resistance gene; Lanes 19 and 20 are amplified products of the erythromycin resistance gene;

[0056] Figure 8 To monitor the duck's body temperature;

[0057] Figure 9 To monitor the weight of ducks;

[0058] Figure 10 To evaluate the immune protection and detect the bacterial clearance effect of the ΔgatAΔarcA vaccine strain. DETAILED DESCRIPTION

[0059] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings, but the protection scope of the present invention is not limited to the following.

[0060] Example 1 Screening and homology analysis of the arcA gene of Pasteurella multocida

[0061] The arcA gene sequences of known Escherichia coli (E. coli MG1655), Salmonella Typhimurium UK-1, and Haemophilus influenzae (H. influenzae 65290_NP_Hi3) were aligned with the genome of Pasteurella multocida strain PM0818 (P. multocida strain DY120818, genome accession number LUCZ01000000) using the Blast tool on the NCBI website, and a highly homologous gene A0R64_00400 with a full length of 711 bp was screened. Its coding sequence shares 88%, 88%, and 79.24% similarity with the ArcA protein sequences in E. coli MG1655 (gene ID: D8B36_RS19230), Salmonella Typhimurium UK-1 (gene ID: STMUK_4585), and H. influenzae 65290_NP_Hi3 (gene ID: FA898_RS00885), respectively. Therefore, A0R64_00400 is the arcA gene of Pasteurella multocida.

[0062] Example 2 Construction of Pasteurella multocida arcA deletion strain

[0063] 2.1 Primer design

[0064] Based on the NCBI-published PM0818 (P. multocida strain DY120818, genome accession number LUCZ01000000) genomic sequence and plasmid pCZ4 sequence, two primer pairs, arcA-up-F / R and arcA-down-F / R, were designed to amplify the upstream and downstream homology arms of arcA, respectively. ArcA-kan-F / R was also used to amplify the kanamycin resistance gene fragment between the homology arms. The resistance gene fragment shares approximately 15 bp of repeating sequence with the upstream and downstream homology arms of the arcA gene, respectively. All primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The specific primer names and sequences are shown in Table 1 below.

[0065] Table 1 Primers for constructing ΔarcA mutants

[0066]

[0067]

[0068] 2.2 Amplification and fusion of upstream and downstream homology arms of the arcA gene and the kanamycin resistance gene

[0069] The arcA upstream and downstream homology arms were amplified using the PM0818 whole genome as a template, and the kanamycin resistance gene was amplified using the plasmid pCZ4 as a template. Amplification system and procedure: 1 μL of template DNA (bacterial genome), 30 μL of 2× PrimeSTARMax (Takara Biotech Co., Ltd.), 2 μL of upstream primer, 2 μL of downstream primer, 25 μL of ddH2O. Amplification conditions were: denaturation at 98°C for 2 minutes and then entering the cycle, with cycle parameters of 98°C for 10 seconds, 55°C for 15 seconds, and 72°C for 10 seconds. After 30 cycles, extension was performed at 72°C for 5 minutes. The amplified PCR products were analyzed by 1% agarose gel electrophoresis, as shown in FIG. Figure 2 The sizes of the three amplified fragments were consistent with the expected sizes.

[0070] The amplified fragments were analyzed by agarose gel electrophoresis and then purified and recovered using a kit. The concentration of the purified and recovered arcA gene upstream and downstream homology arms and kanamycin resistance gene fragments was measured by Nanodrop 2000, and they were fused at a ratio of 1:1:1 according to the length and concentration of the fragments. PCR amplification was performed using 2 μL of the fusion fragment as a template, and then PCR amplification was performed using primers arcA-up-F / arcA-down-R and LA Taq enzyme. The amplification conditions were: denaturation at 94°C for 5 minutes, followed by cycling, with cycling parameters of 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute. After 30 cycles, extension was performed at 72°C for 5 minutes. The results are shown in the figure. Figure 3 The amplified fragments were analyzed by agarose gel electrophoresis and recovered using a kit.

[0071] 2.3 Ligation of the fusion fragment with the suicide plasmid pRE112

[0072] 1) Enzyme digestion of suicide plasmid pRE112: + ) plate to recover E. coli DH5αλpir containing suicide plasmid pRE112, and take a single colony in 200mL LB (Cm + ) liquid culture medium was cultured in a shaking incubator at 37°C for 12 h, and the plasmid was extracted using a plasmid extraction kit. The concentration was determined by Nanodrop 2000 and then enzyme digestion was performed.

[0073] 2) Ligation of plasmid and fragment: The enzyme digestion system was placed in a 37°C metal bath for 3 h, then recovered using a DNA purification kit. The concentration was determined using a Nanodrop 2000. After the concentration and size of the plasmid and fragment were determined in proportion, the cells were placed in a 16°C metal bath for 18 h. The ligation system consisted of 8 μL of the digestion product plus the fusion fragment, 1 μL of T4 ligase, and 1 μL of T4 buffer.

[0074] 2.4 Preparation of competent E. coli

[0075] In LB (Cm+ ) plates and resuscitated E. coli DH5α and DH5αλpir and single colonies were picked and inoculated into 5 mL LB (Cm + ) The liquid culture medium was cultured at 37°C on a shaking platform for 12 h, and then inoculated into 100 mL of LB liquid culture medium at a ratio of 1:100, and cultured at 37°C on a shaking platform until the OD 600 =0.6~0.8; the bacterial solution was dispensed into 50mL centrifuge tubes and ice-bathed for 10min; centrifuged at 4℃, 5000r / min for 10min, and the supernatant was discarded; 20mLCaCl2 (0.1mol / L) solution was added to each centrifuge tube to resuspend the bacteria, and ice-bathed for 10min; centrifuged at 4℃, 5000r / min for 10min, and the supernatant was discarded; 800μLCaCl2 (0.1mol / L) solution was added to each centrifuge tube to resuspend the bacteria, and the cells were allowed to stand at 4℃ overnight; 15% sterilized glycerol was added the next day, mixed, and dispensed into 100μL tubes, and stored at -80℃.

[0076] 2.5 Transformation and identification of ligation systems

[0077] Take out the competent cell of DH5αλpir from -80℃ refrigerator, add 10μL of ligation product and ice bath for 20min; heat shock in 42℃ metal bath for 90s, ice bath for 2min; add 200μL LB liquid culture medium, culture in 37℃ constant temperature shaker for 2-3h; take 100μL bacterial solution and spread on LB (Cm + , Kan: 50 μg / mL) plates and cultured in a constant temperature incubator at 37°C for 24 hours; the colonies on the resistance plates were expanded and cultured and then PCR amplified and identified using primers arcA-up-F and arcA-down-R.

[0078] After agarose gel electrophoresis, plasmids from positive colonies were extracted using a plasmid extraction kit and amplified using primers arcA-up-F and arcA-down-R. The amplified products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The correctly sequenced plasmids were transformed into competent Escherichia coli SM10λpir cells, and the cultured colonies were identified by PCR amplification using primers arcA-up-F and arcA-down-R. Positive colonies were expanded and designated pRE112-arcA-kan.

[0079] 2.6 Conjugative transfer and identification of arcA gene deletion strains

[0080] 1) Conjugation transfer: Resuscitate the recipient strain PM0818 and the donor strain pRE112-arcA-kan, pick a single colony and culture it in 5 mL BHI or LB (DAP: 50 μg / mL) liquid medium at 37°C with shaking for 12 h, then expand the culture to BHI or LB (DAP: 50 μg / mL) liquid medium at a ratio of 1:100 and culture it at 37°C with shaking until the OD 600 =0.6-0.8. Recipient and donor bacteria were mixed in the appropriate proportions to a total volume of 5 mL. The mixed bacterial solution and 5 mL of 0.1 mol / L MgSO4 were added to a sterile 50 mL centrifuge tube. The mixture was filtered using a sterile syringe and a sterile filter (containing a membrane). The membrane was attached to a TSA (DAP: 50 μg / mL) plate and incubated at 37°C for 12 hours. The membrane was then washed with 10 mL of 0.1 mol / L MgSO4, and 100 μL of the bacterial solution was aspirated and applied to a BHI (Kan: 50 μg / mL) plate and incubated at 37°C for 24 hours.

[0081] 2) Identification of arcA gene deletion strains: Pick a single colony from the above plate and expand it for PCR amplification and identification. The identification primers are arcA-F / R, arcA-up-kan-F / R, arcA-down-F / R and kan-F / R. The identification results are as follows: Figure 4 .

[0082] Example 3 Construction of Pasteurella multocida gatA deletion strain and gatA, arcA double-deficient strain

[0083] 3.1 Primer design

[0084] Based on the genomic sequences of PM0818 and plasmid pCZ4 published by NCBI, a pair of primers, gatA-up-F / R and gatA-down-F / R, were designed to amplify the upstream and downstream homology arms of gatA, respectively. A pair of primers, arcA-up-F / R and arcA-down-F / R, were designed to amplify the upstream and downstream homology arms of arcA, respectively. Another pair of primers, gatA-kan-F / R and arcA-erm-F / R, was designed to amplify the inserted kanamycin and erythromycin resistance genes. The upstream and downstream homology arms of the resistance gene and the target gene, each containing approximately 15 bp of repetitive sequence, were used for overlap-PCR to fuse the upstream gene, resistance fragment, and downstream fragment. The resistance gene primers were kan-F / R and erm-F / R. All primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and their sequences are shown in Table 2.

[0085] Table 2. Primers required for constructing ΔgatAΔarcA mutants

[0086]

[0087] 3.2 Amplification and fusion of upstream and downstream homology arms of gatA and arcA genes and kanamycin and erythromycin resistance genes

[0088] 1) Pick a single colony of PM0818 and culture it in 5 mL of LB liquid medium overnight (37°C, 180 rpm / min). Use the bacterial genome extraction kit from Tiangen Biochemical Technology Co., Ltd. and perform genome extraction according to the instructions.

[0089] 2) Amplification of upstream and downstream homology arms, kan, and erm resistance gene fragments: PCR amplification was carried out in a 60 μL system. The reaction system was as follows: 1 μL of template DNA (bacterial genome), 30 μL of 2× PrimeSTARMax (Takara Biotech Co., Ltd.), 2 μL of upstream primer, 2 μL of downstream primer, and 25 μL of ddH2O. The amplification conditions were: denaturation at 98°C for 2 minutes before entering the cycle. The cycle parameters were 98°C for 10 seconds, 55°C for 15 seconds, and 72°C for 10 seconds. After 30 cycles, extension was performed at 72°C for 5 minutes. The amplified PCR products were analyzed by 1% agarose gel electrophoresis. The gatA upstream homology arm was approximately 500 bp (lane 1), the gatA downstream homology arm was approximately 500 bp (lane 2), and the kana resistance gene was approximately 800 bp (lane 3), which were consistent with the expected size. The results are as follows Figure 5 shown.

[0090] 3) Fusion of the upstream and downstream homologous arms with the kan and erm resistance gene fragments, respectively: The upstream and downstream homologous arms were mixed with the kan and erm resistance fragments, respectively, in a molar ratio of 1:1:1, 2 μL of which was taken as a template, and then PCR amplified using primers gatA-up-F / gatA-down-R and LATaq enzyme. The resulting fusion fragment had an "A" base attached to the 3' end. The amplification conditions were: denaturation at 94°C for 5 minutes, followed by cycling, with cycling parameters of 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute. After 30 cycles, extension was performed at 72°C for 5 minutes. The fusion fragment was approximately 1800 bp (lane 1), consistent with the expected size, and the results are as follows. Figure 6 shown.

[0091] 3.3 Construction of pRE112-ΔgatA and pRE112-ΔarcA suicide plasmids

[0092] 1) Enzyme digestion of suicide plasmid pRE112: The pRE112 plasmid was digested with AhdI enzyme to remove the sticky ends with "T" bases, and the plasmid was recovered.

[0093] 2) Ligation: Ligate the digested pRE112 plasmid and the fusion fragment using T4 DNA ligase at 16°C overnight. The ligation product was transferred to SM10λpir and amplified using primers gatA-up-F, gatA-down-R, arcA-up-F, and arcA-down-R to obtain the positive recombinant suicide plasmids pRE112-gatA and pRE112-arcA. The plasmids were extracted and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing and verification.

[0094] 3.4 Construction and identification of ΔgatA and ΔgatAΔarcA mutants

[0095] 1) Construction Process: Sequencing was performed to verify the correctness of the sequence, and the plasmid with the correct sequence was named pRE112-gatA. The recombinant plasmid from the donor strain SM10λpir was then introduced into the recipient strain PM0818 via conjugation. Finally, the correct gatA gene deletion strain was identified through kanamycin resistance screening and PCR amplification.

[0096] The recombinant plasmid pRE112-arcA-erm in the donor strain SM10λpir was introduced into the recipient strain PM0818ΔgatA through conjugation transfer. The correct gatA and arcA double gene deletion strain was identified through kanamycin and erythromycin resistance screening and PCR amplification.

[0097] 2) PCR identification: For identification of gatA gene deletion strains, use primers for amplification of the kanamycin resistance gene to identify the kanamycin resistance gene fragment, and use primers for amplification of the upstream or downstream homologous arms of the gatA gene to the kanamycin resistance gene to verify that the resistance gene fragment successfully replaces the target gene. Figure 7 As shown, no gatA gene fragment was amplified in PM0818ΔgatA (lane 2), but the kanamycin resistance gene band (lane 18), upstream or downstream homology arms and part of the kanamycin resistance gene fragment (lanes 8 and 11) were amplified, indicating that the gatA gene was successfully deleted. The same method was used to identify the gatA and arcA double gene deletion strains (lanes 6, 19, 14, and 16).

[0098] Experimental Example 1 Virulence of vaccine strains (median lethal dose, LD 50 ) determination

[0099] Sichuan ducks were used as animal models to determine the LD50 of PM0818, PM0818ΔarcA, PM0818ΔgatA, and PM0818ΔgatAΔarcA in seven-day-old ducks by oral and intramuscular injection. 50 , through LD 50Results The virulence of the gene-deficient strain was compared with that of the wild-type strain, and the results are shown in Tables 3 and 4. After intramuscular infection, the LD of PM0818ΔarcA 50 About 10 higher than PM0818 4 times, LD between PM0818ΔgatA and PM0818ΔgatAΔarcA 50 About 10 higher than PM0818 7 times. The LD of PM0818ΔarcA, PM0818ΔgatA and PM0818ΔgatAΔarcA after oral infection 50 They are about 10 times taller than wild plants. 3 times.

[0100] In summary, after the deletion of gatA and arcA genes, the virulence of PM0818 to ducks was reduced by at least 10 3 times, indicating that gatA and arcA are both virulence genes of Pasteurella multocida. Therefore, the vaccine strain constructed by the present invention can be used for immune protection evaluation.

[0101] Table 3 LD of duck challenged by intramuscular injection 50 Determination of

[0102]

[0103] Table 4 LD of ducks challenged orally 50 Determination of

[0104]

[0105] Experimental Example 2 Safety Testing of Pasteurella multocida Vaccine Strain

[0106] 10 were injected intramuscularly 5 CFU, 10 6 CFU, 10 7 CFU and 10 8 Seven-day-old ducks were immunized with CFU of PM0818ΔgatAΔarcA, and their body temperature and weight were measured for 14 consecutive days. An environmental control group was also set up to record the health status of the ducks.

[0107] (1) Changes in duck body temperature

[0108] Temperature monitoring results Figure 8 As shown, after infection with PM0818ΔgatAΔarcA, 10 5 The body temperature of the CFU group was relatively stable. 6 The body temperature of the CFU group increased slightly only on the 8th day. 7 The body temperature of the CFU group increased on the 6th to 8th day, and the duck joints were slightly swollen. 8The body temperature of the CFU group was always higher than that of the environmental control group, and the ducks' foot joints became severely swollen and listless during the monitoring process.

[0109] (2) Changes in duck weight

[0110] Body weight monitoring showed that the body weight of ducks immunized with different doses of PM0818ΔgatAΔarcA was similar to that of the environmental control group at each time point, with the body weight increasing from 0.4 kg to 0.6 kg. Figure 9 The results of temperature and weight monitoring showed that the double gene deletion strain had no effect on the weight gain of ducks at each immunization dose, but 10 7 , 10 8 The immunization dose of CFU caused the ducklings to have a long-term fever. 6 CFU only causes short-term fever, 10 5 CFU did not induce fever. Therefore, PM0818ΔgatAΔarcA was expressed in the muscle, 10 6 Doses of CFU and below are safer.

[0111] Experimental Example 3 Determination of the immune protection effect of the ΔgatAΔarcA vaccine strain

[0112] 1) Determination of immune protection efficacy: 140 one-day-old ducks purchased from the hatchery were randomly divided into two groups, the immunization group and the control group. The immunization group was divided into oral immunization and intramuscular immunization, with 40 ducks in each group. The control group was divided into PBS control group and environmental control group, with 40 ducks in the PBS control group and 20 ducks in the environmental control group. The ducks were acclimated to the environment for one week. 6 Ducklings were inoculated with CFU of ΔgatAΔarcA by intramuscular injection, and the other half were boosted with the same dose and route 14 days later. 8 The dose of CFU was immunized orally, and a PBS control group was set up at the same time. After 14 days, the same dose and the same route were used for booster immunization. Two weeks after the second immunization, 100 times the LD 50 The PM0818 was used to challenge the ducklings, and the mortality of the ducklings in each group after the challenge was recorded. Figure 10 B. Oral or intramuscular immunization with PM0818ΔgatAΔarcA eliminated PM0818 from ducks and provided 50% and 65% protection, respectively. This indicates that our constructed attenuated strain ΔgatAΔarcA can be used to prevent avian Pasteurella multocida infection.

[0113] 2) Bacteria clearance effect detection: According to the immunization procedure in 1), 12 hours after the infection, ducklings were randomly selected from each group and killed by air injection, and the heart blood, liver, spleen, and lungs were collected in turn. The above tissues were placed in a disposable sterile sampling bag, added with an appropriate amount of PBS and ground, and the grinding liquid was diluted 10 times and 100 times and then dropped on the plate. The plate was placed in a 37°C incubator for overnight culture. The next day, the number of colonies on the plate was counted, the number of bacteria per gram of tissue was calculated, and the data was processed using GraphPadPrism5 software. The results are as follows. Figure 10 As shown in A, compared with the PBS control group, the two ΔgatAΔarcA immunization groups had significant bacterial clearance effects, which was consistent with the results of the immune protection test.

[0114] In summary, the immune protection experiment in ducklings confirmed that the ΔgatAΔarcA constructed in the present invention can be used to prevent infection with avian Pasteurella multocida. It also confirmed that deleting virulence factor-related genes is an ideal strategy for constructing Pasteurella multocida vaccine strains, which also lays the foundation for the development of new Pasteurella vaccines.

[0115] The foregoing description is merely a preferred embodiment of the present invention. It should be understood that the present invention is not limited to the form disclosed herein and should not be construed as excluding other embodiments. Rather, the present invention can be used in various other combinations, modifications, and environments and can be modified within the scope of the concept described herein through the above teachings or techniques or knowledge in the relevant field. Modifications and variations made by those skilled in the art that do not depart from the spirit and scope of the present invention are intended to be protected by the appended claims.

Claims

1. Attenuated Pasteurella multocida, characterized in that The attenuated Pasteurella multocida is a Pasteurella multocida-deficient arcA Genes and gatA Gene, Pasteurella multocida arcA The sequence of the gene is shown in SEQ ID NO:

1.

2. The method for constructing the attenuated Pasteurella multocida according to claim 1, characterized in that: The construction method comprises: constructing a deletion Pasteurella multocida by suicide plasmid-mediated homologous recombination arcA Genes and gatA genes of Pasteurella multocida.

3. The construction method according to claim 2, characterized in that The homologous recombination method comprises the following steps: S1, respectively construct missing arcA Gene, gatA Gene suicide plasmid; S2, transferring the suicide plasmid constructed in step S1 into competent Escherichia coli, performing conjugation transfer with Pasteurella multocida, and screening positive colonies; S3. Obtaining the missing Pasteurella multocida by PCR screening arcA Genes and gatA genes of Pasteurella multocida.

4. The construction method according to claim 3, characterized in that In step S1, the missing arcA Gene, gatA Gene suicide plasmid methods include: 1) Based on the sequence information of Pasteurella multocida and plasmid pCZ4, primers were designed to amplify arcA Upstream and downstream homology arms of the gene, gatA The upstream and downstream homology arms of the gene, as well as the kanamycin and erythromycin resistance gene fragments between the amplified homology arms, have 15±2bp repeat sequences with the upstream and downstream homology arm fragments, respectively; 2) Amplification using the complete genome of Pasteurella multocida as a template arcA Gene, gatA The upstream and downstream homology arms of the gene were used to amplify the kanamycin and erythromycin resistance genes using plasmid pCZ4 as a template; 3) The product obtained by amplification in step 2) is subjected to PCR amplification using primers and a high-fidelity enzyme to obtain a fusion fragment; 4) After enzyme digestion, the plasmid was ligated with the fusion fragment and transformed into E. coli competent cells. PCR identification was performed to obtain positive deletions arcA Gene, gatA Suicide plasmids containing genes.

5. The construction method according to claim 4, characterized in that: The primers involved in the homologous recombination method are shown in SEQ ID NO: 14 to SEQ ID NO:

35.

6. The deletion constructed by the construction method according to any one of claims 2 to 5 arcA Gene, gatA genes of Pasteurella multocida.

7. Use of the Pasteurella multocida lacking the arcA gene and the gatA gene according to claim 6 in the preparation of a live attenuated fowl cholera vaccine.

Images