Construction method of recombinant canine distemper virus strain expressing mink parvovirus VP2 protein

Abstract

The application provides a construction method of a recombinant canine distemper virus strain expressing mink parvovirus VP2 protein and relates to the technical field of genetic engineering. The construction method uses a mink canine distemper virus attenuated vaccine CDV3 strain as a basis, clones mink parvovirus VP2 genes into a canine distemper virus genome cDNA, and obtains a recombinant canine distemper virus rCDV3-mVP2 strain capable of simultaneously expressing CDV proteins and MEV VP2 proteins through virus reverse genetic technology, so as to provide a candidate vaccine strain for the research and development of a mink canine distemper and parvovirus enteritis double recombinant live vaccine.

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of genetic engineering, in particular to a construction method of a recombinant canine distemper virus strain expressing mink parvovirus VP2 protein. BACKGROUND

[0002] Mink parvovirus enteritis and mink distemper are two important infectious diseases seriously endangering mink breeding industry. Mink parvovirus enteritis is caused by mink parvovirus (MEV) and mainly manifests as acute hemorrhagic enteritis, which has high infectivity and high mortality. Mink distemper is caused by canine distemper virus (CDV) and has strong infectivity and high mortality, and often causes secondary infection.

[0003] At present, there are vaccines on the market for jointly preventing the two mink infectious diseases, but the above-mentioned live vaccines have complex production process and too many immunization times, and further development of more effective vaccines is needed.

[0004] CDV is an excellent carrier platform for developing recombinant virus vector vaccines, and the successful construction of a recombinant virus expressing parvovirus antigen protein by taking canine distemper virus as a carrier provides a good reference for developing a mink distemper and mink parvovirus enteritis double recombinant live vaccine by taking canine distemper virus as a carrier. For example, in 2015, Li Zhili expressed mink parvovirus VP2 protein by using canine distemper virus CDV-L strain, and although a recombinant virus rCDV-MEV-VP2 was rescued, the VP2 protein could not be successfully expressed; in 2015, Qin Liduo expressed codon-optimized canine parvovirus VP2 protein by using canine distemper virus CDV r20 / 8 strain, and the recombinant virus could only induce low-level anti-CDV neutralizing antibodies in mice, and there is no report on the successful construction of a recombinant canine distemper virus expressing mink parvovirus VP2 protein.

[0005] The present research develops a recombinant canine distemper virus capable of simultaneously expressing CDV protein and MEV VP2 protein, provides a candidate vaccine strain for the research and development of a mink distemper and mink parvovirus enteritis double vaccine, and realizes the protection of pets and economic animals against canine distemper and mink parvovirus enteritis.

[0006] In view of this, the present application is proposed. SUMMARY

[0007] The present application aims to provide a construction method of a recombinant canine distemper virus strain expressing mink parvovirus VP2 protein, and the recombinant canine distemper virus strain obtained by the construction method is a recombinant canine distemper virus rCDV3-mVP2 strain capable of simultaneously expressing CDV protein and MEV VP2 protein, and provides a candidate vaccine strain for the research and development of a mink distemper and mink parvovirus enteritis double vaccine.

[0008] In order to achieve the above-mentioned object of the present application, the following technical solutions are adopted:

[0009] The application provides a construction method of a recombinant canine distemper virus strain expressing mink parvovirus VP2 protein.

[0010] Further, the construction method comprises the following steps:

[0011] (A) Construction of a viral infectious clone:

[0012] PCR amplification is performed to obtain the nucleotide sequence encoding the VP2 protein of the mink parvovirus SD-4 strain, and then the nucleotide sequence is cloned into a pCR-rCDV3 recombinant plasmid to obtain a pCR-rCDV3-mVP2 recombinant plasmid.

[0013] (B) Virus rescue:

[0014] The pCR-rCDV3-mVP2 plasmid and an auxiliary plasmid are co-transfected into BSR cells expressing T7 RNA polymerase, and then the cells are co-incubated and cultured with susceptible cells to obtain a recombinant canine distemper virus strain.

[0015] Further, the nucleotide sequence encoding the mink parvovirus VP2 protein in the step (A) is shown in SEQ ID NO. 1.

[0016] Further, in the pCR-rCDV3-mVP2 recombinant plasmid, the nucleotide sequence encoding the mink parvovirus VP2 protein is added with Mlu I and BssH II enzyme cutting sites at both ends, and a Kozak sequence is added at the 5' end.

[0017] Further, the primer sequence for amplifying the nucleotide sequence encoding the mink parvovirus VP2 protein in the step (A) comprises:

[0018] a forward primer with a nucleotide sequence shown in SEQ ID NO. 2;

[0019] and a reverse primer with a nucleotide sequence shown in SEQ ID NO. 3.

[0020] Further, the auxiliary plasmid in the step (B) comprises:

[0021] pCAGGS-N, pCAGGS-P and pCAGGS-L.

[0022] Further, the competent cells co-transfected in the step (B) are BSR cells capable of expressing T7 polymerase.

[0023] Further, the susceptible cells in the step (B) are Vero cells capable of expressing the canine SLAM receptor.

[0024] The application provides a recombinant canine distemper virus strain expressing a mink parvovirus VP2 protein, which is prepared by the construction method described in the application.

[0025] The recombinant canine distemper virus strain obtained by the construction method can be used for the preparation of vaccines or drugs.

[0026] Compared with the prior art, the application has the following beneficial effects:

[0027] The construction method of the recombinant canine distemper virus strain expressing the mink parvovirus VP2 protein in the application is based on the mink canine distemper virus attenuated CDV3 strain, the mink parvovirus VP2 gene is cloned into the genome of the mink canine distemper virus attenuated CDV3 strain, and the virus rescue technology is used to construct the recombinant canine distemper virus rCDV3-mVP2 strain expressing the CDV protein and the MEV VP2 protein, so that the recombinant virus strain provides a basis for the development of a candidate vaccine strain of the mink canine distemper and mink parvovirus enteritis bivalent vaccine. BRIEF DESCRIPTION OF DRAWINGS

[0028] To make the specific embodiments of the application or the technical solutions of the prior art clearer, the drawings required in the specific embodiments or the prior art description are briefly introduced. Obviously, the drawings described below are some embodiments of the application, and other drawings can be obtained by those skilled in the art without creative labor on the basis of the drawings.

[0029] Figure 1 A structural schematic diagram of the recombinant CDV genomic cDNA plasmid pCR-rCDV3 provided for the embodiment 1 of the application is shown in the figure;

[0030] Figure 2 A structural schematic diagram of the recombinant virus genomic plasmid rCDV3-mVP2 provided for the embodiment 2 of the application is shown in the figure;

[0031] Figure 3 A virus rescue flowchart provided for the embodiment 3 of the application is shown in the figure;

[0032] Figure 4 A rescue result diagram of the recombinant virus rCDV3-mVP2 provided for the embodiment 3 of the application is shown in the figure;

[0033] Figure 5 An RT-PCR identification result diagram of the recombinant virus rCDV3-mVP2 provided for the embodiment 4 of the application is shown in the figure;

[0034] Figure 6Figure of cell toxicity morphological observation result of the 5th generation of the recombinant virus rCDV3-mVP2 provided for the embodiment 4 of the present application;

[0035] Figure 7 Figure of Western Blot result of the recombinant virus rCDV3-mVP2 provided for the embodiment 4 of the present application;

[0036] Figure 8a Figure of indirect immunofluorescence identification result of the recombinant virus rCDV3-mVP2 using anti-CDV N protein monoclonal antibody provided for the embodiment 4 of the present application;

[0037] Figure 8b Figure of indirect immunofluorescence identification result of the recombinant virus rCDV3-mVP2 using anti-CDV N protein monoclonal antibody provided for the embodiment 4 of the present application;

[0038] Figure 9 Figure of hemagglutination property detection result of the recombinant virus rCDV3-mVP2 provided for the embodiment 4 of the present application;

[0039] Figure 10 Figure of plaque clone purification result of the recombinant virus rCDV3-mVP2 provided for the embodiment 5 of the present application;

[0040] Figure 11 Figure of passage stability verification result of the recombinant virus rCDV3-mVP2 provided for the embodiment 5 of the present application;

[0041] Figure 12 Figure of growth curve of the recombinant virus rCDV3-mVP2 on Vero cells and induced cell fusion lesion provided for the embodiment 7 of the present application. DETAILED DESCRIPTION

[0042] The technical solutions of the present application will be described clearly and completely in combination with the embodiments. Obviously, the described embodiments are only a part of the present application, not all the embodiments. Based on the embodiments in the present application, all the other embodiments obtained by those skilled in the art without creative labor fall within the protection scope of the present application.

[0043] According to one aspect of the present application, a method for constructing a recombinant canine distemper virus strain expressing mink parvovirus VP2 protein is provided. The method is based on the attenuated CDV3 strain of mink canine distemper virus, and a recombinant canine distemper virus strain capable of expressing CDV protein and MEV VP2 protein is constructed by viral reverse genetics technology.

[0044] The application discloses a method for constructing a recombinant canine distemper virus strain expressing mink parvovirus VP2 protein.

[0045] In a preferred embodiment of the application, the method comprises:

[0046] (A) Construction of a full-length genomic infectious clone:

[0047] The nucleotide sequence encoding the VP2 protein of the mink parvovirus SD-4 strain is amplified by PCR and then cloned into the pCR-rCDV3 recombinant plasmid to construct a pCR-rCDV3-mVP2 recombinant plasmid;

[0048] (B) Virus rescue:

[0049] The pCR-rCDV3-mVP2 recombinant plasmid and a helper plasmid are co-transfected into BSR cells expressing T7 RNA polymerase, and then co-incubated with susceptible cells for culture to obtain the recombinant canine distemper virus strain.

[0050] In a preferred embodiment of the application, the nucleotide sequence encoding the VP2 protein of the mink parvovirus in step (A) is shown as SEQ ID NO. 1.

[0051]

[0052] In a preferred embodiment of the present application, in the pCR-rCDV3-mVP2 plasmid, the nucleotide sequence encoding the mink parvovirus VP2 protein is added with Mlu I and BssH II enzyme cutting sites at both ends, and a Kozak sequence is added at the 5' end, and the Kozak sequence is 5'-GCCACC-3'.

[0053] In a preferred embodiment of the present application, the primer sequence for amplifying the nucleotide sequence encoding the mink parvovirus VP2 protein in step (A) comprises:

[0054] a forward primer with the nucleotide sequence as shown in SEQ ID NO. 2; and a reverse primer with the nucleotide sequence as shown in SEQ ID NO. 3.

[0055] The specific sequence of SEQ ID NO. 2 is as follows (primer sequence 5'→3'): GAGCCTAAGTCCTCTCCTAAAAA aACGC GT ACCGCCACCATGAGTGATGG.

[0056] The specific sequence of SEQ ID NO. 3 is as follows (primer sequence 5'→3'): GTAGATTAGTCAACGCTACAGA GCGCGC TTAATATAATTTTCTAGGTGCTAGTTGAG.

[0057] Note: In the above SEQ ID NO. 2 sequence and SEQ ID NO. 3 sequence, the italicized part is the homologous arm, and the horizontal line is the enzyme cutting site.

[0058] In a preferred embodiment of the present application, the helper plasmid in step (B) comprises: pCAGGS-N, pCAGGS-P and pCAGGS-L.

[0059] In a preferred embodiment of the present application, the competent cells co-transfected in step (B) are BSR cells capable of expressing T7 polymerase.

[0060] In a preferred embodiment of the present application, the susceptible cells in step (B) are Vero cells capable of expressing canine SLAM receptors.

[0061] According to an aspect of the present application, there is provided a recombinant canine distemper virus strain expressing a mink parvovirus VP2 protein, which is prepared by the above-mentioned method for constructing a recombinant canine distemper virus strain expressing a mink parvovirus VP2 protein.

[0062] According to one aspect of the present invention, the use of a recombinant canine distemper virus strain obtained by the above-described construction method in the preparation of vaccines or drugs.

[0063] The recombinant canine distemper virus strain prepared by the method for constructing a recombinant canine distemper virus strain expressing mink parvovirus VP2 protein provided by this invention can be widely used in the preparation of vaccines or drugs.

[0064] The technical solution of the present invention will be further described below with reference to the embodiments.

[0065] Example 1: Construction of pCR-rCDV3 recombinant plasmid:

[0066] (I) Viral RNA was extracted from canine distemper virus strain CDV3 and cDNA templates were prepared. Primers for amplifying viral cDNA and primers for amplifying pCRscript plasmid (pCR plasmid) were designed with reference to CDV3 strain (GenBank: EU726268.1) in the GenBank database. All primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0067] The CDV3 strain genome was sequenced, and the whole genome was divided into 6 segments for amplification based on the distribution of restriction enzyme sites.

[0068] Figure 1 This is a schematic diagram of the structure of the recombinant CDV genomic cDNA plasmid pCR-rCDV3 provided in this embodiment. Figure 1 In the diagram, T7p-opt is the T7 promoter; HhRbz is the hammer ribozyme; HdvRz is the hepatitis B ribozyme; and T7 Ter is the T7 terminator.

[0069] Table 1: Homologous recombination reaction system

[0070]

[0071]

[0072] The CDV3 genome was amplified using the primers in Table 1. The high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, R045Q) was used, and the reaction system and conditions were set according to the instructions.

[0073] (II) Connecting pCR-rCDV3:

[0074] The CDV3 strain gene fragments F1, F2, F3, F4, F5, and F6, amplified with high-fidelity enzymes, were ligated into the blunt-end sequencing vector pCE2-TA-Blunt-Zero and sent to Shanghai Sangon Biotech for sequencing. After successful sequencing, ligation was performed.

[0075] Referring to Table 1, each of the upstream and downstream primers of the F1 fragment comprises a 20 bp sequence homologous to the end of the vector, and the pCR-F and pCR-R primers are used to reverse PCR amplify the pCRscript plasmid vector, and the F1 fragment is synthesized by homologous recombination to obtain the pCR-F1. The pCR-F1 is double digested by Pme I and Mlu I, and the F4 is connected by the homologous arm to obtain the pCR-F1-F4. The pCR-F1-F4 is double digested by Eco065 I and Mlu I, and the F5 is connected by the homologous arm to obtain the pCR-F1-F4-F5. The pCR-F1-F4-F5 is connected by Bln I and Mlu I to obtain the pCR-F1-F4-F5-F6. The pEASY-F2 and pEASY-F3 are obtained by double digestion of the plasmid pEASY-F2 and pEASY-F3 of the pEASY-Blunt-Zero vector by Ned I and Not I, and then connected by T4 ligase to obtain the pEASY-F2-F3. The pEASY-F2-F3 and the pCR-F1-F4-F5-F6 are digested by Pme I and Cpo I, and then connected by T4 ligase to obtain the recombinant plasmid pCR-rCDV3 (see Table 1). Figure 1 )。

[0076] The sequence of the pCR-rCDV3 recombinant plasmid is shown in SEQ ID NO. 4-10.

[0077] The specific sequence of SEQ ID NO. 4 is as follows:

[0078]

[0079] The specific sequence of SEQ ID NO. 5 is as follows:

[0080]

[0081] The specific sequence of SEQ ID NO. 6 is as follows:

[0082]

[0083] The specific sequence of SEQ ID NO. 7 is as follows:

[0084]

[0085] The specific sequence of SEQ ID NO. 8 is as follows:

[0086]

[0087] The specific sequence of SEQ ID NO. 9 is as follows:

[0088]

[0089]

[0090] Construction of recombinant CDV3 strain virus genome cDNA clone expressing VP2 protein:

[0091] The pCR-rCDV3 recombinant plasmid was digested with Mlu I and BssH II, the VP2 gene was amplified with the primers in Table 2, and pCR-rCDV3-mVP2 was constructed by homologous recombination enzyme ligation. The ligation product was transformed into XL-10 competent cells, a single colony was selected, and after correct identification, it was sent to Shengong for sequencing. The plasmid with correct sequencing was named pCR-rCDV3-mVP2.

[0092] Figure 2 The structure of the recombinant virus genome plasmid pCR-rCDV3-mVP2 provided for this embodiment is shown in the schematic diagram.

[0093] Figure 2 T7 p-opt: T7 promoter; HhRbz: hammerhead ribozyme; HdvRz: hepatitis B ribozyme; T7 Ter: T7 terminator; VP2: MEV VP2 gene; GE: transcription termination signal; GS: transcription initiation signal; CDS: gene coding region; the VP2 gene is inserted between the P and M genes, Mlu I and BssH II restriction sites are added at both ends of the CDS region, and GS / GE sequences required for transcription regulation are added for the VP2 gene; italic GCCACC is the Kozak sequence; lowercase acc is added for adjustment of the six-base principle.

[0094] Table 2:

[0095]

[0096] Rescue of recombinant CDV3 strain virus rCDV3-mVP2 expressing VP2 protein:

[0097] Figure 3 The flowchart of virus rescue provided for this embodiment is shown in the schematic diagram.

[0098] Referring to Figure 3 It can be seen that the virus rescue process includes two processes of transfection and co-incubation with susceptible cells. The expression of T7 polymerase BSR cells is required to realize virus RNA transcription and the expression of auxiliary proteins and to provide an environment for the assembly of RNPs. The expression of canine SLAM receptor Vero cells is used to realize efficient proliferation of the virus.

[0099] The specific rescue process is as follows.

[0100] (1) Cell preparation: BSR cells were cultured and subcultured in DMEM medium containing 10% fetal bovine serum, and VerodogSLAM cells were cultured and subcultured in DMEM medium containing 5% serum. BSR cells were inoculated into a 6-well plate, and VerodogSLAM cells were subcultured in a T25 cell bottle at a ratio of 1:3 for standby.

[0101] (2) Transfection: BSR cells in the 6-well plate reached 80% density and were transfected with pCR-rCDV3-mVP2 8 μg, pCAGGS-N 0.5 μg, pCAGGS-P 0.5 μg, and pCAGGS-L 1 μg.

[0102] (3) Co-incubation: After 48 hours of transfection, the cells in the 6-well plate were digested and inoculated into a VerodogSLAM cell bottle with a density of about 50%-60%, mixed evenly, and cultured at 34°C. After the cells were fully grown, 1 / 2 of the cells were again co-incubated with VerodogSLAM cells for continuous culture.

[0103] (4) Virus collection: After three generations of co-incubation, the cells and supernatant were collected, repeatedly freeze-thawed 3 times, then centrifuged to take the supernatant, and stored at -80°C refrigerator.

[0104] The rescue results of the recombinant CDV3 strain virus expressing VP2 protein in this example are as follows:

[0105] The pCR-rCDV3-mVP2 plasmid was co-transfected with the helper plasmids pCAGGS-N, pCAGGS-P, and pCAGGS-L in a ratio of 8:0.5:0.5:1 in BSR cells. After 48 hours of transfection, no large area of cytopathic effect was observed in BSR, and after 48 hours of co-incubation in VerodogSLAM cells, a large area of cytopathic effect was observed. The virus was collected by repeated freeze-thawing and detected, and the specific results are shown in Figure 4 .

[0106] Figure 4 The rescue results of the recombinant virus rCDV3-mVP2 provided in this example are shown in the figure.

[0107] Figure 4 A is uninfected BSR cells; Figure 4 B is the result of co-transfecting the full-length plasmid with the helper plasmid into BSR cells for 48 hours; Figure 4 C is uninfected VerodogSLAM cells; Figure 4 D is the result of inoculating VerodogSLAM cells 48 hours after co-incubating VerodogSLAM cells for 96 hours.

[0108] Example 3 Identification of recombinant virus rCDV3-mVP2:

[0109] (I) RT-PCR identification of recombinant virus rCDV3-mVP2

[0110] The recombinant virus rCDV3-mVP2 was passaged on Verodog SLAM cells for 7 times in succession, and the RNA of each passage of virus liquid was extracted and reverse transcribed, and the primers were SEQ ID NO. 11 and SEQ ID NO. 12.

[0111] The specific sequence of SEQ ID NO. 11 is as follows: ATGAGTGATGGAGCAGTTC.

[0112] The specific sequence of SEQ ID NO. 12 is as follows: TTAATATAATTTTCTAGGTGCTAGTTGAG.

[0113] PCR was performed with the primers in Table 3 to detect the carrying of VP2 gene in the genome of the recombinant virus.

[0114] Table 3:

[0115]

[0116] The specific results are as follows:

[0117] The recombinant virus rCDV3-mVP2 was passaged in succession, and the RNA was extracted to detect the VP2 gene by RT-PCR, and the results showed that the genome of the recombinant virus passaged for 7 times still carried the VP2 gene.

[0118] Figure 5 Figure for RT-PCR identification results of recombinant virus rCDV3-mVP2.

[0119] Figure 5 M: DL 2000 DNA marker; 1: negative control; 2: rCDV3-mVP2 P1; 3: rCDV3-mVP2 P2; 4: rCDV3-mVP2 P3; 5: rCDV3-mVP2 P4; 6: rCDV3-mVP2 P5; 7: rCDV3-mVP2 P6; 8: rCDV3-mVP2 P7.

[0120] (II) Electron microscopic observation of recombinant virus rCDV3-mVP2:

[0121] The 5th passage of recombinant virus rCDV3-mVP2 cell toxin was taken, centrifuged at 5 000 r / min for 10 min after repeated freezing and thawing for 3 times, and the supernatant was observed by electron microscope after negative staining with 2% phosphotungstic acid.

[0122] Figure 6This image shows the morphological observation results of the fifth generation of recombinant virus rCDV3-mVP2. Figure 6 Electron microscopy revealed that the isolated strain possessed the morphological characteristics characteristic of canine distemper virus.

[0123] (III) Western Blot identification of recombinant virus rCDV3-mVP2:

[0124] VerodogSLAM cells were seeded in 60 mm petri dishes. When the cell density reached 70%, the parental rCDV3 strain and recombinant virus rCDV3-mVP2 were used to infect the cells. When obvious cytopathic effects appeared, the cells were collected into 1.5 mL centrifuge tubes, centrifuged at 3000 rpm for 5 min, the PBS was discarded, and the cells were frozen at -80°C for 10 min. After thawing, 50 μL of RIPA lysis buffer containing 1% PMSF was added, and the cells were lysed on ice for 30 min. The lysed sample was centrifuged at 4°C and 12000 rpm for 10 min, transferred to a new centrifuge tube, mixed with 12.5 μL of loading buffer, vortexed, centrifuged, and aliquoted for later use.

[0125] 10 μL of protein sample was subjected to SDS-PAGE electrophoresis. The membrane was subjected to constant voltage electrophoresis at 200V for 30 min and constant voltage electrophoresis at 100V for 50 min. It was blocked with 5% skim milk at room temperature for 2 h. After washing twice with TBST, the membrane was used as primary antibody with mouse anti-CDV N protein monoclonal antibody G3N1 and mouse anti-MEV VP2 protein monoclonal antibody, and as secondary antibody with Boos goat anti-mouse IgG. After washing the membrane 4 times with TBST, it was developed with ECL chemiluminescent chromogenic solution.

[0126] Figure 7 This is a Western blotting result of the recombinant virus rCDV3-mVP2.

[0127] Depend on Figure 7 It was found that after VerodogSLAM cells were infected with recombinant virus rCDV3-mVP2, the cells were lysed and samples were prepared for Western Blot analysis to detect the expression of CDV N protein and MEV VP2 protein. The Western Blot results showed that CDV N protein and MEV VP2 protein expression were detected in the recombinant virus rCDV3-mVP2 group, but no expression of the two proteins was detected in the uninfected group.

[0128] (iv) Indirect immunofluorescence identification of recombinant virus rCDV3-mVP2:

[0129] VerodogSLAM cells were plated in 48-well plates, and when the cell density reached 80%, rCDV3 and rCDV3-mVP2 were infected at an MOI of 0.1. After obvious lesions appeared, the culture medium was discarded, 4% tissue fixative was added for 30 min, and PBS was washed twice; 0.5% Triton X-10 was added for 30 min, and PBS was washed twice; 1% BSA was added for 1 h at room temperature, and PBS was washed twice; mouse anti-CDV N protein monoclonal antibody G3N1 and mouse anti-MEV VP2 protein monoclonal antibody were used as the primary antibody, and FITC-labeled goat anti-mouse IgG (H+L) was used as the secondary antibody. After PBS washing twice, fluorescence was observed under a fluorescence microscope.

[0130] Figure 8a Figure showing the results of indirect immunofluorescence identification of recombinant virus rCDV3-mVP2 using anti-CDV N protein monoclonal antibody;

[0131] Figure 8b Figure showing the results of indirect immunofluorescence identification of recombinant virus rCDV3-mVP2 using anti-MEV VP2 protein monoclonal antibody;

[0132] From the above Figure 8a and Figure 8b it can be seen that the recombinant virus rCDV3-mVP2 strain and the parent virus rCDV3 strain infected VerodogSLAM cells, and were identified using anti-CDV N protein monoclonal antibody and anti-MEV VP2 protein monoclonal antibody. The recombinant virus infection group observed obvious green fluorescence representing CDV N protein and MEV VP2 protein at the lesion site, and the parent rCDV3 group only observed green fluorescence representing CDV N protein expression at the lesion site.

[0133] (Five) Hemagglutination property detection of recombinant virus rCDV3-mVP2

[0134] The first 4 generations of cell toxins of the isolated strain were selected as detection samples for hemagglutination test. A 1% pig red blood cell suspension was used to operate according to the conventional method in a 96-well V-shaped reaction plate, and observation was performed after 4°C reaction for 60 min. The highest dilution degree of 50% red blood cell agglutination was used as the determination result, and the HA titer of the virus was calculated.

[0135] The hemagglutination property of the first 4 generations of cell toxins of recombinant virus rCDV3-mVP2 was detected, and the detection results are shown in Figure 9 .

[0136] Figure 9 Figure showing the hemagglutination property detection results of recombinant virus rCDV3-mVP2. Figure 9 A in the figure is a MEV positive control; Figure 9 B in the figure is rCDV3-mVP2 P1 (first generation);Figure 9 C in the middle is rCDV3-mVP2 P2 (second generation); Figure 9 D in the middle is rCDV3-mVP2 P3 (third generation); Figure 9 The middle E is rCDV3-mVP2 P4 (fourth generation).

[0137] Depend on Figure 9 It can be seen that the hemagglutination titers of recombinant viruses rCDV3-mVP2-P1, rCDV3-mVP2-P2, rCDV3-mVP2-P3, and rCDV3-mVP2-P4 are 2, 1, 2, 1, 2, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, and 14, respectively. 3 2 7 2 7 2 8 .

[0138] Example 4 Plaque purification of recombinant virus rCDV3-mVP2

[0139] The plaque purification method for the recombinant virus rCDV3-mVP2 is as follows:

[0140] (1) Take 200 μL of the recombinant virus rCDV3-mVP2 prepared in Example 2 and inoculate it into a 60 mm VerodogSLAM cell plate for overnight culture.

[0141] (2) Prepare agar medium. Take 0.5g of low melting point agar and add it to 10mL of pure water. Sterilize at 120℃ for 20min. After cooling, add 30mL of medium containing 10% FBS and mix well for later use.

[0142] (3) Remove the petri dish, discard the culture medium and pour in 5 mL of agar medium, then cool to room temperature.

[0143] (4) Add 10 times diluted 0.03% neutral red staining solution to the petri dish for staining.

[0144] Once obvious syncytia appear, the virus is purified by plaque phage using low melting point agarose. Clear plaques can be observed by staining with neutral red. Single plaques are picked for further culture.

[0145] Figure 10 This image shows the purification results of the plaque clone of the recombinant virus rCDV3-mVP2 provided in this embodiment.

[0146] See Figure 10 The virus was infected into VerodogSLAM cells and then purified by plaque removal. Figure 10 The area highlighted in the middle is a magnified empty spot.

[0147] Example 5: Verification of the stability of exogenous gene expression in recombinant virus rCDV3-mVP2

[0148] The virus purified by plaque was passaged seven times in VerodogSLAM cells. The viral titer of each generation was detected in VerodogSLAM cells, and each detection was repeated twice and the average value was taken.

[0149] Figure 11 The figure shows the results of the passage stability verification of the recombinant virus rCDV3-mVP2 provided in this embodiment.

[0150] Depend on Figure 11 It was found that after continuous passage of the purified virus in VerodogSLAM cells and detection of the viral titer at each passage, the viral titer of the recombinant virus remained stable after 7 consecutive passages, with the titer consistently around 10 after the second passage. 4.5 TCID 50 / mL or more.

[0151] Example 6: Study on the in vitro growth characteristics of recombinant virus rCDV3-mVP2

[0152] To compare the growth kinetics of the recombinant virus rCDV3-mVP2 and the parental rCDV3 strain, Vero cells were infected with both the recombinant virus and the parent at an MOI of 0.005, and growth curves were plotted at different time points.

[0153] Specifically, Vero cells were seeded in 24-well plates and cultured overnight at 37°C. Parental virus rCDV3 and recombinant virus rCDV3-mVP2 were seeded into 24-well plates at an MOI of 0.005 and cultured at 37°C. Cells and supernatant were harvested at 24, 36, 48, 72, and 96 hours post-infection, with two wells collected at each time point. The supernatant was collected by centrifugation after three freeze-thaw cycles for virus titer determination.

[0154] Figure 12 The growth curve and induced cytopathic effect diagram of the recombinant virus rCDV3-mVP2 provided in this embodiment on Vero cells.

[0155] Depend on Figure 12 It was found that the recombinant virus rCDV3-mVP2 could induce syncytial cytopathic effects similar to those of the parent virus. Growth curves showed that the recombinant virus and the parent virus had similar growth characteristics, both reaching peak viral load at 72 hours. The peak titer of the recombinant virus was not significantly different from that of the parent virus, both exceeding 10. 5.0 TCID 50 / mL

[0156] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present application, and are not intended to limit the present application; although the present application has been described in detail with reference to the above embodiments, those skilled in the art should understand that the technical solutions recorded in the above embodiments can be modified, or some or all of the technical features can be replaced by equivalents; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present application.

Claims

1. A method for constructing a recombinant canine distemper virus strain expressing mink parvovirus VP2 protein, characterized in that, The construction method includes: (A) Construction of infectious viral clones: The encoding nucleotides of the VP2 protein of mink parvovirus SD-4 strain were obtained by PCR amplification, and then cloned into the pCR-rCDV3 recombinant plasmid to construct the pCR-rCDV3-mVP2 recombinant plasmid. The nucleotide sequence encoding the VP2 protein is shown in SEQ ID NO. 1; The pCR-rCDV3 recombinant plasmid sequences are as shown in SEQ ID NO. 4~10, and the sequences are added together sequentially. (B) Virus Rescue: BSR cells expressing T7 RNA polymerase were co-transfected with the pCR-rCDV3-mVP2 recombinant plasmid and helper plasmid, and then co-incubated with susceptible cells to obtain a recombinant canine distemper virus strain.

2. The method for constructing a recombinant canine distemper virus strain expressing mink parvovirus VP2 protein according to claim 1, characterized in that, The pCR-rCDV3-mVP2 plasmid has MluⅠ and BssHII restriction sites added to both ends of the nucleotide sequence encoding the mink parvovirus VP2 protein, and a Kozak sequence added to the 5' end.

3. The method for constructing a recombinant canine distemper virus strain expressing mink parvovirus VP2 protein according to claim 1, characterized in that, The primer sequences for amplifying the encoding nucleotides of the mink parvovirus VP2 protein in step (A) include: The nucleotide sequence is as shown in the forward primer of SEQ ID NO. 2; and, the reverse primer with the nucleotide sequence shown in SEQ ID NO.

3.

4. The method for constructing a recombinant canine distemper virus strain expressing mink parvovirus VP2 protein according to claim 1, characterized in that, The helper plasmid in step (B) includes: pCAGGS-N, pCAGGS-P and pCAGGS-L.

5. The method for constructing a recombinant canine distemper virus strain expressing mink parvovirus VP2 protein according to claim 1, characterized in that, In step (B), the competent cells co-transfected are BSR cells expressing T7 polymerase.

6. The method for constructing a recombinant canine distemper virus strain expressing mink parvovirus VP2 protein according to claim 1, characterized in that, In step (B), the susceptible cells are Vero cells (VerodogSLAM cells) that express the canine SLAM receptor.

7. A recombinant canine distemper virus strain expressing mink parvovirus VP2 protein, characterized in that, The recombinant canine distemper virus strain is mainly prepared by the method for constructing a recombinant canine distemper virus strain expressing mink parvovirus VP2 protein as described in any one of claims 1 to 6.

8. The use of a recombinant canine distemper virus strain obtained by the construction method according to any one of claims 1 to 6 in the preparation of a recombinant canine distemper virus or mink parvovirus vaccine.

Images