DNA aptamer specifically recognizing mCRP and application thereof

By using SELEX technology to screen DNA aptamers that specifically recognize mCRP, the shortcomings of existing technologies in recognizing and blocking mCRP are overcome, enabling specific detection and therapeutic applications of mCRP, which is suitable for the treatment of CRP-related diseases.

CN116144666BActive Publication Date: 2026-07-21SHENZHEN LINGGENE BIOTECH CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202310032169.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-01-09
Publication Date
2026-07-21
Estimated Expiration
2043-01-09

AI Technical Summary

Technical Problem

Currently, there is no DNA aptamer that can specifically recognize monomeric CRP (mCRP). RNA aptamers are expensive and unstable, cannot distinguish between mCRP and pentameric CRP (nCRP), and there is no evidence that they can block the function of mCRP.

Method used

DNA aptamers that specifically recognize mCRP were screened using SELEX technology, including the sequences shown in SEQ ID NO:1-4 and their derivatives. These aptamers have the function of specifically recognizing mCRP and their stability and functionality can be improved through modification.

Benefits of technology

It enables the specific identification and detection of mCRP, which can be used for the purification, in vivo imaging and diagnosis of mCRP, and can block the pathological function of mCRP for the treatment of CRP-related diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0004045754340000011
    Figure HDA0004045754340000011
  • Figure HDA0004045754340000012
    Figure HDA0004045754340000012
  • Figure HDA0004045754340000021
    Figure HDA0004045754340000021
Patent Text Reader

Abstract

The application screens a group of DNA aptamers capable of specifically recognizing mCRP through SELEX technology. Compared with RNA aptamers, the DNA aptamers have the advantages of low cost, in-vivo stability and difficulty in degradation, and are more suitable for in-vivo application. The DNA aptamers capable of specifically recognizing mCRP can be used for capturing mCRP from a complex system, realizing detection, purification, in-vivo imaging and diagnosis, drug delivery and the like of mCRP. Further, the DNA aptamers in the group can block the pathological function of mCRP, and are further used for treating CRP-related diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of DNA aptamers, and more specifically, to a DNA aptamer that specifically recognizes mCRP and its applications. Background Technology

[0002] C-reactive protein (CRP) is an acute-phase reactive protein synthesized in response to inflammation, infection, and tissue damage, stimulated by cytokines such as IL-6. The liver is the primary site of synthesis, with smaller amounts also expressed in lymphocytes, endothelial cells, and monocytes. For many years, CRP has been simply considered a marker of inflammatory responses and widely used in the clinical diagnosis of autoimmune diseases, infectious diseases, and cardiovascular diseases. However, in recent years, CRP has been increasingly found to participate in the development and progression of various diseases, such as rheumatoid arthritis, atherosclerosis, and Alzheimer's disease, and has been proposed as a potential therapeutic target.

[0003] After being synthesized in the body, CRP is secreted into the bloodstream as a pentamer, known as native CRP (nCRP). nCRP irreversibly dissociates into monomeric CRP (mCRP) upon entering the inflammatory microenvironment or at the site of tissue damage. Currently, increasing evidence suggests that mCRP is the direct form in which CRP exerts its pathological functions. For example, studies have shown that mCRP can stimulate RANKL expression and promote osteoclast differentiation, while nCRP has no effect on osteoclast differentiation; mCRP promotes chemokine expression and recruits monocytes; mCRP can induce the expression of inflammatory factors and matrix-degrading enzymes in chondrocytes; mCRP can activate complement, stimulate endothelial cells, neutrophils, synovial fibroblasts, and platelets, leading to the release of pro-inflammatory cytokines, etc. Currently reported small-molecule CRP inhibitors include 1,6-bis-choline-hexane (1,6-bis-PC), whose mechanism of action is to inhibit the dissociation of nCRP into mCRP. However, the short half-life of 1,6-bis-PC in animal models, its low affinity for CRP, and the fact that its pharmacokinetic parameters still need improvement limit its clinical application prospects.

[0004] Aptamers are single-stranded oligonucleotides (DNA or RNA) that can fold themselves into higher-order structures to specifically bind to a target. Aptamers are primarily obtained through Systematic Evolution of Ligandsby Exponential Enrichment (SELEX) screening. This technique works by synthesizing a single-stranded DNA or RNA library in vitro. This library is incubated with a target substance, and sequences that do not bind to the target substance are washed away. Sequences that bind to the target substance are then isolated, amplified by PCR, and separated into single strands – this is positive selection. The sequences enriched in the positive selection are then incubated with a control substance, sequences that bind to the control substance are removed, and sequences that do not bind to the control substance are collected. These sequences are then amplified by PCR and separated into single strands – this is negative selection. Repeating these positive and negative selection processes multiple times allows sequencing to obtain aptamers that specifically bind to the target substance. Aptamers work similarly to antibodies, but their advantages include ease of screening, chemical synthesis, simple modification, low cost, low toxicity, and convenient storage. Aptamers can be used as targeted ligands to achieve target detection and purification, disease diagnosis, imaging and in vivo drug delivery, or they can block the function of target proteins, thus becoming aptamers with therapeutic potential.

[0005] In 2011, a research team screened RNA aptamers that could specifically bind to mCRP. However, the drawback was that the aptamer had no ability to recognize nCRP, and there was no evidence that the RNA aptamer could block the function of mCRP. In addition, RNA aptamers are expensive, have poor serum stability, and are easily degraded by nucleases in vivo, making them unsuitable for in vivo application.

[0006] In 2017 and 2020, research teams screened DNA aptamers that could recognize nCRP. However, the drawback was that the aptamer could not distinguish between mCRP and nCRP, and there was no evidence that the DNA aptamer could block the function of mCRP.

[0007] Creative Biolabs offers a variety of commercially available CRP-specific RNA aptamers, but their drawback is that these aptamers are RNA molecules that can only recognize nCRP and cannot distinguish between mCRP and nCRP. There is no evidence that these RNA aptamers can block the function of mCRP. Summary of the Invention

[0008] The technical problem this invention aims to solve is to address the current deficiency in existing technologies where there are no DNA aptamers that can specifically recognize mCRP, by providing a set of DNA aptamers that can specifically recognize mCRP. Compared to RNA aptamers, DNA has advantages such as low cost, in vivo stability, and resistance to degradation, making it more suitable for in vivo applications.

[0009] A first aspect of the present invention provides a DNA aptamer that specifically recognizes mCRP, comprising at least one of the following sequences:

[0010] (1) The sequence shown in SEQ ID NO:1 or a derivative thereof;

[0011] (2) The sequence shown in SEQ ID NO:2 or a derivative thereof;

[0012] (3) The sequence shown in SEQ ID NO:3 or its derivatives;

[0013] (4) The sequence shown in SEQ ID NO:4 or its derivatives;

[0014] Among them, SEQ ID NO:1:CGAGCCCGAGGTCCATGGGCCGAATGCGAA

[0015] SEQ ID NO:2:TTGCGGATTCCGGGATACCACCTGGAATCC

[0016] SEQ ID NO:3:CCAATGGCCCTAGGGCTTGCAAATCGCTGCC

[0017] SEQ ID NO:4:TTGACCCTTTAAGGTCGTCCGAAACGGGC.

[0018] Preferably, the derivative includes: a derivative obtained by modifying at least one base of the sequence shown in SEQ ID NO:1, a derivative obtained by modifying at least one base of the sequence shown in SEQ ID NO:2, a derivative obtained by modifying at least one base of the sequence shown in SEQ ID NO:3, a derivative obtained by modifying at least one base of the sequence shown in SEQ ID NO:4, a sequence with more than 60% homology to the sequence shown in SEQ ID NO:1, a sequence with more than 60% homology to the sequence shown in SEQ ID NO:2, a sequence with more than 60% homology to the sequence shown in SEQ ID NO:3, a sequence with more than 60% homology to the sequence shown in SEQ ID NO:4, a sequence with more than 60% homology to the sequence shown in SEQ ID NO:1, a sequence with more than 60% homology to the sequence shown in SEQ ID NO:2, a sequence with more than 60% homology to the sequence shown in SEQ ID NO:3, a sequence with more than 60% homology to the sequence shown in SEQ ID NO:4, a sequence that hybridizes with the sequence shown in SEQ ID NO:1 under stringent conditions, and a sequence that hybridizes with the sequence shown in SEQ ID NO:4 under stringent conditions. The sequence that hybridizes with the sequence shown in SEQ ID NO:2, the sequence that hybridizes with the sequence shown in SEQ ID NO:3 under stringent conditions, the sequence that hybridizes with the sequence shown in SEQ ID NO:4 under stringent conditions, the thiophosphate backbone sequence derived from the backbone of the sequence shown in SEQ ID NO:1, the thiophosphate backbone sequence derived from the backbone of the sequence shown in SEQ ID NO:2, the thiophosphate backbone sequence derived from the backbone of the sequence shown in SEQ ID NO:3, the thiophosphate backbone sequence derived from the backbone of the sequence shown in SEQ ID NO:4, the peptide nucleic acid modified from the sequence shown in SEQ ID NO:1, the peptide nucleic acid modified from the sequence shown in SEQ ID NO:2, the peptide nucleic acid modified from the sequence shown in SEQ ID NO:3, or the peptide nucleic acid modified from the sequence shown in SEQ ID NO:4;

[0019] The derivatives mentioned above all have the function of specifically recognizing mCRP.

[0020] Preferably, the modification of the at least one base includes phosphorylation, methylation, amination, thiolation, or isotopization. Preferably, the functional group includes at least one of a fluorescent group, a radioactive group, a therapeutic drug, biotin, digoxigenin, a luminescent nanomaterial, a nucleic acid substance, or an enzyme label.

[0021] In this invention, any known method and any known functional group can be used to modify the sequences shown in SEQ ID NO:1-4 and to connect functional groups, as long as it does not affect the performance of the obtained sequences. That is, the derivatives obtained by modifying or connecting functional groups to the sequences shown in SEQ ID NO:1-4 will not lose their basic function, namely, specific recognition of mCRP. For example, the 3' or 5' end of the sequences shown in SEQ ID NO:1-4 can be modified or functional groups can be connected. These modifications or functional groups can be used to improve the stability of the aptamer, provide a detection signal, or connect the aptamer to other substances to form a composition.

[0022] Preferably, the sequence having more than 60% homology with the sequence shown in SEQ ID NO:1 may include DNA sequences having 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology with the sequence shown in SEQ ID NO:1 and capable of specifically recognizing mCRP. Similarly, the sequence having more than 60% homology with the sequence shown in SEQ ID NO:2 may include DNA sequences having 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology with the sequence shown in SEQ ID NO:2 and capable of specifically recognizing mCRP. Sequences with more than 60% homology to the sequence shown in SEQ ID NO:3 may include DNA sequences with homology of 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% to the sequence shown in SEQ ID NO:3 and capable of specifically recognizing mCRP. Sequences with more than 60% homology to the sequence shown in SEQ ID NO:4 may include DNA sequences with homology of 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% to the sequence shown in SEQ ID NO:4 and capable of specifically recognizing mCRP.

[0023] Phosphothiophosphate modification is the simplest and most widely used chemical modification for increasing nuclease resistance. Unmodified nucleic acid aptamers can exhibit activity, but they are rapidly degraded by nucleases, thus limiting their effectiveness. In the phosphate backbone of oligonucleotides, thiophosphate bonds replace non-bridging oxygen atoms with sulfur atoms, making the internucleotide bonds more resistant to nuclease degradation and thus more stable.

[0024] Peptide nucleic acids (PNAs) are a class of DNA analogs in which the sugar-phosphate backbone is replaced by a polypeptide backbone. The neutral peptide chain amide-aminoethylglycine bond replaces the pentose phosphate-diester bond backbone in DNA, while the rest is identical to DNA. PNAs can recognize and bind to DNA or RNA sequences via Watson-Crick base pairing, forming a stable double helix structure. They exhibit high hybridization stability, excellent specific sequence recognition ability, are not hydrolyzed by nucleases and proteases, and can be co-transfected into cells with ligands.

[0025] In this invention, the above-mentioned thiophosphate backbone sequence and peptide nucleic acid can be prepared using the sequences shown in SEQ ID NO:1 to 4 according to conventional methods in the art.

[0026] In this invention, the aforementioned DNA aptamer that specifically recognizes mCRP can specifically recognize mCRP, and is therefore used for mCRP detection, purification, in vivo imaging and diagnosis, drug delivery, etc.

[0027] Therefore, a second aspect of the present invention relates to the application of the aforementioned DNA aptamers that specifically recognize mCRP in the detection, purification, in vivo imaging and diagnosis, and drug delivery of mCRP.

[0028] A third aspect of the present invention provides a product for detecting mCRP, the product containing the aforementioned DNA aptamer that specifically recognizes mCRP.

[0029] A fourth aspect of the present invention provides a DNA aptamer that specifically recognizes mCRP, characterized in that it comprises the sequence shown in SEQ ID NO:3 or a derivative thereof; wherein, SEQ ID NO:3:CCAATGGCCCTAGGGCTGCAAATCGCTGCC.

[0030] Preferably, the derivative includes: a derivative obtained by modifying at least one base of the sequence shown in SEQ ID NO:3; a derivative obtained by linking a functional group to the sequence shown in SEQ ID NO:3; a sequence with more than 60% homology to the sequence shown in SEQ ID NO:3; a sequence that hybridizes with the sequence shown in SEQ ID NO:3 under stringent conditions; a thiophosphate backbone sequence derived from the backbone of the sequence shown in SEQ ID NO:3; or a peptide nucleic acid modified from the sequence shown in SEQ ID NO:3; wherein the derivative has the same function as the sequence shown in SEQ ID NO:3.

[0031] Here, the sequence shown in SEQ ID NO:3 or its derivatives can specifically recognize mCRP, and can be used for mCRP detection, purification, in vivo imaging and diagnosis, drug delivery, etc. On the other hand, it can also block the function of mCRP, becoming a therapeutic aptamer for the treatment of CRP-related diseases.

[0032] Therefore, the fifth aspect of the present invention relates to the use of the aforementioned DNA aptamers that specifically recognize mCRP in the preparation of diagnostic or therapeutic remedies for CRP-related diseases.

[0033] Preferably, the CRP-related diseases include rheumatoid arthritis, osteoarthritis, ankylosing spondylitis, Alzheimer's disease, and atherosclerosis.

[0034] A sixth aspect of the invention provides a medicament comprising the aforementioned DNA aptamer that specifically recognizes mCRP. This medicament can be used to treat CRP-related diseases such as rheumatoid arthritis, osteoarthritis, ankylosing spondylitis, Alzheimer's disease, and atherosclerosis.

[0035] Preferably, a drug combination for treating rheumatoid arthritis includes a disease-modifying antirheumatic drug and the aforementioned DNA aptamer that specifically recognizes mCRP.

[0036] This invention utilizes SELEX technology to screen a group of DNA aptamers that can specifically recognize mCRP. Compared to RNA aptamers, DNA aptamers offer advantages such as lower cost, in vivo stability, and resistance to degradation, making them more suitable for in vivo applications. Furthermore, these DNA aptamers capable of specifically recognizing mCRP can be used to capture mCRP from complex systems, enabling the detection, purification, in vivo imaging and diagnosis of mCRP, and drug delivery. In addition, one group of DNA aptamers, besides possessing the aforementioned functions, can also block the pathological functions of mCRP, thus facilitating the treatment of CRP-related diseases. Attached Figure Description

[0037] The present invention will be further described below with reference to the accompanying drawings and embodiments. In the accompanying drawings:

[0038] Figure 1 This is a flowchart of the SELEX screening process in Embodiment 1 of the present invention, which can specifically recognize DNA aptamers of mCRP.

[0039] Figure 2 This is a diagram showing the binding of SELEX-enriched DNA aptamers that specifically recognize mCRP to mCRP and nCRP in Example 2 of the present invention.

[0040] Figure 3This is a diagram showing the results of mCRP and nCRP binding to SELEX-enriched DNA aptamers that specifically recognize mCRP in Example 2 of the present invention.

[0041] Figure 4 This is a diagram showing the results of the DNA aptamer that can specifically recognize mCRP, obtained in Example 3 of the present invention, binding to mCRP and nCRP.

[0042] Figure 5 This is a diagram showing the results of mCRP and nCRP binding to the DNA aptamers that specifically recognize mCRP obtained through screening in Example 3 of the present invention.

[0043] Figure 6 This is a graph showing the results of ApmCRP3 inhibiting the pro-inflammatory effect of mCRP on chondrocytes in Example 4 of the present invention;

[0044] Figure 7 This is a diagram showing the results of ApmCRP3 reducing the activation of synovial fibroblasts by mCRP in Example 5 of the present invention.

[0045] Figure 8 This is a graph showing the results of how ApmCRP3 can alleviate the disease symptoms of a CIA mouse model in Example 6 of this invention;

[0046] Figures 9A-9D These are schematic diagrams of secondary structure prediction for ApmCRP1, ApmCRP2, ApmCRP3, and ApmCRP4, respectively. Detailed Implementation

[0047] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods. Unless otherwise specified, the experimental materials used in the following embodiments were purchased from conventional biochemical reagent companies.

[0048] This invention uses SELEX (Systematic Evolution of Ligands by Exponential Enrichment) technology to screen a group of DNA aptamers (ApmCRP1, ApmCRP2, ApmCRP3, ApmCRP4) that specifically recognize mCRP.

[0049] ApmCRP1:CGAGCCCGAGGTCCATGGGCCGAATGCGAA

[0050] ApmCRP2:TTGCGGATTCCGGGATACCACCTGGAATCC

[0051] ApmCRP3:CCAATGGCCCTAGGGCTGCAAATCGCTGCC

[0052] ApmCRP4:TTGACCCTTTAAGGTCGTCCGAAACGGGC

[0053] ApmCRP1, ApmCRP2, and ApmCRP4 can specifically recognize mCRP but cannot block its function. These aptamers can be used for the detection, purification, in vivo imaging and diagnosis, and drug delivery of mCRP. The products include kits or detection chips.

[0054] ApmCRP3 can specifically recognize mCRP, and on the one hand, it can be used for the detection, purification, in vivo imaging and diagnosis of mCRP, drug delivery, etc. On the other hand, it can also block the function of mCRP, becoming a therapeutic aptamer for the treatment of CRP-related diseases.

[0055] To screen these aptamers, this invention first synthesizes a DNA library with known sequences at both ends and containing 30 bases in the middle. Using mCRP as the target protein and nCRP as the control protein, SELEX technology is employed to screen for DNA aptamers with high specificity. The secondary structure of the aptamers is predicted using the structure prediction software mfold, and the binding of the aptamers to the target protein is identified using PCR and magnetic bead enrichment techniques. Real-time quantitative PCR is used to detect the pro-inflammatory effects of the aptamers on chondrocytes and their activation effects on synovial fibroblasts. The therapeutic effects of the aptamers on CRP-related diseases such as rheumatoid arthritis are tested using a collagen-induced arthritis (CIA) mouse model.

[0056] Example 1: DNA aptamers that can specifically recognize mCRP can be screened by SELEX.

[0057] The initial random single-stranded DNA library was chemically synthesized, and its sequence is as follows:

[0058] TAGGGAAGAGAAGGACATATGAT-N(30)-TTGACTAGTACATGACCAC TTGA; where N(30) is 30 random oligonucleotides.

[0059] Primer P1: 5'-TAGGGAAGAGAAGGACATATGAT-3'

[0060] Primer P2: 5'-phosphorylation-TCAAGTGGTCATGTACTAGTCAA-3'

[0061] Here, the aforementioned library and primers P1 and P2 can be synthesized by Shanghai Sangon Biotech Co., Ltd. In the positive screening, 50 pmol of mCRP protein containing a 6×His tag was added to 1 nmol of the library and incubated at 25°C for 1 h. Then, 50 μl of His Mag magnetic beads were added and incubated at 25°C for 30 min. The magnetic beads were washed three times with 1 ml of washing buffer (140 mM NaCl, 2.5 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4, 5 mM MgCl2, 5 mM imidazole, 0.02% Tween 20). 50 μl of 500 mM imidazole was added to the magnetic beads, and the mixture was incubated at room temperature for 1 min. The supernatant was collected. Six cycles of pre-amplification were performed in a 500 μl PCR system. Subsequently, a cycle number gradient experiment was used to determine the optimal number of cycles for amplification. Using a portion of the pre-amplified product as a template, four 50 μl PCR systems were prepared, and amplification was performed for 6, 9, 12, and 15 cycles, respectively. PCR products were subjected to electrophoresis. The optimal cycle number was selected, and the selected products were amplified to prepare double strands. The amplified products were purified and quantified using Nanodrop. 5 μl of 10× digestion buffer and 1 μl of lambda exonuclease were added to every 2 μg of product, and water was added to bring the volume to 50 μl. The mixture was digested at 37°C for 30 min, and the resulting single-stranded DNA was used for negative selection. In negative selection, 100 pmol of nCRP protein containing a 6× His tag was added to 1 nmol of the above single-stranded DNA, and the mixture was incubated at 25°C for 1 h. Then, 50 μl of His Mag beads were added, and the mixture was incubated at 25°C for 30 min. The supernatant was collected. The same PCR pre-amplification was performed, and the optimal cycle number was selected. The selected products were amplified, purified, quantified, and prepared into single strands. The above process was repeated for 16 rounds. The PCR products from the last round were cloned and sequenced (see...). Figure 1 Through screening, a set of mCRP-specific DNA aptamers (ApmCRP1, ApmCRP2, ApmCRP3, and ApmCRP4) were obtained. The secondary structures of ApmCRP1, ApmCRP2, ApmCRP3, and ApmCRP4 were predicted using the structure prediction software mfold, and the results are as follows: Figures 9A-9D As shown, ApmCRP1, ApmCRP2, ApmCRP3, and ApmCRP4 form special stem-ring and hairpin structures, respectively, with Gibbs free energies (ΔG) of -3.59, -8.13, -4.62, and -5.63, respectively.

[0062] In a further preferred embodiment of the present invention, at least one base of the obtained mCRP-specific DNA aptamers ApmCRP1, ApmCRP2, ApmCRP3, and ApmCRP4 can be phosphorylated, methylated, aminated, thiolated, or isotopized to obtain their derivatives.

[0063] In a further preferred embodiment of the present invention, functional groups, such as fluorescent groups, radioactive groups, therapeutic drugs, biotin, digoxigenin, nanoluminescent materials, nucleic acid substances, or enzyme markers, can be attached to any position of the obtained mCRP-specific DNA aptamers ApmCRP1, ApmCRP2, ApmCRP3, and ApmCRP4. For example, different chemical groups can be modified at the ends of ApmCRP1, ApmCRP2, ApmCRP3, and ApmCRP4 to connect them to drug carriers, thus preparing drug delivery systems with different functions. For example, ApmCRP1, ApmCRP2, ApmCRP3, and ApmCRP4 can be connected to polymers, inorganic nanoparticles, dendritic molecules, liposomes, and micelles to form different drug delivery systems. In addition, ApmCRP1, ApmCRP2, ApmCRP3, and ApmCRP4 can also be attached to various markers for the detection and identification of sample cells, tissues, or biomolecules. Alternatively, the markers can be attached to the 5′ and / or 3′ ends of ApmCRP1, ApmCRP2, ApmCRP3, and ApmCRP4 before being introduced into the sample to be tested. Various methods can be used to detect the binding of the aptamers to the sample, such as flow cytometry and confocal microscopy to detect fluorescently labeled nucleic acid aptamers, and immunochemiluminescence detection to detect digoxigenin-labeled aptamers. This makes it suitable for a variety of detection methods and systems. Furthermore, embedding drug molecules into ApmCRP1, ApmCRP2, ApmCRP3, and ApmCRP4 is a simple and effective targeted drug delivery method. Drugs can also be chemically modified to form stable esters, amines, and disulfide bonds that bind to the aptamers, or they can be covalently bound via linkers.

[0064] In a further preferred embodiment of the present invention, based on the obtained mCRP-specific DNA aptamers ApmCRP1, ApmCRP2, ApmCRP3, and ApmCRP4, a DNA sequence with homology of more than 60%, for example, homology of 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99%, and capable of specifically recognizing mCRP, can be obtained.

[0065] In a further preferred embodiment of the present invention, sequences that can be hybridized to the obtained mCRP-specific DNA aptamers ApmCRP1, ApmCRP2, ApmCRP3, and ApmCRP4 under stringent conditions can be obtained.

[0066] In a further preferred embodiment of the present invention, for the obtained mCRP-specific DNA aptamers ApmCRP1, ApmCRP2, ApmCRP3, and ApmCRP4, phosphate thioester backbone sequences derived from their backbones or modified peptide nucleic acids can be obtained.

[0067] Here, those skilled in the art can obtain derivatives of the aforementioned mCRP-specific DNA aptamers ApmCRP1, ApmCRP2, ApmCRP3, and ApmCRP4 using any known methods in the art, and these all fall within the protection scope of this invention.

[0068] Example 2: SELEX-enriched DNA sequences can specifically bind to mCRP.

[0069] 100 pmol of DNA sequences enriched in rounds 4, 8, 12, and 16 were collected, and 25 pmol of 6×His-tagged mCRP and nCRP proteins were added respectively. The mixtures were incubated at 25°C for 1 h. Then, 25 μl of His Mag magnetic beads were added, and the mixture was incubated at 25°C for 30 min. The magnetic beads were washed three times with 1 ml of washing buffer (140 mM NaCl, 2.5 mM KCl, 10 mM Na₂HPO₄, 2 mM KH₂PO₄, 5 mM MgCl₂, 5 mM imidazole, 0.02% Tween 20) each time. 25 μl of 500 mM imidazole was added to the magnetic beads, and the mixture was incubated at room temperature for 1 min. The supernatant was collected. PCR amplification was performed using the primers listed below. The amplification products were subjected to nucleic acid electrophoresis, and the band brightness was quantified using Quantity One software.

[0070] Primer P1: 5'-TAGGGAAGAGAAGGACATATGAT-3'

[0071] Primer P3: 5'-TCAAGTGGTCATGTACTAGTCAA-3'

[0072] Here, primers P3 and P4 were synthesized by Shanghai Sangon Biotech Co., Ltd. The results showed that the binding of the DNA sequences enriched during the screening process to mCRP increased with the number of screening rounds, but there was no significant binding to nCRP (see...). Figure 2 ).

[0073] The DNA sequences enriched in rounds 4, 8, 12, and 16 were amplified by PCR using the following primers. The amplified products were purified and quantified using Nanodrop. 5 μl of 10× digestion buffer and 1 μl of lambda exonuclease were added to every 2 μg of product, and water was added to bring the volume to 50 μl. The mixture was digested at 37°C for 30 min to obtain biotin-labeled single-stranded DNA. 200 pmol of biotin-labeled single-stranded DNA was incubated with 50 pmol of mCRP protein containing a 6× His tag at 25°C for 1 h. Magnetic beads (Streptavidin MagSepharose) were used. TM GE Healthcare performed magnetic bead enrichment experiments on DNA, detected mCRP bound to DNA by electrophoresis, and quantified the bands using Quantity One software.

[0074] Primer P4: 5'-biotin-TAGGGAAGAGAAGGACATATGAT-3'

[0075] Primer P2: 5'-phosphorylation-TCAAGTGGTCATGTACTAGTCAA-3'

[0076] The results showed that the binding of mCRP to the enriched DNA sequences increased with the number of screening rounds, but nCRP did not bind significantly to the enriched DNA sequences (see...). Figure 3 ).

[0077] Example 3: The DNA aptamers (ApmCRP1-4) obtained by screening specifically bind to mCRP.

[0078] Take 200 pmol of ApmCRP1, ApmCRP2, ApmCRP3, and ApmCRP4, and add 50 pmol of 6×His-tagged mCRP and nCRP proteins respectively, and incubate at 25°C for 1 h. Then add 50 μl of His Mag magnetic beads and incubate at 25°C for 30 min. Wash the magnetic beads three times with washing buffer (140 mM NaCl, 2.5 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4, 5 mM MgCl2, 5 mM imidazole, 0.02% Tween 20), 1 ml each time. Add 25 μl of 500 mM imidazole to the magnetic beads, incubate at room temperature for 1 min, and collect the supernatant. Perform nucleic acid electrophoresis at 95°C for 10 min, and quantify the band brightness using Quantity One software.

[0079] The results showed that ApmCRP1, ApmCRP2, ApmCRP3, and ApmCRP4 could all bind to mCRP, but showed no significant binding to nCRP (see...). Figure 4 ).

[0080] 200 pmol of biotin-labeled ApmCRP1, ApmCRP2, ApmCRP3, and ApmCRP4 were added, and 50 pmol of 6×His-tagged mCRP and nCRP proteins were added respectively. The mixtures were incubated at 25°C for 1 h. Magnetic beads (Streptavidin Mag Sepharose) were used. TM GE Healthcare performed magnetic bead enrichment experiments on DNA, and protein electrophoresis was used to detect mCRP bound to DNA. The bands were quantified using Quantity One software. The results showed that mCRP could bind to ApmCRP1, ApmCRP2, ApmCRP3, and ApmCRP4, but nCRP did not show significant binding to ApmCRP1, ApmCRP2, ApmCRP3, and ApmCRP4 (see...). Figure 5 ).

[0081] Therefore, ApmCRP1, ApmCRP2, ApmCRP3, and ApmCRP4 are mCRP-specific DNA aptamers, but not specific to nCRP.

[0082] Because ApmCRP1, ApmCRP2, ApmCRP3, and ApmCRP4 can specifically recognize mCRP, these aptamers can be used for mCRP detection, purification, in vivo imaging and diagnosis, drug delivery, and more.

[0083] For example, after modification, ApmCRP1, ApmCRP2, ApmCRP3, and ApmCRP4 can be directly detected using various methods. For instance, flow cytometry and confocal microscopy can be used to detect the fluorescently labeled ApmCRP1, ApmCRP2, ApmCRP3, and ApmCRP4; IVIS in vivo imaging systems can be used to detect the in vivo distribution of ApmCRP1, ApmCRP2, ApmCRP3, and ApmCRP4; and immunochemiluminescence immunoassay can be used to detect digoxigenin-labeled ApmCRP1, ApmCRP2, ApmCRP3, and ApmCRP4. Therefore, ApmCRP1, ApmCRP2, ApmCRP3, and ApmCRP4 are suitable for various detection methods and kits for the detection, purification, in vivo imaging, and diagnosis of mCRP.

[0084] For example, drugs can be embedded into ApmCRP1, ApmCRP2, ApmCRP3, and ApmCRP4 to achieve drug delivery. These embedding conditions are typically mild and do not require any chemical modification of the drug or ligand. Both the drug and the nucleic acid aptamer retain their biological activity, and high drug loading can be achieved. Drugs can also be chemically modified to form stable esters, amines, and disulfide bonds to attach to the aptamer, or covalently bound via linkers.

[0085] Example 4: ApmCRP3 can inhibit the pro-inflammatory effect of mCRP on chondrocytes.

[0086] The mouse chondrocyte cell line ATDC5 was seeded in 6-well plates at a cell density of 5 × 10⁶ cells / well. 5 / well, ATDC5 cells were stimulated with 50 μg mCRP, and 400 nM ApmCRP1, ApmCRP2, ApmCRP3, and ApmCRP4 were added simultaneously. After 24 h, real-time quantitative PCR was performed to analyze the expression of inflammatory factors IL-6 and IL-8 and matrix-degrading enzyme MMP13. The results showed that mCRP promoted the expression of inflammatory factors and matrix-degrading enzymes. ApmCRP3 could inhibit the pro-inflammatory effect of mCRP, while ApmCRP1, ApmCRP2, and ApmCRP4 could not inhibit the pro-inflammatory effect of mCRP (see...). Figure 6 ).

[0087] Therefore, ApmCRP3 can block the function of mCRP, thus becoming a therapeutic aptamer for the treatment of CRP-related diseases. These diseases include, but are not limited to, rheumatoid arthritis, osteoarthritis, ankylosing spondylitis, Alzheimer's disease, and atherosclerosis.

[0088] Example 5: ApmCRP3 can reduce the activation of synovial fibroblasts by mCRP.

[0089] HFLS synovial fibroblasts from rheumatoid arthritis patients were seeded in 6-well plates at a cell density of 5 × 10⁻⁶ cells / well. 5 / well, while activating HFLS with 50μg mCRP, add 400nM ApmCRP1, ApmCRP2, ApmCRP3, and ApmCRP4. After 24h, perform real-time quantitative PCR to detect and analyze the expression of inflammatory factors IL-6 and IL-1β and matrix degrading enzyme MMP3.

[0090] The results showed that mCRP promoted the expression of inflammatory factors and matrix-degrading enzymes, thus activating synovial fibroblasts. ApmCRP3 could reduce the activation of synovial fibroblasts by mCRP, while ApmCRP1, ApmCRP2, and ApmCRP4 could not reduce the activation of synovial fibroblasts by mCRP (see...). Figure 7 ).

[0091] Therefore, ApmCRP3 can block the function of mCRP, thus becoming a therapeutic aptamer for the treatment of CRP-related diseases. These diseases include, but are not limited to, rheumatoid arthritis, osteoarthritis, ankylosing spondylitis, Alzheimer's disease, and atherosclerosis.

[0092] Example 6: ApmCRP3 can alleviate disease symptoms in a CIA mouse model.

[0093] Rheumatoid arthritis (RA) is a CRP-related disease, and commonly used medications are disease-modifying antirheumatic drugs (DMARDs), such as the TNFα inhibitor Enbrel (Etanercept for injection). However, 40-50% of the population does not respond to DMARDs. Collagen-induced arthritis (CIA) is a commonly used animal model for RA, prepared as follows: Bovine type II collagen (2 mg / ml, Chondrex) is emulsified in an equal volume of complete Freund's adjuvant (purchased from Chondrex). The emulsion contains Mycobacterium tuberculosis at a final concentration of 2 mg / kg. 100 μl of the emulsion (containing 100 μg of bovine type II collagen) is administered subcutaneously to the tail root of 6-8 week old male DBA / 1 mice. The severity of arthritis is assessed using an arthritis index score, performed by two independent, blinded observers. The scoring system ranges from 0 to 4 points, with 0 representing no swelling; 1 representing swelling in one joint; 2 representing swelling in more than one joint; 3 representing redness and swelling of the entire paw; and 4 representing deformity and joint stiffness. All four limbs of each mouse are included in the score, with a maximum score of 16 per mouse. After 28 days, mice scoring 1 or higher are considered to have arthritis, or CIA.

[0094] CIA mice were divided into 7 groups and administered 50 μg mCRP intraperitoneally every two weeks, while simultaneously receiving PBS, ApmCRP1, ApmCRP2, ApmCRP3, ApmCRP4, the TNFα inhibitor etanercept, or a combination of ApmCRP3 and etanercept, respectively. The aptamers (ApmCRP1, ApmCRP2, ApmCRP3, and ApmCRP4) were administered at a dose of 20 mg / kg via tail vein, once every 3 days. Etanercept was administered intraperitoneally at a dose of 5 mg / kg, once every 3 days. Treatment lasted for 4 weeks. Arthritis scores were assessed every 7 days during treatment to evaluate efficacy.

[0095] The results showed that ApmCRP3 alleviated disease symptoms in the CIA mouse model, with an effect comparable to that of the positive control TNF inhibitor (etanercept). The combination of ApmCRP3 and ApmCRP4 was superior to either drug alone. ApmCRP1, ApmCRP2, and ApmCRP4 did not alleviate disease symptoms in the CIA mouse model (see...). Figure 8 ).

[0096] Of course, in other preferred embodiments of the present invention, ApmCRP3 can also be used in combination with other disease-modifying antirheumatic drugs, including but not limited to traditional disease-modifying antirheumatic drugs such as methotrexate, leflunomide, hydroxychloroquine, and sulfasalazine; biological disease-modifying antirheumatic drugs such as abatacept, adalimumab, anaerobicin, pecelizumab, etanercept, golimumab, infliximab, rituximab, thalidomide, and tocilizumab; and targeted synthetic disease-modifying antirheumatic drugs such as baricitinib, tofacitinib, and utpatinib.

[0097] ApmCRP3 can also be used in combination with a variety of other medications for treating rheumatoid arthritis, including nonsteroidal anti-inflammatory drugs (NSAIDs) such as ibuprofen, diclofenac, indomethacin, meloxicam, and celecoxib; immunosuppressants such as cyclopropamide, azathioprine, mycophenolate mofetil, and cyclosporine; and glucocorticoids such as prednisone, prednisone, and triamcinolone.

[0098] Although the present invention has been described through specific embodiments, those skilled in the art will understand that various modifications and equivalent substitutions can be made to the invention without departing from its scope. Furthermore, various modifications can be made to the invention for specific situations or materials without departing from its scope. Therefore, the present invention is not limited to the specific embodiments disclosed, but should include all embodiments falling within the scope of the claims.

[0099] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A pharmaceutical combination for treating rheumatoid arthritis, characterized in that, This includes disease-modulating antirheumatic drugs and DNA aptamers that specifically recognize mCRP; The DNA aptamer that specifically recognizes mCRP is the sequence shown in SEQ ID NO:

3.

2. The pharmaceutical combination for treating rheumatoid arthritis according to claim 1, characterized in that, The disease-modifying antirheumatic drugs mentioned include the TNFα inhibitor Enbrel.

3. The pharmaceutical combination for treating rheumatoid arthritis according to claim 1, characterized in that, The disease-modifying antirheumatic drugs mentioned include methotrexate, leflunomide, hydroxychloroquine, and sulfasalazine.

4. The pharmaceutical combination for treating rheumatoid arthritis according to claim 1, characterized in that, The disease-modifying antirheumatic drugs mentioned include abatacept, adalimumab, anaerobicin, pecelizumab, etanercept, golimumab, infliximab, rituximab, thalidomide, and tocilizumab.

5. The pharmaceutical combination for treating rheumatoid arthritis according to claim 1, characterized in that, The disease-modifying antirheumatic drugs mentioned include baricitinib, tofacitinib, and utpatinib.

Citation Information

Patent Citations

  • DNA aptamers for the detection of monomeric crp

    WO2022122966A2