A kind of Acinetobacter strain SXO-2 with phosphorus accumulation function and its application

Abstract

The invention discloses an acinetobacter strain SXO-2 with a phosphorus accumulation function and an application thereof. The strain is a phosphorus accumulation bacterium, and is taxonomically named as acinetobacter (Acinetobacter sp.) SXO-2, and has a preservation number of CGMCC No. 25517, and has been preserved in the China General Microbiological Culture Collection Management Center. The acinetobacter strain SXO-2 is used as a phosphorus accumulation bacterium in biological phosphorus removal of water. The strain is easy to culture and multiply; and has a good phosphorus removal rate, which can reach 75.6-85.28% under suitable conditions, significantly exceeding the phosphorus removal rate of existing phosphorus accumulation bacteria.

Description

Technical Field

[0001] This invention belongs to the field of environmental microbiology technology and relates to an Acinetobacter bacillus strain SXO-2 with polyphosphate-accumulating function and its phosphorus removal application. Background Technology

[0002] Phosphorus is an essential nutrient for plant growth, and phosphorus pollution can lead to eutrophication of water bodies. Therefore, biological phosphorus removal technologies are commonly used to effectively reduce phosphorus levels in water bodies, preventing water quality deterioration and aquatic environmental imbalance. Commonly used biological phosphorus removal processes include A / O, Phostrip, A2O, inverted A2O, and SBR. The microorganisms responsible for phosphorus removal are called polyphosphate-accumulating organisms (PAOs), which are bacteria with anaerobic phosphorus release and aerobic (or anoxic) superphosphate uptake characteristics. Researchers have screened out bacteria with phosphorus accumulation function from environmental media such as soil and water. These bacteria mainly include Acinetobacter, Staphylococcus, Aeromonas, Pseudomonas, Microthrix, and Moraxella Fulton. However, their phosphorus removal efficiency is not high, and their phosphorus removal conditions still need to be optimized.

[0003] The A2O process is a typical wastewater nitrogen and phosphorus removal process, consisting of three reaction zones: anaerobic, anoxic, and aerobic. In the anaerobic zone, polyphosphate-accumulating bacteria hydrolyze intracellular polyphosphates (Poly-P) into orthophosphates, releasing them extracellularly and acquiring energy. They then use this energy to absorb readily degradable COD from the wastewater to synthesize poly(β-hydroxybutyrate) (PHB), an energy storage substance. Under aerobic conditions, polyphosphate-accumulating bacteria use free oxygen as an electron acceptor to oxidize the intracellularly stored PHB. Utilizing the energy generated from this reaction, they excessively absorb phosphates from the wastewater, synthesizing high-energy substances ATP and Poly-P. In this process, aerobic phosphorus uptake exceeds anaerobic phosphorus release, and efficient phosphorus removal is achieved through the discharge of excess sludge. Summary of the Invention

[0004] The present invention addresses the problem of providing a novel Acinetobacter bacterium strain SXO-2 with polyphosphate-accumulating function and its application. This strain is a polyphosphate-accumulating bacterium screened from the sludge of the aerobic tank in the A2O process, and can provide excellent bacterial resources for biological phosphorus removal processes.

[0005] The present invention is achieved using the following technical solution:

[0006] An Acinetobacter sp. strain SXO-2 with polyphosphate-accumulating function has been deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 25517.

[0007] This strain is a Gram-positive bacterium; its cells turn blue after methylene blue staining.

[0008] The strain grows into round, off-white, opaque colonies on solid isolation medium, with a moist, smooth surface and no protrusions.

[0009] The 16S rDNA sequence of this strain is shown in SEQ.ID.NO.1.

[0010] The phosphorus removal rate of this strain is 60.0%–78.1% at pH 6–9, with pH 7 being the optimal phosphorus removal condition.

[0011] The Acinetobacter bacillus strain SXO-2 with polyphosphate-accumulating function is used as a polyphosphate-accumulating bacterium in biological phosphorus removal from water.

[0012] The Acinetobacter strain SXO-2 is used as a polyphosphate-accumulating bacterium in the A2O process.

[0013] The conditions required for the Acinetobacter strain SXO-2 include a pH of 6–9 and a NaAC content of 3–9 g / L.

[0014] The required conditions for the Acinetobacter strain SXO-2 are pH 8.32, NaAC content 6.95 g / L, and trace element content 2.34 mL / L.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] The polyphosphate-accumulating bacteria *Acinetobacter sp. SXO-2* of this invention, isolated from the sludge of the aerobic tank in the A2O process, can effectively reduce the phosphorus content in wastewater, providing an excellent strain resource for the A2O biological phosphorus removal process. This strain exhibits an exponential growth trend in the early stage of cultivation (0–12 h), being in the logarithmic growth phase, with rapid growth and vigorous metabolism. During the 12–20 h static cultivation period, the growth of strain SXO-2 slows down. During the 20–50 h aerobic cultivation period, the growth rate increases compared to the static period, making it easy to cultivate and propagate. Furthermore, it has a good phosphorus removal rate, reaching 75.6–85.28% under suitable conditions, which is already a high level for wild polyphosphate strains and significantly exceeds the phosphorus removal rate of existing polyphosphate-accumulating bacteria.

[0017] Preservation Instructions

[0018] The strain provided in this invention is taxonomically named Acinetobacter sp. SXO-2, with accession number CGMCC No. 25517. It was deposited on August 10, 2022, at the China General Microbiological Culture Collection Center, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The collection center's testing results indicate it is viable. Attached Figure Description

[0019] Figure 1 The colony morphology of strain SXO-2 on solid culture medium;

[0020] Figure 2 Phylogenetic tree of strain SXO-2;

[0021] Figure 3 The growth curve of strain SXO-2;

[0022] Figures 4-1 to 4-3 The figures show the surface plots of the response of strain SXO-2 to phosphorus removal rate under the interaction of two factors. Detailed Implementation

[0023] The present invention will be further explained and described below with reference to the accompanying drawings and embodiments.

[0024] The Acinetobacter bacillus strain SXO-2 with polyphosphate-accumulating capacity provided by this invention is a polyphosphate-accumulating bacterium screened from the sludge of the aerobic tank in the A2O process, which can provide an excellent strain resource for the A2O biological phosphorus removal process. The phosphorus removal conditions of the screened polyphosphate-accumulating bacterium SXO-2 were optimized to obtain the culture conditions under which SXO-2 exerts its maximum phosphorus removal capacity. This has important reference value for the study of polyphosphate-accumulating bacteria characteristics and the improvement of phosphorus removal rate.

[0025] Example 1: Screening and identification of Acinetobacter sp. SXO-2, a polyphosphate-accumulating bacterium

[0026] (1) Source of strain

[0027] The bacterial strains used in this invention are derived from the activated sludge in the aerobic tank of the A2O process.

[0028] The activated sludge was collected on July 23, 2021, from the sewage treatment plant in Suxi Town, Yiwu City.

[0029] (2) Culture medium

[0030] ① Aerobic liquid culture medium (pH=7): KH2PO4, 135-140 mg / L; K2HPO4, 245 mg / L; (NH4)2SO4, 140 mg / L; CaCl2·2H2O, 14 mg / L; MgSO4·7H2O, 180 mg / L; trace element solution, 0.4 ml / L; vitamin solution, 1 ml / L.

[0031] ② Anaerobic liquid culture medium (pH=7): NaAC, 4g / L; (NH4)2SO4, 140mg / L; CaCl2·2H2O, 14mg / L; MgSO4·7H2O, 180mg / L; trace element solution, 0.4ml / L; vitamin solution, 1ml / L.

[0032] ③LB solid medium (pH=7): tryptone, 10 g / L; NaCl, 10 g / L; yeast extract, 5 g / L; agar, 15 g / L.

[0033] ④ Solid separation culture medium (pH=7): NaAC, 4 g / L; KH2PO4, 0.18 g / L; K2HPO4, 0.32 g / L; (NH4)2SO4, 1.5 g / L; CaCl2·2H2O, 0.15 g / L; MgSO4·7H2O, 1.7 g / L; trace element solution, 4 ml; vitamin solution, 10 ml / L; agar, 15 g / L. After sterilization, pour the culture medium onto plates and allow it to cool. Spread 80 μl of 5-bromo-4-chloro-3-indole-phosphate (BCIP) solution (20 mg BCIP dissolved in 1 ml dimethylformamide) onto the plates and allow it to stand for 1.5 h for absorption. Polyphosphate-accumulating bacteria turn blue upon contact with BCIP, which can be used for preliminary screening.

[0034] ⑤ Phosphorus removal capacity test medium (pH=7): NaAC, 5g / L; NH4Cl, 0.4g / L; beef extract, 0.2g / L; tryptone, 0.4g / L; trace element solution, 2ml / L; KH2PO4, 0.1g / L.

[0035] ⑥ Trace element solution: FeCl3·6H2O, 1.5 g / L; H3BO3, 0.15 g / L; CuSO4·5H2O, 0.04 g / L; MgSO4·7H2O, 0.18 g / L; KI, 0.18 g / L; MnCl2·4H2O, 0.13 g / L; Na2MO4·2H2O, 0.06 g / L; ZnSO4·7H2O, 0.12 g / L; CoCl2·6H2O, 0.15 g / L.

[0036] ⑦ Vitamin solution: Vitamin B1, 50 mg / L; Vitamin B2, 50 mg / L; Vitamin B6, 100 mg / L; Vitamin B12, 2 mg / L; Folic acid, 10 mg / L; Niacin, 50 mg / L; Calcium pantothenate, 50 mg / L; Para-aminobenzoic acid, 50 mg / L; Biotin, 21 mg / L;

[0037] All culture media were sterilized at 121°C for 20 min and then cooled to room temperature before use.

[0038] (3) Strain screening

[0039] Centrifuge the original sludge and discard the supernatant; place the precipitate in a 250ml saline bottle containing 100ml of aerobic liquid culture medium and incubate at 30℃ and 120r for 23h with shaking; let stand for 1h, centrifuge at 6000r for 20min, discard the supernatant, transfer the precipitate to a saline bottle containing 100mL of anaerobic liquid culture medium, purge with nitrogen for 10min to ensure dissolved oxygen in the bottle is below 0.1mg·L-1, and incubate at 30℃ for 24h.

[0040] Perform aerobic and anaerobic alternating culture according to the above method until 5 cycles are completed.

[0041] After the cycle was completed, the enriched sludge was centrifuged at 6000 rpm for 20 min, the supernatant was discarded, and the sludge precipitate was washed with sterile water. Then, it was diluted with sterile physiological saline (0.9%) to 10, 2×10, 4×10, and 10⁻⁶ ppm. 2 2×10 2 10 3 10 4 The samples were spread on solid separation medium plates covered with BCIP and incubated at 30°C for 2–3 days until blue colonies appeared.

[0042] Single colonies that turned distinctly blue and exhibited inconsistent morphology were selected and streaked onto BCIP isolation plates in four zones. This process was repeated 3-4 times until colonies on each plate showed a uniform blue color and morphology. The phosphorus removal capacity of the finally screened and purified strains was tested, and one strain exhibiting significant phosphorus accumulation was selected and named SXO-2.

[0043] (4) Strain identification

[0044] Methylene blue staining solution: Methylene blue 1g / L; glacial acetic acid, 50ml / L; 95% ethanol, 50ml / L.

[0045] After screening and purification, the strain was cultured in phosphorus removal capacity test medium at 30℃ and 120 rpm for 24 h, centrifuged at 6000 rpm for 20 min, the supernatant was discarded, the bacterial pellet was washed with sterile water, and the bacterial cells were diluted with 0.2 ml of sterile water. 10 μl of the diluted bacterial solution was smeared and stained with methylene blue for 2 min. After washing off the stain, the bacteria were fixed with an alcohol lamp flame for microscopic examination. The bacteria appeared blue, further confirming that strain SXO-2 is an polyphosphate-accumulating bacterium.

[0046] The strain SXO-2 was identified as a Gram-positive bacterium by Gram staining.

[0047] The genomic DNA of this strain was extracted and used as a template. The 16S rDNA sequence of this strain was obtained by PCR amplification.

[0048] Upstream primer 27F: AGAGTTTGATCCTGGCTCAG

[0049] Downstream primer 1942R: GGTTACCTTGTTACGACTT

[0050] PCR reaction mixture (25 μl):

[0051]

[0052] PCR amplification program: denaturation at 98℃ for 10 s, annealing at 55℃ for 45 s, extension at 72℃ for 1 min; 30 cycles, with a final extension at 72℃ for 4 min. PCR amplification products were detected by 1% agarose gel electrophoresis.

[0053] Genomic DNA of the strain was extracted and used as a template. The 16S rDNA sequence of the strain was obtained by PCR amplification (as shown in SEQ.ID.NO.1).

[0054] Homology analysis of the 16S rDNA sequence of strain SXO-2 was performed using BLAST in GenBank, and a phylogenetic tree of the strain was constructed using MEGA7 software. Figure 2 The strain was found to have 99% similarity to Acinetobacter sp., thus confirming that SXO-2 belongs to Acinetobacter sp.

[0055] Example 2: Determination of the growth curve of Acinetobacter sp. SXO-2

[0056] Preparation of seed culture: Single colonies of strain SXO-2 grown on LB solid medium were picked and inoculated into LB liquid medium, and cultured at 30℃ and 120 rpm for 24 h. The bacterial culture was then diluted with sterile water to OD. 595 =0.7, to be used.

[0057] Growth curve determination: 2% seed culture was inoculated into a 250ml saline bottle containing 100ml of phosphorus removal capacity testing medium, and aerobically cultured at 30℃ and 120r for 12h, then allowed to stand for 8h, and continued aerobic culture for 40h. OD was measured every 4h. 595 .

[0058] The growth curve of strain SXO-2 was obtained as follows: Figure 3 As shown, this strain exhibited an exponential growth trend in the early stage of cultivation (0–12 h), indicating a rapid growth rate and vigorous metabolism during the logarithmic growth phase. During the static cultivation period of 12–20 h, the growth of strain SXO-2 slowed down. In the aerobic cultivation period of 20–50 h, the growth rate increased compared to the static period, but decreased compared to the early growth stage. After 50 h, the growth rate of strain SXO-2 plateaued, and the OD... 595 It remains basically unchanged, tending towards a period of stability and decline.

[0059] Example 3: Optimization of polyphosphate accumulation conditions for Acinetobacter sp. SXO-2

[0060] Phosphorus removal rate calculation formula: η=(P C -P S ) / P C ×100%, where η is the phosphorus removal rate (%); P C The blank represents the phosphorus concentration (mg / L); P S The phosphorus concentration (mg / L) of the sample.

[0061] (1) The seed liquid of strain SXO-2 was obtained according to the seed liquid preparation method in Example 2.

[0062] (2) Single-factor experiment

[0063] The effects of pH, trace elements, and NaAC content on the phosphorus removal rate of Acinetobacter sp. SXO-2 were investigated. A blank control group without SXO-2 was included in the experiment (the culture medium composition was the same as that used in the phosphorus removal capacity test in Example 1).

[0064] ① Effect of pH on phosphorus removal rate of polyphosphate-accumulating bacteria Acinetobacter sp. SXO-2: The pH of the phosphorus removal capacity test medium was adjusted to 5, 6, 7, 8 and 9 in sequence, while other culture conditions were kept consistent with those of the phosphorus removal capacity test medium in Example 1.

[0065] ② Effect of trace element content on phosphorus removal rate of polyphosphate-accumulating bacteria Acinetobacter sp. SXO-2: The trace element content of the phosphorus removal capacity test medium was 0, 1, 2, 3, and 4 ml / L, respectively, while other culture conditions were kept consistent with the phosphorus removal capacity culture medium composition in Example 1.

[0066] ③ Effect of NaAC content on phosphorus removal rate of Acinetobacter sp. SXO-2: The NaAC content of the phosphorus removal capacity test medium was 3, 5, 7 and 9 g / L respectively, and other culture conditions were kept consistent with those of the phosphorus removal capacity test medium in Example 1.

[0067] 2% seed culture was inoculated into a 250ml saline bottle containing 100ml of phosphorus removal capacity testing medium. It was aerobically cultured at 30℃ and 120r for 12h, then allowed to stand for 8h, and continued aerobic culture for 40h. 5ml of the cultured bacterial solution was taken into a centrifuge tube and centrifuged at 6000r for 20min. The supernatant was filtered through a 0.22μm sterile filter. The phosphorus content was determined using a SpectroDirect spectrophotometer and the matching total phosphorus measurement reagent. The phosphorus removal rate of the strain was calculated according to the phosphorus removal formula for different pH, trace element content, and NaAC content.

[0068] Table 1. Effect of pH value on phosphorus removal rate of strain SXO-2

[0069]

[0070] Table 2. Effects of trace element content on phosphorus removal rate of strain SXO-2

[0071]

[0072] Table 3. Effect of NaAC content on phosphorus removal rate of strain SXO-2

[0073]

[0074] As shown in Table 1, the phosphorus removal rate of strain SXO-2 was low at pH=5. As the pH increased (6-9), the phosphorus removal rate first increased and then decreased. The maximum phosphorus removal rate was 78.1% at pH=7.

[0075] As shown in Table 2, the phosphorus removal rate of strain SXO-2 also showed a trend of first increasing and then decreasing with the increase of trace element content, and the phosphorus removal rate reached the highest of 82.6% when the trace element content was 2 ml / L.

[0076] As shown in Table 3, the phosphorus removal rate of strain SXO-2 reached a maximum of 75.6% when the NaAC concentration was 5 g / L.

[0077] The results showed that pH, trace elements and NaAC content all had a certain impact on the phosphorus removal rate of strain SXO-2, and the phosphorus removal conditions were optimized based on these results.

[0078] (2) Optimization of polyphosphate conditions for strain SXO-2 using response surface methodology

[0079] Response surface methodology was designed using Design Expert 8.0.6.1's Central Composite feature. The phosphorus removal rate (Y) was set as the response value. The pH, trace element content, and NaAC content, which significantly affected the phosphorus removal rate of strain SXO-2, were coded. A represents pH, B represents NaAC content, and C represents trace element content. A total of three factors (A, B, C) with five levels (-1.682, -1, 0, 1, 1.682) were established. The experimental factors and levels are shown in Table 4. Figures 4-1 to 4-3 As shown.

[0080] Culture media (phosphorus content 21.9 mg / L) were prepared under each test condition. A blank group without strain SXO-2 was also set up (the culture medium composition was the same as that for phosphorus removal capacity test in Example 1). The final bacterial solution was obtained according to the culture method in Example 3. The phosphorus content was measured and the phosphorus removal rate was calculated to obtain the response values ​​shown in Table 4.

[0081] Analysis using Design Expert 8.0.6.1 software revealed that the predicted response surface value was highest when pH = 8.32, NaAC content was 6.95 g / L, and trace element content was 2.34 mL / L. Under these conditions, the predicted maximum phosphorus removal rate for strain SXO-2 was 85.28%. This phosphorus removal rate is already quite high for wild-type polyphosphate strains.

[0082] Table 4. Design Factor Levels and Phosphorus Removal Rate of Central Composite Experiment

[0083]

[0084]

[0085] Example 4: Effect of initial phosphorus concentration on phosphorus removal rate of strain SXO-2 under optimal conditions

[0086] To verify the accuracy and applicability of the model, the effect of phosphorus concentration on the phosphorus removal rate of strain SXO-2 under optimal conditions was further investigated. Experimental groups with KH2PO4 concentrations of 0.050, 0.075, 0.100, 0.125, and 0.150 g / L, as well as blank groups without strain SXO-2 at different phosphorus concentrations, were set up. The phosphorus removal rates of strain SXO-2 at different phosphorus concentrations were obtained according to the methods in sections (1) and (2) of Example 2, as shown in Table 5.

[0087] As shown in Table 5, when the phosphorus content of the blank group was 21.6 mg / L, which was similar to the phosphorus content of 21.9 mg / L in the blank group of the partial response surface methodology analysis of Example 2 (2), the phosphorus removal rate of strain SXO-2 was 79.1%, which was higher than the response value in Table 4. This indicates that the phosphorus removal rate of strain SXO-2 was improved after optimization by response surface methodology.

[0088] Table 5. Phosphorus removal rate of strain SXO-2 under different phosphorus contents.

[0089]

[0090] Table 5 shows that the phosphorus removal rate of strain SXO-2 decreases with increasing phosphorus content. When the phosphorus content increases from 16.2 mg / L to 39 mg / L, the phosphorus removal rate drops from 84.0% to 49.6%. Strain SXO-2 was screened from activated sludge in the aerobic tank of the A2O process. After optimization of phosphorus removal conditions, it was found that under optimal pH, trace element content, and NaAC concentration, the phosphorus removal rate decreases with increasing phosphorus content in the wastewater. This indicates that strain SXO-2 is more suitable for phosphorus removal from low-phosphorus wastewater, which is also a characteristic of its practical application. To make strain SXO-2 exhibit better phosphorus removal performance, its growth conditions need to be controlled.

Claims

1. An Acinetobacter bacillus strain SXO-2 with polyphosphate-accumulating function, characterized in that, This strain is an polyphosphate-accumulating bacterium, taxonomically named Acinetobacter sp. SXO-2, with accession number CGMCC No. 25517, and has been deposited at the China General Microbiological Culture Collection Center.

2. The Acinetobacter bacillus strain SXO-2 with polyphosphate function as described in claim 1, characterized in that, This strain is a Gram-positive bacterium; its cells turn blue after methylene blue staining. The strain grows into round, off-white, opaque colonies on solid isolation medium, with a moist, smooth surface and no protrusions.

3. The Acinetobacter bacillus strain SXO-2 with polyphosphate function as described in claim 1, characterized in that, The 16S rDNA sequence of this strain is shown in SEQ.ID.NO.

1.

4. The Acinetobacter bacillus strain SXO-2 with polyphosphate function as described in claim 1, characterized in that, The phosphorus removal rate of this strain is 60.0%–78.1% at pH 6–9, with pH 7 being the optimal phosphorus removal condition.

5. The application of Acinetobacter bacillus strain SXO-2 with polyphosphate-accumulating function as described in claim 1 as a polyphosphate-accumulating bacterium in biological phosphorus removal from water.

6. The application as described in claim 5, characterized in that, Application of Acinetobacter strain SXO-2 as polyphosphate-accumulating bacteria in the A2O process.

7. The application as described in claim 5, characterized in that, The conditions required for Acinetobacter strain SXO-2 include a pH of 6–9 and a NaAC content of 3–9 g / L.

8. The application as described in claim 5 or 7, characterized in that, The conditions required for Acinetobacter strain SXO-2 are pH 8.32, NaAC content 6.95 g / L, and trace element content 2.34 mL / L.