A method for increasing the content of ganoderic triterpenoids

Abstract

A method for increasing the content of ganoderic triterpenoids is to overexpress the SREBP gene in Ganoderma lucidum. The method of the present invention significantly increases the content of triterpenoids in Ganoderma lucidum. Compared with the wild-type Ganoderma lucidum control strain, the contents of total ganoderic acids, lanosterol, and ganoderic acid C2 are significantly increased by 1.87 times, 1.89 times, and 2.75 times respectively, opening up a new way for cultivating new strains of Ganoderma lucidum and having good application and development prospects; the method of the present invention has a simple process and low cost, and is suitable for industrial production.

Description

Technical Field

[0001] The present invention relates to a method for increasing the content of ganoderic triterpenoids, and specifically relates to a method for overexpressing the SREBP gene in Ganoderma lucidum cells by transgenic technology, thereby increasing the content of ganoderic triterpenoids in Ganoderma lucidum. Background Art

[0002] Ganoderma is a precious edible and medicinal fungus. Pharmacological and biochemical studies have shown that ganoderic acids (Gas) are important pharmacological active ingredients in Ganoderma, and are a class of highly oxygenated lanostane-type triterpenoids (Shiao, M.S. Natural products of the medicinal fungus Ganoderma lucidum: occurrence, biological activities, and pharmacological functions. Chem Rec 3, 172 - 80 (2003)). A large number of studies have shown that ganoderic acids have various biological functions, such as cytotoxic effects on various tumor cells in vitro, inhibition of tumor invasion in vivo and in vitro, regulation of osteoclastogenesis, liver protection, anti-human immunodeficiency virus, etc. At present, certain progress has been made in the related research on increasing the yield of ganoderic acids by controlling fermentation strategies, adding chemical inducers, and genetic engineering and other methods.

[0003] In addition to the research on the pharmacological analysis of ganoderic acids and the improvement of the yield of ganoderic acids, some studies have also been carried out on the regulatory mechanism of ganoderic acid biosynthesis. So far, the roles of upstream signaling molecules such as reactive oxygen species, calcium ions, cAMP, and membrane phospholipids in the biosynthesis of ganoderic acids have been preliminarily elucidated. However, the downstream pathways of these known signaling molecules, especially the transcription factors that directly regulate the expression of triterpenoid biosynthesis genes, are still poorly understood for the regulatory mechanism of triterpenoid biosynthesis. Therefore, there is no report on overexpressing the transcription factor that regulates the expression of triterpenoid biosynthesis genes by transgenic technology.

[0004] CN108929884A discloses a method for heterologous biosynthesis of ganoderic acids by synthetic biology means, which is to heterologously express the cytochrome P450 enzyme (CYP) gene related to ganoderic triterpenoid biosynthesis in Saccharomyces cerevisiae cells, and separate, purify, analyze by mass spectrometry and nuclear magnetic resonance, etc. the fermentation products of the transgenic yeast engineering strain to determine that the transgenic yeast can synthesize ganoderic acid Z. However, this technology has not been able to increase the synthesis amount of ganoderic triterpenoids in Ganoderma lucidum cells.

[0005] CN101717782A discloses a method for improving the biological yield and polysaccharide content of Ganoderma lucidum, which transfers the uridine diphosphate glucose pyrophosphorylase gene (OsUgo2) from rice into Ganoderma lucidum cells through agrobacterium-mediated transformation, thereby improving the biological yield and polysaccharide content of Ganoderma lucidum. However, it does not involve the influence on the content of ganoderic triterpenoids.

[0006] Sterol Regulatory Element-Binding Protein (SREBP) is a member of the nuclear transcription factor family and an important regulator of lipid metabolism. It has a basic helix-loop-helix leucine zipper (bHLH-ZIP) structure. In mammals, SREBP directly regulates the expression of key enzyme genes in the sterol metabolism and lipid synthesis pathways, playing an important role in the regulation of sterol metabolism and fatty acid metabolism. Animal cells control the dynamic balance of intracellular lipid and sterol content through the feedback regulation mechanism of SREBP (Horton, J.D., Goldstein, J.L. & Brown, M.S. SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver. J Clin Invest 109, 1125-1131 (2002); Adam et al. The SREBP pathway in Drosophila: regulation by palmitate, not sterols. Dev Cell 2, 229-238 (2002)). In the fungus Aspergillus fumigatus, SREBP can directly regulate ergosterol biosynthesis through 14-α-sterol demethylase and C-4 methylsterol oxidase (Chung, D., Barker, B.M., Carey, C.C., Merriman, B. & Werner, E.R. ChIP-seq and in vivo transcriptome analyses of the Aspergillus fumigatus SREBP SrbA Reveals a new regulator of the fungal hypoxia response and virulence. Plos Pathog 10, e1004487 (2014)).In addition, SREBP can also promote the synthesis of carotenoids and sterols in the MVA pathway (mevalonate pathway) of Xanthophyllomyces dendrorhous (Gutierrez, M.S. et al. Sterol regulatory element-binding protein (Sre1) promotes the synthesis of carotenoids and sterols in Xanthophyllomyces dendrorhous. Front Microbiol 10, 586 (2019)). Studies on overexpression of SREBP have shown that SREBP positively regulates the expression of many sterol synthesis genes in the mammalian MVA pathway, such as 3-hydroxy-3-methylglutaryl coenzyme A reductase (the rate-limiting enzyme for sterol biosynthesis), mevalonate kinase, squalene synthase, and fatty acid synthesis genes such as fatty acid synthase and long-chain fatty acyl elongase (Horton, J.D., Goldstein, J.L. & Brown, M.S. SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver. J Clin Invest 109, 1125-1131 (2002)) (Rawson & Robert, B. The SREBP pathway--insights from Insigs and insects. Nat Rev Mol Cell Bio 4, 631-640 (2003)). However, there is currently no report on the technology related to increasing the content of ganoderic triterpenoids by overexpressing SREBP.

[0007] In summary, there is an urgent need to find a gene and a method to increase the content of ganoderic triterpenoids by overexpressing it in Ganoderma lucidum. Summary of the Invention

[0008] The technical problem to be solved by the present invention is to overcome the above-mentioned defects existing in the prior art and provide a method for increasing the content of triterpenoids in Ganoderma lucidum, which can significantly increase the content of triterpenoids in Ganoderma lucidum, has a simple process, low cost, and is suitable for industrial production.

[0009] The technical solution adopted by the present invention to solve its technical problems is as follows: A method for increasing the content of ganoderic triterpenoids is to overexpress the SREBP gene in Ganoderma lucidum. The inventor of the present invention has found through research that the synthesis of sterols and triterpenoids is both catalyzed upstream of lanosterol, that is, through the MVA pathway. Experiments have proved that the selected SREBP gene in the method of the present invention is the transcription factor that directly regulates the synthesis of triterpenoids in Ganoderma lucidum. The inventor of the present invention used the DAP-Seq technology (DNA affinity purification sequencing) to analyze the SREBP-interacting DNA, and a total of 2,271 SREBP binding sites were obtained; further analyzing the coding genes near the promoter binding sites, a total of 1,144 SREBP potential regulatory target genes were obtained. Functional annotation shows that 5 of the SREBP target genes encode proteins related to terpenoid synthesis, and EMSA was used to verify the interaction between SREBP and the promoter DNA of the target gene. It shows that SREBP is a transcription factor protein that potentially regulates the synthesis of ganoderic triterpenoids.

[0010] Preferably, using the multiple cloning site region, the promoter of the gpd gene cloned from Ganoderma lucidum and the SREBP gene are inserted into the Agrobacterium binary expression vector pCAMBIA1300 to obtain an overexpression vector, denoted as GLgpd-SREBP; using the hygromycin resistance gene as a marker gene, through the Agrobacterium-mediated transformation method, the overexpression vector GLgpd-SREBP is transferred into Ganoderma lucidum protoplast cells to obtain a transgenic Ganoderma lucidum strain with overexpressed SREBP gene. The inventive concept of the method of the present invention is: by using transgenic technology to transfer the regulatory gene SREBP for triterpenoid synthesis into Ganoderma lucidum fungi, and obtaining a transgenic Ganoderma lucidum strain with a steadily increased content of ganoderic triterpenoids, the content of triterpenoids in Ganoderma lucidum can be increased. The GL is Ganoderma lingzhi The abbreviation of.

[0011] Preferably, the nucleotide sequence of the SREBP gene is SEQ ID NO: 1.

[0012] Preferably, the nucleotide sequence of the gpd gene promoter is SEQ ID NO: 2.

[0013] Preferably, the method includes the following steps:

[0014] (1) Using the Ganoderma lucidum genomic DNA containing the gpd gene promoter as a template, designing primers to amplify the gpd gene promoter fragment to obtain a PCR amplification product of the gpd gene promoter, and connecting it to the Agrobacterium binary expression vector pCAMBIA1300 to obtain a vector, denoted as GLgpd;

[0015] (2) Using Ganoderma lucidum cDNA as a template, primers were designed to amplify the SREBP gene, and the PCR amplification product of the SREBP gene was obtained. It was ligated to the vector GLgpd obtained in step (1) to obtain the overexpression vector GLgpd-SREBP;

[0016] (3) The overexpression vector GLgpd-SREBP obtained in step (2) was introduced into Agrobacterium tumefaciens competent EHA105 cells. After activation, it was added to the Ganoderma lucidum protoplast cell solution. Using hygromycin as a screening antibiotic, it mediated the transformation of Ganoderma lucidum protoplast cells to screen transgenic Ganoderma lucidum strains, and transgenic Ganoderma lucidum strains with overexpression of the SREBP gene were obtained.

[0017] Ganoderma lucidum used in the method of the present invention Ganoderma lingzhi The preservation number of 1006 is CGMCC No. 18819.

[0018] Preferably, in step (1), the nucleotide sequences of the upstream and downstream primers of the gpd gene promoter are SEQ ID NO: 3 and 4 in sequence. The Ganoderma lucidum genomic DNA was extracted using the prior art.

[0019] Preferably, in step (1), the method for ligating the PCR amplification product of the gpd gene promoter to the Agrobacterium tumefaciens binary expression vector pCAMBIA1300 is: an EcoR I restriction enzyme site was designed at the 5' end of the upstream primer of the gpd gene, and a BamH I restriction enzyme site was designed at the 5' end of the downstream primer. After PCR amplification, the amplification product was subjected to double digestion with EcoR I and BamH I, and it was ligated into the plasmid of the Agrobacterium tumefaciens binary expression vector pCAMBIA1300 that had been subjected to double digestion with EcoR I and BamH I, and that's it. The Agrobacterium tumefaciens binary expression vector pCAMBIA1300 was purchased from Cambia - Canberra, Australia.

[0020] Preferably, in step (2), the nucleotide sequences of the upstream and downstream primers of the SREBP gene are SEQ ID NO: 5 and 6 in sequence. The Ganoderma lucidum cDNA was extracted using the prior art.

[0021] Preferably, in step (2), the method for ligating the PCR amplification product of the SREBP gene to the vector GLgpd obtained in step (1) is: an Xba I restriction enzyme site was designed at the 5' end of the upstream primer of the SREBP gene, and a HandIII restriction enzyme site was designed at the 5' end of the downstream primer. After PCR amplification, the amplification product was subjected to double digestion with Xba I and Hand III, and it was ligated into the plasmid of the vector GLgpd that had been subjected to double digestion with Xba I and Hand III.

[0022] Preferably, in step (3), the method for introducing the overexpression vector GLgpd-SREBP into Agrobacterium tumefaciens competent EHA105 cells is as follows: 1) Take 50 μL of Agrobacterium tumefaciens competent EHA105, thaw it in an ice box, add 3 - 5 μL of the plasmid, and incubate on ice for 4 - 6 min; 2) After quick-freezing in liquid nitrogen for 4 - 6 min, perform a water bath at 36 - 38 °C for 4 - 6 min, and then incubate on ice for 1 - 3 min; 3) Add 800 μL of YEB medium containing rifampicin, and culture at 26 - 30 °C and 150 - 250 rpm for 3 - 4 h; 4) Centrifuge at 6000 - 10000 rpm for 1 - 3 min, enrich the bacterial cells and discard the supernatant. After resuspending the bacterial solution, spread it onto YEB medium containing kanamycin and rifampicin, and culture it upside down at 26 - 30 °C for 36 - 48 h; 5) Identify by colony PCR. The Agrobacterium tumefaciens competent EHA105 cells are purchased from Tsingke Biological Company (Beijing). After the overexpression vector GLgpd-SREBP is identified by sequencing to have a correct sequence, it is then introduced.

[0023] Preferably, in step (3), the activation to OD 600 = 0.4 - 0.6. Bacteria are generally cryopreserved and usually reactivated and cultured to OD 600 = 0.4 - 0.6, at which time the bacterial activity is relatively high.

[0024] Preferably, in step (3), the specific method of activation is as follows: Add the agrobacterium competent EHA105 cell solution transfected with the overexpression vector GLgpd-SREBP to the liquid YEB medium containing rifampicin and kanamycin, perform a primary shaking culture, centrifuge, discard the supernatant, resuspend the cells with the IM induction culture medium containing acetosyringone, and then perform a secondary shaking culture to obtain the activated cells. The preparation method of the YEB medium (1 L) is as follows: peptone 5.0 g, yeast extract 1.0 g, beef extract 5.0 g, magnesium sulfate heptahydrate (MgSO4·7H2O) 0.493 g, sucrose 0.5 g, adjust the pH value to 7.2 with NaOH, and make up the volume. Add 15.0 g of agar powder to the solid YEB medium, sterilize at 121 °C under high-pressure steam for 20 - 25 min to obtain the solid YEB medium. The composition of the IM induction culture medium (100 mL) is as follows: Induction medium (IM): per liter contains the following components: K-Buffer: 10 mL, M-N Solution: 20 mL, 1% CaCl2: 1 mL, 0.01% FeSO4: 10 mL, 20% NH4NO3: 2.5 mL, Spore elements: 5 mL, 50% glycerol: 10 mL, 1 mol / L MES 40 mL, 2 mol / L glucose: 5 mL; The composition of the K-Buffer is: K2HPO4 200 g / L, NaH2PO4 145 g / L; The composition of the M-N Solution is: MgSO4·7H2O 30 g / L, NaCl 15 g / L; The composition of the Spore elements is: ZnSO4·7H2O 500 mg / L, CuSO4·5H2O 500 mg / L, H3BO3 50 mg / L, MnSO4·H2O 500 mg / L, Na2MoO4·2H2O 500 mg / L; The preparation method of the MES (4-morpholineethanesulfonic acid, 1 mol / L) is as follows: Dissolve 19.524 g of MES in water, adjust the pH to 5.5 with NaOH, and finally make up the volume to 100 mL. Filter and sterilize with a water-based filter membrane (model 0.22 μm), and dispense 8.5 mL into 10 mL centrifuge tubes.

[0025] Preferably, the volume ratio of the cell solution to the liquid YEB medium is 1:400 - 600.

[0026] Preferably, in the liquid YEB medium, the concentrations of rifampicin and kanamycin are both 50 - 150 μg / mL.

[0027] Preferably, the temperature of the primary shaking culture is 25 - 30 °C, the rotation speed is 150 - 250 rpm, and the time is 36 - 48 h.

[0028] Preferably, the relative centrifugal force of the centrifugation is 7000-8000g, and the time is 4-6 min.

[0029] Preferably, the volume ratio of the bacterial liquid to the IM induction culture medium is 1:50-150.

[0030] Preferably, the concentration of acetosyringone in the IM induction culture medium is 150-250 μmol / L.

[0031] Preferably, the resuspended bacteria are adjusted to OD 600 =0.25-0.30.

[0032] Preferably, the temperature of the secondary shaking culture is 25-30 °C, the rotation speed is 150-250 rpm, and the time is 4-6 h.

[0033] Preferably, in step (3), the method for preparing the Ganoderma lucidum protoplast cell solution is as follows: adding a lysing enzyme digestion solution to Ganoderma lucidum mycelium, mixing evenly, performing enzymatic digestion in a water bath, filtering, centrifuging, discarding the supernatant, resuspending and washing, and redissolving to obtain the solution.

[0034] Preferably, the mass-to-volume ratio of the Ganoderma lucidum mycelium to the lysing enzyme digestion solution is 1:1-6 g / mL.

[0035] Preferably, the mass fraction of the lysing enzyme digestion solution is 1-3%.

[0036] Preferably, the temperature of the enzymatic digestion in the water bath is 25-35 °C, the time is 3-4 h, and during the enzymatic digestion process, the mixture is inverted and mixed evenly every 25-35 min.

[0037] Preferably, the filtration refers to filtering the protoplasts after enzymatic digestion 2-3 times with a sterilized glass syringe filled with cotton.

[0038] Preferably, the temperature of the filtration is 0-8 °C.

[0039] Preferably, the temperature of the centrifugation is 0-8 °C, the relative centrifugal force is 10000-15000g, and the time is 8-12 min.

[0040] Preferably, resuspend and wash 2-3 times with a sterile mannitol-MES solution. The preparation method of the mannitol-MES solution is as follows: dissolve 14.5736 g of mannitol in 50 mL of ddH2O, then weigh 0.39048 g of MES and dissolve it, make up the volume to 100 mL, adjust the pH to 4.5, filter and sterilize, and dispense 9 mL into 10 mL centrifuge tubes.

[0041] Preferably, when resuspending and washing, the dosage of the sterile mannitol-MES solution per time and the volume-to-mass ratio of the Ganoderma lucidum mycelium is 1-4:1 mL / g.

[0042] Preferably, reconstitution is performed with sterile mannitol-MES solution.

[0043] Preferably, the concentration of the Ganoderma lucidum protoplast cell solution after resolubilization is 10 5 ~10 7 cfu / mL.

[0044] Preferably, the culturing method of the Ganoderma lucidum mycelium is: taking a Ganoderma lucidum mycelium block and inoculating it into a liquid SDB culture medium, culturing it at a constant temperature in the dark, centrifuging the Ganoderma lucidum mycelium suspension, discarding the supernatant, resuspending and rinsing, centrifuging, discarding the supernatant, and absorbing the moisture of the mycelium to obtain the product.

[0045] Preferably, the mass volume ratio of the Ganoderma lucidum mycelium block to the liquid SDB medium is 1:30 to 150 g / mL. The preparation method of the liquid SDB medium (1 L) is as follows: 30 g of SDB powder is dissolved in distilled water. 15.0 g of agar powder is added to the solid SDA medium, and the mixture is sterilized by high pressure steam at 121°C for 15 min.

[0046] Preferably, the constant temperature culture temperature is 20-30° C., the time is 3-5 days, and during the constant temperature culture process, the mixture is vigorously shaken every 6-8 hours.

[0047] Preferably, the relative centrifugal force of the centrifugation is 4000-6000g, and the time of each centrifugation is 5-10 minutes.

[0048] Preferably, the solution is resuspended and rinsed 2 to 4 times with PBS buffer. The preparation method of the PBS buffer is as follows: 8 g NaCl, 0.2 g KCl, 1.44 g Na2HPO4 and 0.24 g KH2PO4 are dissolved in 800 mL ddH2O, the pH value of the solution is adjusted to 7.4 with hydrochloric acid solution, the volume is fixed to 1000 mL, high pressure steam sterilization is carried out, and the solution is stored at 4°C.

[0049] Preferably, in step (3), the method for mediating transformation is as follows: Add the activated Agrobacterium tumefaciens competent EHA105 cell solution transfected with the overexpression vector GLgpd-SREBP into the Ganoderma lucidum protoplast cell solution, mix well, spread it onto the IM solid medium covered with cellophane, co-culture in the dark, then remove the cellophane on the IM solid medium, transfer the cellophane to the M-100 solid medium containing carbenicillin and hygromycin, culture, and after colonies grow, transfer the colonies into a 24-well plate containing the M-100 solid medium with carbenicillin and hygromycin for re-screening, and it is done. During the mediation of transformation, the Ganoderma lucidum protoplast cells will gradually grow from single cells into white filamentous multicellular cells. The preparation method of the IM solid medium (100 mL) is as follows: Add 1.5 g of agar powder to the aforementioned IM induction culture solution (100 mL), and sterilize it by high-pressure steam at 121 °C for 15 min, and it is done. The composition of the M-100 solid medium (100 mL) is: 6.25% of M-100 macroelement mother liquor, 1% of glucose, 0.3% of potassium nitrate (KNO3), 1.5% of agar powder; the composition of the M-100 macroelement mother liquor (500 mL) is: 8 g of potassium dihydrogen phosphate (KH2PO4), 2 g of sodium sulfate (Na2SO4), 4 g of potassium chloride (KCl), 1 g of magnesium sulfate heptahydrate (MgSO4·7H2O), 0.5 g of calcium chloride (CaCl2), 4 mL of M-100 trace element mother liquor; the composition of the M-100 trace element mother liquor (500 mL) is: 30 mg of boric acid (H3BO3), 70 mg of manganese chloride tetrahydrate (MnCl2·4H2O), 200 mg of zinc chloride (ZnCl2), 20 mg of sodium molybdate dihydrate (Na2MoO4·2H2O), 50 mg of ferric chloride hexahydrate (FeCl3·6H2O), 200 mg of copper sulfate pentahydrate (CuSO4·5H2O).

[0050] Preferably, the volume ratio of the Agrobacterium tumefaciens competent EHA105 cell solution to the Ganoderma lucidum protoplast cell solution is 1:0.8 - 1.2.

[0051] Preferably, the time for co-culturing in the dark is 1 - 3 d.

[0052] Preferably, in the M-100 solid medium, the concentrations of carbenicillin and hygromycin are both 50 - 150 μg / mL.

[0053] Preferably, the time for culturing on the M-100 solid medium is 7 - 10 d.

[0054] Preferably, the time for re-screening is 5 - 7 d.

[0055] In the method of the present invention, organic solvent extraction was used to extract total ganoderic acid (GA); high performance liquid chromatography was used to determine the contents of total GA, lanosterol and ganoderic acid C2 (GA-C2).

[0056] The beneficial effects of the method of the present invention are as follows:

[0057] (1) In the method of the present invention, the regulatory gene SREBP was transferred into Ganoderma lucidum cells by transgenic technology to obtain a transgenic Ganoderma lucidum strain with significantly increased triterpene content. The transgenic Ganoderma lucidum strain was identified by fusion gene PCR, qRT-PCR and Western blotting, and it was proved that the obtained transgenic Ganoderma lucidum strain successfully overexpressed the SREBP gene;

[0058] (2) The triterpene content in the transgenic Ganoderma lucidum strain with overexpression of the SREBP gene obtained by the method of the present invention was significantly increased. Compared with the wild-type Ganoderma lucidum control strain, the contents of total ganoderic acid, lanosterol and ganoderic acid C2 increased by 1.87 times, 1.89 times and 2.75 times respectively, opening up a new way for cultivating new Ganoderma lucidum strains and having good application and development prospects;

[0059] (3) The method of the present invention has a simple process and low cost, and is suitable for industrial production. Description of the Drawings

[0060] Figure 1 is a schematic diagram of the SREBP overexpression vector GLgpd-SREBP in Example 1 of the present invention;

[0061] Figure 2 is the situation of the transgenic Ganoderma lucidum strain with overexpression of the SREBP gene in Example 1 of the present invention growing on M-100 solid medium containing hygromycin (100 μg / mL) for 5 days;

[0062] Figure 3 is the PCR identification of the fusion of the gpd gene promoter and the SREBP gene in Example 1 of the present invention;

[0063] Figure 4 is the qRT-PCR analysis of the expression level of the SREBP gene in the transgenic Ganoderma lucidum strain with overexpression of the SREBP gene obtained in Example 1 of the present invention;

[0064] Figure 5 is the analysis of the SREBP protein level in the transgenic Ganoderma lucidum strain with overexpression of the SREBP gene obtained in Example 1 of the present invention by Western blotting;

[0065] Figure 6 is the comparison of the total GA content between the wild-type Ganoderma lucidum strain and the transgenic Ganoderma lucidum strain with overexpression of the SREBP gene obtained in Example 1 of the present invention;

[0066] Figure 7 It is a comparison of the lanosterol content between the wild-type Ganoderma lucidum strain and the transgenic Ganoderma lucidum strain with overexpression of the SREBP gene obtained in Example 1 of the present invention;

[0067] Figure 8 It is a comparison of the GA-C2 content between the wild-type Ganoderma lucidum strain and the transgenic Ganoderma lucidum strain with overexpression of the SREBP gene obtained in Example 1 of the present invention;

[0068] In the figure, the wild-type strain is the Ganoderma lucidum strain without vector introduction. Detailed implementation manners

[0069] The present invention will be further described below in conjunction with examples and drawings.

[0070] The Ganoderma lucidum used in the examples of the present invention Ganoderma lingzhi The preservation number of 1006 is CGMCC No. 18819; the used Agrobacterium binary expression vector pCAMBIA1300 was purchased from Cambia - Canberra, Australia; the used Agrobacterium competent EHA105 cells were purchased from Tsingke Biotechnology Co., Ltd. (Beijing); the preparation methods of the used YEB medium, IM induction culture solution, mannitol-MES solution, liquid SDB medium, PBS buffer solution, and IM solid medium are detailed in the specification; the composition of the used M-100 solid medium is detailed in the specification; the raw materials or chemical reagents used in the examples of the present invention, unless otherwise specified, are all obtained through conventional commercial channels.

[0071] In the examples of the present invention, total GA was extracted by the organic solvent extraction method; the contents of total GA, lanosterol, and GA-C2 were determined by high performance liquid chromatography.

[0072] Example 1

[0073] A method for increasing the content of Ganoderma triterpenoids is to overexpress the SREBP gene in Ganoderma lucidum;

[0074] That is, using the multiple cloning site region, the gpd gene promoter cloned from Ganoderma lucidum and the SREBP gene were inserted into the Agrobacterium binary expression vector pCAMBIA1300 to obtain an overexpression vector, denoted as GLgpd-SREBP; using the hygromycin resistance gene as a marker gene, through the Agrobacterium-mediated transformation method, the overexpression vector GLgpd-SREBP was transferred into Ganoderma lucidum protoplast cells to obtain a transgenic Ganoderma lucidum strain with overexpression of the SREBP gene; the nucleotide sequence of the SREBP gene is SEQ ID NO: 1; the nucleotide sequence of the gpd gene promoter is SEQ ID NO: 2;

[0075] Specifically, it includes the following steps:

[0076] (1) Using Ganoderma lucidum genomic DNA containing the gpd gene promoter as a template, design primers to amplify the gpd gene promoter fragment to obtain a PCR amplification product of the gpd gene promoter, and ligate it to the Agrobacterium binary expression vector pCAMBIA1300 to obtain a vector, denoted as GLgpd;

[0077] The nucleotide sequences of the upstream and downstream primers of the gpd gene promoter are SEQ ID NO:3 and 4 in sequence;

[0078] The method of ligating the PCR amplification product of the gpd gene promoter to the Agrobacterium binary expression vector pCAMBIA1300 is as follows: Design an EcoR I restriction site at the 5' end of the upstream primer of the gpd gene and a BamH I restriction site at the 5' end of the downstream primer. After PCR amplification, the amplification product is subjected to double digestion with EcoR I and BamH I, and then ligated into the plasmid of the Agrobacterium binary expression vector pCAMBIA1300 that has been subjected to double digestion with EcoR I and BamH I, thus completed (as Figure 1 shown);

[0079] Extraction of Ganoderma lucidum genomic DNA: The CTAB method is adopted. The specific operation is as follows: Take an appropriate amount of Ganoderma lucidum mycelium and quickly grind it into a powder in liquid nitrogen; Add 2×CTAB extraction buffer (65 °C) to a 2 mL centrifuge tube in advance, then transfer the Ganoderma lucidum powder into the centrifuge tube, incubate at 65 °C for 1.5 h, and gently shake and mix intermittently; Centrifuge at 4 °C and 12000g for 5 min; Take the supernatant, add an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1), gently and slowly mix well, and ensure uniform mixing; Centrifuge at 4 °C and 12000g for 10 min; Take out the centrifuge tube. At this time, the liquid is divided into three phases. Carefully transfer the top aqueous phase to a new centrifuge tube with a pipette, add the same volume of chloroform, mix well, and centrifuge at 12000g for 10 min; Carefully transfer the upper aqueous phase to a new centrifuge tube with a pipette, add absolute ethanol (2 times the volume) and sodium acetate (3 mol / L, 1 / 10 volume), mix well and place at -20 °C for 1 h for precipitation; Centrifuge at 4 °C and 12000g for 10 min; Discard the supernatant, wash the DNA precipitate with 700 μL ethanol (70%), centrifuge at 4 °C and 12000g for 10 min; Place the DNA precipitate in a laminar flow bench to air dry, finally dissolve it in ultrapure water and add an appropriate amount of RNAase to digest RNA at 37 °C. After taking 5 μL of the DNA sample for electrophoresis detection, store it at -20 °C for standby;

[0080] (2) Using Ganoderma lucidum cDNA as a template, primers were designed to amplify the SREBP gene, and the PCR amplification product of the SREBP gene was ligated to the vector GLgpd obtained in step (1) to obtain the overexpression vector GLgpd-SREBP;

[0081] The nucleotide sequences of the upstream and downstream primers of the SREBP gene are SEQ ID NO:5 and 6 in sequence;

[0082] The method for ligating the PCR amplification product of the SREBP gene to the vector GLgpd obtained in step (1) is as follows: an Xba I restriction enzyme site was designed at the 5' end of the upstream primer of the SREBP gene, and a Hand III restriction enzyme site was designed at the 5' end of the downstream primer. After PCR amplification, the amplification product was subjected to double digestion with Xba I and Hand III, and then ligated into the vector GLgpd plasmid that had been digested with Xba I and Hand III (as Figure 1 shown);

[0083] Method for preparing Ganoderma lucidum cDNA: Add 17 μL of RNA solution to a new 1.5 mL centrifuge tube, and then add 3 μL of Oligo(dT) (100 mmol / L); incubate at 72 °C for 10 min, then ice-bath for 10 min; centrifuge for 20 s; prepare the following reverse transcription reaction solution in the above centrifuge tube: 5×M-MLV Buffer, 6 μL; dNTPs (each 10 mmol / L), 3 μL; RNaseInhibitor (40 U / μL), 0.5 μL; M-MLV (RNaseHˉ), 0.5 μL; total volume 10 μL; incubate at 42 °C for 45 min; denature at 95 °C for 5 min, and then cool on ice to obtain;

[0084] (3) Introduce the overexpression vector GLgpd-SREBP obtained in step (2) into Agrobacterium tumefaciens competent EHA105 cells, and after activation to OD 600 = 0.5, add it to the Ganoderma lucidum protoplast cell solution, use hygromycin as a screening antibiotic to mediate the transformation of Ganoderma lucidum protoplast cells, and screen for transgenic Ganoderma lucidum strains to obtain transgenic Ganoderma lucidum strains with overexpression of the SREBP gene (select 3 strains and name them SREBP overexpression strains -1, 2, 3 respectively, as Figure 2 shown);

[0085] The method for introducing the overexpression vector GLgpd-SREBP into Agrobacterium tumefaciens competent EHA105 cells is as follows: 1) Take out a tube of 50 μL of Agrobacterium tumefaciens competent EHA105, thaw it in an ice box, add 4 μL of the plasmid, and incubate on ice for 5 min; 2) Quick-freeze in liquid nitrogen for 5 min, then water-bath at 37 °C for 5 min, and then incubate on ice for 2 min; 3) Add 800 μL of YEB medium containing rifampicin, and culture at 28 °C and 200 rpm for 3.5 h; 4) Centrifuge at 8000 rpm for 2 min, enrich the bacteria and discard the supernatant. After resuspending the bacterial solution, spread it with a spreading rod onto YEB medium containing kanamycin and rifampicin, and culture it upside down at 28 °C for 42 h; 5) Identify by colony PCR; after the overexpression vector GLgpd-SREBP has been sequenced and identified to have the correct sequence, then introduce it;

[0086] The specific method for activation is as follows: Add 10 μL of the bacterial solution of Agrobacterium tumefaciens competent EHA105 cells into which the overexpression vector GLgpd-SREBP has been introduced to 5 mL of liquid YEB medium containing rifampicin (100 μg / mL) and kanamycin (100 μg / mL). Culture it on a shaker at 28 °C and a rotation speed of 200 rpm for 42 h. Centrifuge at a relative centrifugal force of 7500 g for 5 min, discard the supernatant, resuspend the bacterial cells with 1 mL of IM induction culture solution containing acetosyringone (200 μmol / L) until OD 600 = 0.3, and then culture it on a shaker at 28 °C and a rotation speed of 200 rpm for 5 h until OD 600 = 0.55, and it is ready;

[0087] The method for preparing the Ganoderma lucidum protoplast cell solution is as follows: Add 1 mL of lysing enzyme solution (mass fraction 2%) to 1 g of Ganoderma lucidum mycelium in a 2 mL sterilized EP tube, mix well, and perform enzymatic hydrolysis in a water bath at 30 °C for 3.5 h (during the enzymatic hydrolysis process, invert and mix well every 30 min). Filter the protoplasts after enzymatic hydrolysis 3 times with a sterilized glass syringe filled with cotton at 4 °C, place the filtrate in a 2 mL EP tube, centrifuge at 4 °C and a relative centrifugal force of 12000 g for 10 min, discard the supernatant, resuspend and wash 2 times with 1 mL of sterile mannitol-MES solution each time, and redissolve with 1 mL of sterile mannitol-MES solution to obtain a Ganoderma lucidum protoplast cell solution with a concentration of 10 6 cfu / mL;

[0088] The method for culturing the Ganoderma lucidum mycelium is as follows: Take 5 pieces of 1 cm 22 g of Ganoderma lucidum mycelium blocks were inoculated into 100 mL of liquid SDB medium and incubated at 25 °C in a constant temperature incubator in the dark for 4 d (during the constant temperature incubation, shake vigorously every 7 h). After that, the Ganoderma lucidum mycelium suspension was transferred to a 50 mL EP tube and centrifuged at a relative centrifugal force of 5000 g for 8 min. The supernatant was discarded, and the mycelium was resuspended and rinsed 3 times with PBS buffer, each time centrifuged at a relative centrifugal force of 5000 g for 8 min. The supernatant was discarded, and the moisture of the mycelium was sucked dry with a pipette gun, and it was ready;

[0089] The method for mediating transformation is as follows: 100 μL of the activated Agrobacterium tumefaciens competent EHA105 cell solution containing the overexpression vector GLgpd-SREBP was added to 100 μL of the Ganoderma lucidum protoplast cell solution, mixed well, and plated on an IM solid medium covered with cellophane. After co-culturing in the dark for 2 d, the cellophane on the IM solid medium was removed, and the cellophane was transferred to an M-100 solid medium containing carbenicillin (100 μg / mL) and hygromycin (100 μg / mL). After culturing for 8 d, after colonies grew, the colonies were transferred to a 24-well plate containing an M-100 solid medium with carbenicillin (100 μg / mL) and hygromycin (100 μg / mL) for re-screening for 6 d, and it was ready.

[0090] As Figure 1 shown, the vector schematic diagram shows that the promoter of the Ganoderma lucidum gpd gene and the SREBP gene were loaded into the pCAMBIA1300 plasmid, and this plasmid was named GLgpd-SREBP.

[0091] As Figure 2 shown, the transgenic Ganoderma lucidum strains with overexpression of the SREBP gene can grow on the hygromycin resistance plate, while the wild-type Ganoderma lucidum strains cannot.

[0092] In order to verify that the transgenic Ganoderma lucidum strains with overexpression of the SREBP gene have successfully introduced the GLgpd-SREBP plasmid, PCR, qRT-PCR and Western blotting were used to identify the fusion gene of the gpd gene promoter and the SREBP gene in the SREBP overexpression strains -1, 2, and 3 obtained in Example 1 of the present invention.

[0093] (1)PCR identification of the fusion gene of the gpd gene promoter and the SREBP gene:

[0094] Genomic DNA of Ganoderma lucidum was taken for fusion PCR identification of the gpd gene promoter and the SREBP gene. The PCR primer sequences were:

[0095] gpd-SREBP-F: CTTGACGGTTCACTGGTTT;

[0096] gpd-SREBP-R: CGCTCTTGCTCCTCCTT;

[0097] The PCR amplification system is as follows: Component name: 10.0 μL system; 2X Pro Taq Master Mix: 5.0 μL; Genomic DNA: 1.0 μL; Primer F: 0.2 μL (10 μmol / L); Primer R: 0.2 μL (10 μmol / L); RNase free water: 3.6 μL;

[0098] The PCR reaction procedure is: 94°C, 30 s; 98°C, 10 s; 58°C, 30 s; 72°C, 1 kb / min; 72°C, 2 min; Cycle 30 times; The PCR result is as Figure 3 shown;

[0099] It can be Figure 3 seen that in the SREBP overexpressing strains -1, 2, and 3, the fusion gene fragment of the gpd gene promoter and the SREBP gene can be PCR cloned, where the plasmid is used as a positive control.

[0100] (2) qRT-PCR identification of the fusion gene of the gpd gene promoter and the SREBP gene:

[0101] Extraction of total RNA from Ganoderma lucidum: It is extracted by the Trizol method. The specific operation is as follows: Take an appropriate amount of Ganoderma lucidum mycelium and quickly grind it into powder in a mortar with liquid nitrogen. Pre-add RNAiso plus (800 μL) in a sterile centrifuge tube, take an appropriate amount of the ground Ganoderma lucidum mycelium powder and add it to the centrifuge tube, mix vigorously, and let it stand at room temperature for 5 min; Centrifuge at 4°C, 12000 g for 5 min, transfer the supernatant to a new centrifuge tube, add chloroform with a volume of 1 / 5 of the supernatant, invert and mix up and down for 15 s, and let it stand at room temperature for 5 min; Centrifuge at 4°C, 12000 g for 15 min. At this time, the solution is divided into three layers. Transfer the supernatant to a new 1.5 mL centrifuge tube, add the same volume of isopropanol, mix well, and let it stand at room temperature for 10 min; Centrifuge at 4°C, 12000 g for 10 min, discard the supernatant, add 500 μL of pre-cooled ethanol (70% (v / v)) to wash the precipitate; Centrifuge at 4°C, 12000 g for 1 min, discard the supernatant; Place the centrifuge tube in a laminar flow hood and dry it at room temperature for 5 min, add an appropriate amount of DEPC water to dissolve it, and store the dissolved total RNA of Ganoderma lucidum at ultra-low temperature; Take an appropriate amount of the extracted RNA sample and perform electrophoresis detection with 1% agarose gel for standby.

[0102] Digestion of DNA in Ganoderma lucidum total RNA: Add the following reagents into a 50 μL system: 10×DNase I buffer, 5 μL; RNase-Free DNaseI, 2 μL; RNA enzyme inhibitor (40 U / μL), 0.5 μL; RNA, 25 μL; ddH2O, 17.5 μL. Incubate the digestion solution at 37 °C for 30 min; add 50 μL ddH2O and mix well, add 100 μL of chloroform / isopentanol (24:1), shake, and place on ice for 10 min; centrifuge at 4 °C and 12,000 rpm for 5 min, transfer the supernatant to a new centrifuge tube; add 2.5 volumes of absolute ethanol and 1 / 10 volume of 0.3 mol / L NaAc, mix well, and place at -70 °C for 30 min; centrifuge at 4 °C and 12,000 rpm for 10 min, discard the supernatant, wash with 75% ethanol, and air dry; add 50 μL of RNase-free water, and detect the quality of RNA by electrophoresis; store the remaining RNA at -70 °C.

[0103] Preparation of Ganoderma lucidum cDNA: As described above.

[0104] The qRT-PCR amplification program is as follows: 95 °C for 10 min; 95 °C for 15 s, 60 °C for 1 min, for 40 cycles; Melting curve;

[0105] Data processing of qRT-PCR: Select Ganoderma lucidum 18S rRNA as the internal reference gene, calculate the expression of the target gene according to the 2-ΔΔCT method, and set the expression level of the SREBP gene in the wild-type strain to 1; the calculation results are as Figure 4 shown.

[0106] The qRT-PCR primer sequences are as follows:

[0107] SREBP-F2: TGGCACTGTCGGAAACAC, SREBP-R2: GCTCGGTCGCCTTAGAAC;

[0108] 18S-F: TCGAGTTCTGACTGGGTTGT, 18S-R: TCCGTTGCTGAAAGTTGTAT.

[0109] As Figure 4 can be seen, in the SREBP overexpression strains -1, 2, and 3, the transcriptional level of the SREBP gene is significantly higher than that of the wild-type strain, indicating that SREBP is overexpressed in the transgenic strains.

[0110] (3) Western blotting identification of the fusion gene of the gpd gene promoter and the SREBP gene:

[0111] The polyclonal antibody against SREBP was obtained by immunizing rabbits with the SREBP-bHLH protein domain sent to a professional antibody preparation company (Chemgen Biotech, Shanghai, China). Proteins of wild-type strains and SREBP overexpression strains -1, 2, and 3 mycelial strains were separated on a 12% (w / v) SDS-PAGE gel and transferred to a polyvinylidene fluoride membrane (Bio-Rad). They were incubated with rabbit anti-SREBP primary antibody and then with HRP goat anti-rabbit IgG antibody. β-Actin protein was used as an internal reference and detected with mouse β-Actin specific primary antibody (1:2000, a T0097, CMCTAG) and HRP goat anti-mouse IgG antibody.

[0112] Separation of Ganoderma lucidum mycelial cytoplasmic and nuclear protein fractions: Performed using a nuclear and cytoplasmic extraction kit (Nuclear and Cytoplasmic Extraction Reagents, Thermo Fisher Scientific, IL, USA). β-Tubulin antibody (1:2000, A T0003, CMCTAG) and Histone-H3 antibody (1:2000, A T0005, CMCTAG) were used as cytoplasmic and nuclear internal references respectively.

[0113] It can be seen from Figure 5 that Western blotting analysis showed that the SREBP protein levels in SREBP overexpression strains -1, 2, and 3 obtained in Example 1 of the present invention were significantly increased, especially the nuclear form of SREBP protein was significantly increased, which was 1.63 - 2.11 times that of the wild-type strain, significantly higher than the wild-type strain.

[0114] To prove the effect of overexpressing SREBP on the content of Ganoderma triterpenoids, after 7 days of fermentation culture, the total GA, lanosterol, and GA-C2 contents in wild-type strains and transgenic strain cells were detected.

[0115] a. Determination of total GA content: 2 g of dry mycelia were extracted with 100 mL of 75% (v / v) ethanol for 3 h, and the extraction was repeated twice. After removing the mycelia by centrifugation, the supernatant was dried under vacuum; the residue was suspended in water and then extracted with 100 mL of chloroform for 2 h, and the extraction was repeated twice; after the sample was evaporated to remove chloroform, it was further extracted with 200 mL of 5% (w / v) NaHCO3 for 12 h, and the pH value was adjusted to 3 by adding 2 mol / L hydrochloric acid solution; the total ganoderic acids in the NaHCO3 layer were extracted with 200 mL of chloroform for 12 h, and after evaporating to remove chloroform, it was dissolved in anhydrous ethanol. Using ursolic acid as the standard, the absorbance was measured at 245 nm; according to the ursolic acid standard curve, the total GA content was calculated;

[0116] b. Determination of lanosterol content: Using an Agilent 1290 ultra-high performance liquid chromatograph (UPLC), concentration gradient curves of lanosterol, that is, standard curves, were plotted according to the peak elution time and peak area respectively; the completed-fermentation Ganoderma mycelia were collected, dried to a constant weight at 60 °C, and ground into powder using a mortar; 0.03 g of the powder was weighed in a 2 mL centrifuge tube, 1.5 mL of 10% KOH-75% ethanol solution was added, and it was incubated in a 50 °C water bath for 2 h, with occasional gentle shaking; after cooling, it was centrifuged at 12000 g for 10 min, and the supernatant was taken into a 5 mL centrifuge tube and extracted with the same volume of n-hexane, and the upper layer solution was taken into a new test tube, and the extraction was repeated 3 times; dried with N2, 500 μL of chromatographic-grade methanol was added to the test tube for dissolution, and after complete dissolution, it was filtered using a 0.22 μm organic phase filter; loaded onto the UPLC, using an Agilent ZORBAX Eclipse Plus C18 column, the loading conditions were: using 100% methanol as the mobile phase, the injection flow rate was 0.5 mL / min, the injection volume was 1 μL, and the detection wavelength was 210 nm; according to the peak elution time, peak area and the standard curve, the contents of squalene and lanosterol were calculated (Xu, J.W., Xu, Y.N. & Zhong, J.J. Production of individual ganoderic acids and expression of biosynthetic genes in liquid static and shaking cultures of Ganoderma lucidum. Appl Microbiol Biotechnol 85, 941-8 (2010));

[0117] c. Determination of GA-C2 content: 100 mg of dried mycelia was extracted with methanol, and the GA-C2 content in the supernatant was determined by Agilent 1200 series high performance liquid chromatography using an Agilent Zorbax b-c18 chromatographic column (250×4.6 mm, 5 µm) at 254 nm; a calibration curve for determining GA-C2 in fungal mycelia was constructed using GA-C2 (>99%, MedChem Express) as the standard; the content of GA-C2 was calculated based on the peak elution time, peak area, and the standard curve.

[0118] It can be seen from Figures 6 - 8 that compared with the wild-type strain, the total GA, lanosterol, and GA-C2 contents of the SREBP overexpressing strain-1 obtained in Example 1 of the present invention were significantly increased by 1.87, 1.89, and 2.75 times, respectively; the total GA, lanosterol, and GA-C2 contents of the SREBP overexpressing strain-2 were significantly increased by 1.81, 1.83, and 2.52 times, respectively; the total GA, lanosterol, and GA-C2 contents of the SREBP overexpressing strain-3 were significantly increased by 1.86, 1.79, and 2.51 times, respectively. This indicates that the triterpene contents in the SREBP overexpressing strains-1, 2, and 3 obtained in Example 1 of the method of the present invention were all significantly increased.

Claims

1. A method for increasing the content of ganoderic triterpenoids, characterized in that: Overexpress the SREBP gene in Ganoderma lucidum, specifically: using the multiple cloning site region, insert the promoter of the gpd gene cloned from Ganoderma lucidum and the SREBP gene into the Agrobacterium binary expression vector pCAMBIA1300 to obtain the overexpression vector, denoted as GLgpd-SREBP; using the hygromycin resistance gene as the marker gene, through Agrobacterium-mediated transformation, transfer the overexpression vector GLgpd-SREBP into Ganoderma lucidum protoplast cells to obtain a transgenic Ganoderma lucidum strain with overexpression of the SREBP gene; the nucleotide sequence of the SREBP gene is SEQ ID NO:1; the nucleotide sequence of the gpd gene promoter is SEQ ID NO:2; the preservation number of the Ganoderma lucidum is CGMCC No.18819.

2. The method for increasing the content of ganoderic triterpenoids according to claim 1, wherein Including the following steps: (1) Using the Ganoderma lucidum genomic DNA containing the gpd gene promoter as a template, design primers to amplify the gpd gene promoter fragment to obtain the PCR amplification product of the gpd gene promoter, and ligate it to the Agrobacterium binary expression vector pCAMBIA1300 to obtain a vector, denoted as GLgpd; (2) Using Ganoderma lucidum cDNA as a template, design primers to amplify the SREBP gene to obtain the PCR amplification product of the SREBP gene, and ligate it to the vector GLgpd obtained in step (1) to obtain the overexpression vector GLgpd-SREBP; (3) Introduce the overexpression vector GLgpd-SREBP obtained in step (2) into Agrobacterium competent EHA105 cells. After activation, add it to the Ganoderma lucidum protoplast cell solution, use hygromycin as the screening antibiotic to mediate the transformation of Ganoderma lucidum protoplast cells, and screen for transgenic Ganoderma lucidum strains to obtain a transgenic Ganoderma lucidum strain with overexpression of the SREBP gene.

3. The method for increasing the content of ganoderic triterpenoids according to claim 2, wherein: In step (1), the nucleotide sequences of the upstream and downstream primers of the gpd gene promoter are SEQ ID NO:3 and 4 in sequence; the method for ligating the PCR amplification product of the gpd gene promoter to the Agrobacterium binary expression vector pCAMBIA1300 is: design an EcoR I restriction enzyme site at the 5' end of the upstream primer of the gpd gene and a BamH I restriction enzyme site at the 5' end of the downstream primer. After PCR amplification, perform double digestion of the amplification product with EcoR I and BamH I, and ligate it into the plasmid of the Agrobacterium binary expression vector pCAMBIA1300 that has been double-digested with EcoR I and BamH I, and that's it.

4. The method for increasing the content of ganoderic triterpenoids according to claim 2 or 3, characterized in that: In step (2), the nucleotide sequences of the upstream and downstream primers of the SREBP gene are SEQ ID NO:5 and 6 in sequence; the method for ligating the PCR amplification product of the SREBP gene to the vector GLgpd obtained in step (1) is: design an Xba I restriction enzyme site at the 5' end of the upstream primer of the SREBP gene and a Hand III restriction enzyme site at the 5' end of the downstream primer. After PCR amplification, perform double digestion of the amplification product with Xba I and Hand III, and ligate it into the plasmid of the vector GLgpd that has been double-digested with Xba I and Hand III.

5. The method for increasing the content of ganoderic triterpenoids according to claim 2 or 3, characterized in that: In step (3), the method for introducing the overexpression vector GLgpd-SREBP into Agrobacterium tumefaciens competent EHA105 cells is as follows: 1) Take 50 μL of Agrobacterium tumefaciens competent EHA105, thaw it in an ice box, add 3 - 5 μL of the plasmid, and incubate on ice for 4 - 6 min; 2) After quick-freezing in liquid nitrogen for 4 - 6 min, perform a water bath at 36 - 38 °C for 4 - 6 min, and then incubate on ice for 1 - 3 min; 3) Add 800 μL of YEB medium containing rifampicin, and culture at 26 - 30 °C with a rotation speed of 150 - 250 rpm for 3 - 4 h; 4) Centrifuge at 6000 - 10000 rpm for 1 - 3 min, enrich the bacteria, discard the supernatant, resuspend the bacterial solution, and spread it onto the YEB medium containing kanamycin and rifampicin, then incubate at 26 - 30 °C in an inverted position for 36 - 48 h; 5) Identify by colony PCR.

6. The method for increasing the content of ganoderic triterpenoids according to claim 4, wherein: In step (3), the method for introducing the overexpression vector GLgpd-SREBP into Agrobacterium tumefaciens competent EHA105 cells is as follows: 1) Take 50 μL of Agrobacterium tumefaciens competent EHA105, thaw it in an ice box, add 3 - 5 μL of the plasmid, and incubate on ice for 4 - 6 min; 2) After quick-freezing in liquid nitrogen for 4 - 6 min, perform a water bath at 36 - 38 °C for 4 - 6 min, and then incubate on ice for 1 - 3 min; 3) Add 800 μL of YEB medium containing rifampicin, and culture at 26 - 30 °C with a rotation speed of 150 - 250 rpm for 3 - 4 h; 4) Centrifuge at 6000 - 10000 rpm for 1 - 3 min, enrich the bacteria, discard the supernatant, resuspend the bacterial solution, and spread it onto the YEB medium containing kanamycin and rifampicin, then incubate at 26 - 30 °C in an inverted position for 36 - 48 h; 5) Identify by colony PCR.

7. The method for increasing the content of ganoderic triterpenoids according to claim 2 or 3, characterized in that: In step (3), the specific method of activation is as follows: Add the Agrobacterium tumefaciens competent EHA105 cell solution transfected with the overexpression vector GLgpd-SREBP to the liquid YEB medium containing rifampicin and kanamycin, perform the first shaking culture, centrifuge, discard the supernatant, resuspend the cells with the IM induction culture medium containing acetosyringone, and then perform the second shaking culture until OD 600 = 0.4 - 0.6, and it is ready; the volume ratio of the cell solution to the liquid YEB medium is 1:400 - 600; in the liquid YEB medium, the concentrations of rifampicin and kanamycin are both 50 - 150 μg / mL; the temperature of the first shaking culture is 25 - 30 °C, the rotation speed is 150 - 250 rpm, and the time is 36 - 48 h; the relative centrifugal force for centrifugation is 7000 - 8000 g, and the time is 4 - 6 min; the volume ratio of the cell solution to the IM induction culture medium is 1:50 - 150; the concentration of acetosyringone in the IM induction culture medium is 150 - 250 μmol / L; resuspend the cells until OD 600 = 0.25 - 0.30; the temperature of the second shaking culture is 25 - 30 °C, the rotation speed is 150 - 250 rpm, and the time is 4 - 6 h.

8. The method for increasing the content of ganoderic triterpenoids according to claim 4, characterized in that: In step (3), the specific method of activation is as follows: Add the Agrobacterium tumefaciens competent EHA105 cell solution transfected with the overexpression vector GLgpd-SREBP to the liquid YEB medium containing rifampicin and kanamycin, perform a first shaking culture, centrifuge, discard the supernatant, resuspend the cells with the IM induction culture medium containing acetosyringone, and then perform a second shaking culture until OD 600 = 0.4 - 0.6, and it is done; the volume ratio of the cell solution to the liquid YEB medium is 1:400 - 600; in the liquid YEB medium, the concentrations of rifampicin and kanamycin are both 50 - 150 μg / mL; the temperature of the first shaking culture is 25 - 30 °C, the rotation speed is 150 - 250 rpm, and the time is 36 - 48 h; the relative centrifugal force for centrifugation is 7000 - 8000 g, and the time is 4 - 6 min; the volume ratio of the cell solution to the IM induction culture medium is 1:50 - 150; the concentration of acetosyringone in the IM induction culture medium is 150 - 250 μmol / L; resuspend the cells until OD 600 = 0.25 - 0.30; the temperature of the second shaking culture is 25 - 30 °C, the rotation speed is 150 - 250 rpm, and the time is 4 - 6 h.

9. The method for increasing the content of ganoderic triterpenoids according to claim 5, wherein: In step (3), the specific method of activation is as follows: Add the agrobacterium competent EHA105 cell solution transfected with the overexpression vector GLgpd-SREBP to the liquid YEB medium containing rifampicin and kanamycin, perform the first shaking culture, centrifuge, discard the supernatant, resuspend the cells with the IM induction culture medium containing acetosyringone, and then perform the second shaking culture until OD 600 = 0.4 - 0.6, and it is done; the volume ratio of the cell solution to the liquid YEB medium is 1:400 - 600; in the liquid YEB medium, the concentrations of rifampicin and kanamycin are both 50 - 150 μg / mL; the temperature of the first shaking culture is 25 - 30 °C, the rotation speed is 150 - 250 rpm, and the time is 36 - 48 h; the relative centrifugal force for centrifugation is 7000 - 8000 g, and the time is 4 - 6 min; the volume ratio of the cell solution to the IM induction culture medium is 1:50 - 150; the concentration of acetosyringone in the IM induction culture medium is 150 - 250 μmol / L; resuspend the cells until OD 600 = 0.25 - 0.30; the temperature of the second shaking culture is 25 - 30 °C, the rotation speed is 150 - 250 rpm, and the time is 4 - 6 h.

10. The method for increasing the content of ganoderic triterpenoids according to claim 2 or 3, characterized in that: In step (3), the method for preparing the Ganoderma lucidum protoplast cell solution is as follows: add a lysing enzyme digestion solution to Ganoderma lucidum mycelia, mix well, perform enzymatic digestion in a water bath, filter, centrifuge, discard the supernatant, resuspend and wash, and redissolve to obtain the solution. The mass-volume ratio of the Ganoderma lucidum mycelia to the lysing enzyme digestion solution is 1:1 - 6 g / mL. The mass fraction of the lysing enzyme digestion solution is 1 - 3%. The temperature of the enzymatic digestion in the water bath is 25 - 35°C, and the time is 3 - 4 h. During the enzymatic digestion process, invert and mix well every 25 - 35 min. The filtration means filtering the digested protoplasts 2 - 3 times with a sterilized glass syringe filled with cotton. The temperature of the filtration is 0 - 8°C. The temperature of the centrifugation is 0 - 8°C, the relative centrifugal force is 10000 - 15000 g, and the time is 8 - 12 min. Resuspend and wash 2 - 3 times with a sterile mannitol-MES solution. When resuspending and washing, the volume-mass ratio of the sterile mannitol-MES solution used each time to the Ganoderma lucidum mycelia is 1 - 4:1 mL / g. Redissolve with a sterile mannitol-MES solution. The concentration of the Ganoderma lucidum protoplast cell solution after redissolution is 10 5 ~10 7 cfu / mL. The method for culturing the Ganoderma lucidum mycelia is as follows: inoculate Ganoderma lucidum mycelial blocks into a liquid SDB medium, perform dark constant-temperature culture, centrifuge the Ganoderma lucidum mycelial suspension, discard the supernatant, resuspend and rinse, centrifuge, discard the supernatant, and blot dry the moisture of the mycelium to obtain the mycelium. The mass-volume ratio of the Ganoderma lucidum mycelial blocks to the liquid SDB medium is 1:30 - 150 g / mL. The temperature of the constant-temperature culture is 20 - 30°C, and the time is 3 - 5 d. During the constant-temperature culture process, shake vigorously every 6 - 8 h. The relative centrifugal force for each centrifugation is 4000 - 6000 g, and the time for each centrifugation is 5 - 10 min. Resuspend and rinse 2 - 4 times with PBS buffer.

11. The method for increasing the content of ganoderic triterpenoids according to claim 4, characterized in that: In step (3), the preparation method of the Ganoderma lucidum protoplast cell solution is as follows: adding a wall-lytic enzyme hydrolysate to the Ganoderma lucidum mycelium, mixing, water bath hydrolysing, filtering, centrifuging, discarding the supernatant, resuspending, washing, and re-dissolving; the mass volume ratio of the Ganoderma lucidum mycelium to the wall-lytic enzyme hydrolysate is 1:1-6 g / mL; the mass fraction of the wall-lytic enzyme hydrolysate is 1-3%; the temperature of the water bath hydrolysis is 25-35°C, the time is 3-4h, and during the hydrolysis process, the solution is mixed by inversion every 25-35min; the filtration refers to: using a sterilized container filled with The enzymatically hydrolyzed protoplasts are filtered 2 to 3 times with a cotton glass syringe; the filtering temperature is 0 to 8°C; the centrifugal temperature is 0 to 8°C, the relative centrifugal force is 10,000 to 15,000 g, and the time is 8 to 12 minutes; the protoplasts are resuspended and washed 2 to 3 times with a sterile mannitol-MES solution; during the resuspending and washing, the volume mass ratio of each sterile mannitol-MES solution to the ganoderma mycelium is 1 to 4:1 in mL / g; the protoplasts are re-dissolved with a sterile mannitol-MES solution; the concentration of the re-dissolved ganoderma protoplast cell solution is 10 5 ~10 7 cfu / mL; the culturing method of the ganoderma mycelium is as follows: taking a ganoderma mycelium block and inoculating it into a liquid SDB culture medium, culturing it at a constant temperature in the dark, centrifuging the ganoderma mycelium suspension, discarding the supernatant, resuspending and rinsing, centrifuging, discarding the supernatant, and absorbing the moisture of the mycelium to obtain the product; the mass volume ratio of the ganoderma mycelium block to the liquid SDB culture medium is 1:30-150 g / mL; the temperature of the constant temperature culture is 20-30°C, the time is 3-5 days, and during the constant temperature culture, the culture is vigorously shaken every 6-8 hours; the relative centrifugal force of the centrifugation is 4000-6000g, and the time of each centrifugation is 5-10 minutes; Resuspend and rinse 2 - 4 times with PBS buffer.

12. The method for increasing the content of ganoderic triterpenoids according to claim 5, wherein: In step (3), the preparation method of the Ganoderma lucidum protoplast cell solution is as follows: adding a wall-lytic enzyme hydrolysate to the Ganoderma lucidum mycelium, mixing, water bath hydrolysing, filtering, centrifuging, discarding the supernatant, resuspending, washing, and re-dissolving; the mass volume ratio of the Ganoderma lucidum mycelium to the wall-lytic enzyme hydrolysate is 1:1-6 g / mL; the mass fraction of the wall-lytic enzyme hydrolysate is 1-3%; the temperature of the water bath hydrolysis is 25-35°C, the time is 3-4h, and during the hydrolysis process, the solution is mixed by inversion every 25-35min; the filtration refers to: using a sterilized container filled with The enzymatically hydrolyzed protoplasts are filtered 2 to 3 times with a cotton glass syringe; the filtering temperature is 0 to 8°C; the centrifugal temperature is 0 to 8°C, the relative centrifugal force is 10,000 to 15,000 g, and the time is 8 to 12 minutes; the protoplasts are resuspended and washed 2 to 3 times with a sterile mannitol-MES solution; during the resuspending and washing, the volume mass ratio of each sterile mannitol-MES solution to the ganoderma mycelium is 1 to 4:1 in mL / g; the protoplasts are re-dissolved with a sterile mannitol-MES solution; the concentration of the re-dissolved ganoderma protoplast cell solution is 10 5 ~10 7 cfu / mL; the culturing method of the ganoderma mycelium is as follows: taking a ganoderma mycelium block and inoculating it into a liquid SDB culture medium, culturing it at a constant temperature in the dark, centrifuging the ganoderma mycelium suspension, discarding the supernatant, resuspending and rinsing, centrifuging, discarding the supernatant, and absorbing the moisture of the mycelium to obtain the product; the mass volume ratio of the ganoderma mycelium block to the liquid SDB culture medium is 1:30-150 g / mL; the temperature of the constant temperature culture is 20-30°C, the time is 3-5 days, and during the constant temperature culture, the culture is vigorously shaken every 6-8 hours; the relative centrifugal force of the centrifugation is 4000-6000g, and the time of each centrifugation is 5-10 minutes; Resuspend and rinse 2 - 4 times with PBS buffer.

13. The method for increasing the content of ganoderic triterpenoids according to claim 7, characterized in that: In step (3), the preparation method of the Ganoderma lucidum protoplast cell solution is as follows: adding a wall-lytic enzyme hydrolysate to the Ganoderma lucidum mycelium, mixing, water bath hydrolysing, filtering, centrifuging, discarding the supernatant, resuspending, washing, and re-dissolving; the mass volume ratio of the Ganoderma lucidum mycelium to the wall-lytic enzyme hydrolysate is 1:1-6 g / mL; the mass fraction of the wall-lytic enzyme hydrolysate is 1-3%; the temperature of the water bath hydrolysis is 25-35°C, the time is 3-4h, and during the hydrolysis process, the solution is mixed by inversion every 25-35min; the filtration refers to: using a sterilized container filled with The enzymatically hydrolyzed protoplasts are filtered 2 to 3 times with a cotton glass syringe; the filtering temperature is 0 to 8°C; the centrifugal temperature is 0 to 8°C, the relative centrifugal force is 10,000 to 15,000 g, and the time is 8 to 12 minutes; the protoplasts are resuspended and washed 2 to 3 times with a sterile mannitol-MES solution; during the resuspending and washing, the volume mass ratio of each sterile mannitol-MES solution to the ganoderma mycelium is 1 to 4:1 in mL / g; the protoplasts are re-dissolved with a sterile mannitol-MES solution; the concentration of the re-dissolved ganoderma protoplast cell solution is 10 5 ~10 7 cfu / mL; the culturing method of the ganoderma mycelium is as follows: taking a ganoderma mycelium block and inoculating it into a liquid SDB culture medium, culturing it at a constant temperature in the dark, centrifuging the ganoderma mycelium suspension, discarding the supernatant, resuspending and rinsing, centrifuging, discarding the supernatant, and absorbing the moisture of the mycelium to obtain the product; the mass volume ratio of the ganoderma mycelium block to the liquid SDB culture medium is 1:30-150 g / mL; the temperature of the constant temperature culture is 20-30°C, the time is 3-5 days, and during the constant temperature culture, the culture is vigorously shaken every 6-8 hours; the relative centrifugal force of the centrifugation is 4000-6000g, and the time of each centrifugation is 5-10 minutes; Resuspend and rinse 2 - 4 times with PBS buffer.

14. The method for increasing the content of ganoderic triterpenoids according to claim 2 or 3, characterized in that: In step (3), the method for mediated transformation is as follows: Add the bacterial solution of the activated Agrobacterium tumefaciens competent EHA105 cells introduced with the overexpression vector GLgpd-SREBP into the Ganoderma lucidum protoplast cell solution, mix well, spread it on the IM solid medium covered with cellophane, co-culture in the dark, then remove the cellophane on the IM solid medium, transfer the cellophane to the M-100 solid medium containing carbenicillin and hygromycin, culture, and after colonies grow, transfer the colonies into the 24-well plate of the M-100 solid medium containing carbenicillin and hygromycin for rescreening, and it is completed; the volume ratio of the bacterial solution of Agrobacterium tumefaciens competent EHA105 cells to the Ganoderma lucidum protoplast cell solution is 1:0.8 - 1.2; the time for co-culture in the dark is 1 - 3 d; in the M-100 solid medium, the concentrations of carbenicillin and hygromycin are both 50 - 150 μg / mL; the time for culturing on the M-100 solid medium is 7 - 10 d; the time for rescreening is 5 - 7 d.

15. The method for increasing the content of ganoderic triterpenoids according to claim 4, characterized in that: In step (3), the method for mediating transformation is as follows: Add the activated bacterial solution of Agrobacterium tumefaciens competent EHA105 cells transfected with the overexpression vector GLgpd-SREBP into the Ganoderma lucidum protoplast cell solution, mix well, spread it on the IM solid medium covered with cellophane, and after co-culturing in the dark, remove the cellophane on the IM solid medium, transfer the cellophane to the M-100 solid medium containing carbenicillin and hygromycin, culture it, and after colonies grow, transfer the colonies into a 24-well plate containing the M-100 solid medium with carbenicillin and hygromycin for rescreening, and it is done; the volume ratio of the Agrobacterium tumefaciens competent EHA105 cell bacterial solution to the Ganoderma lucidum protoplast cell solution is 1:0.8 - 1.2; the time for co-culturing in the dark is 1 - 3 d; in the M-100 solid medium, the concentrations of both carbenicillin and hygromycin are 50 - 150 μg / mL; the time for culturing on the M-100 solid medium is 7 - 10 d; the time for rescreening is 5 - 7 d.

16. The method for increasing the content of ganoderic triterpenoids according to claim 5, characterized in that: In step (3), the method for mediating transformation is as follows: Add the activated bacterial solution of Agrobacterium tumefaciens competent EHA105 cells transfected with the overexpression vector GLgpd-SREBP into the Ganoderma lucidum protoplast cell solution, mix well, spread it on the IM solid medium covered with cellophane, and after co-culturing in the dark, remove the cellophane on the IM solid medium, transfer the cellophane to the M-100 solid medium containing carbenicillin and hygromycin, culture it, and after colonies grow, transfer the colonies into a 24-well plate containing the M-100 solid medium with carbenicillin and hygromycin for rescreening, and it is done; the volume ratio of the Agrobacterium tumefaciens competent EHA105 cell bacterial solution to the Ganoderma lucidum protoplast cell solution is 1:0.8 - 1.2; the time for co-culturing in the dark is 1 - 3 d; in the M-100 solid medium, the concentrations of both carbenicillin and hygromycin are 50 - 150 μg / mL; the time for culturing on the M-100 solid medium is 7 - 10 d; the time for rescreening is 5 - 7 d.

17. The method for increasing the content of ganoderic triterpenoids according to claim 7, characterized in that: In step (3), the method for mediating transformation is as follows: Add the activated agrobacterium competent EHA105 cell suspension containing the overexpression vector GLgpd-SREBP into the Ganoderma lucidum protoplast cell solution, mix well, spread it on the IM solid medium covered with cellophane, after co-culturing in the dark, remove the cellophane on the IM solid medium, transfer the cellophane to the M-100 solid medium containing carbenicillin and hygromycin, culture it, after colonies grow, transfer the colonies into a 24-well plate containing the M-100 solid medium with carbenicillin and hygromycin, and perform secondary screening to obtain the product; the volume ratio of the agrobacterium competent EHA105 cell suspension to the Ganoderma lucidum protoplast cell solution is 1:0.8 - 1.2; the time for co-culturing in the dark is 1 - 3 d; in the M-100 solid medium, the concentrations of carbenicillin and hygromycin are both 50 - 150 μg / mL; the time for culturing on the M-100 solid medium is 7 - 10 d; the time for secondary screening is 5 - 7 d.

18. The method for increasing the content of ganoderic triterpenoids according to claim 10, characterized in that: In step (3), the method for mediating transformation is as follows: Add the activated agrobacterium competent EHA105 cell suspension containing the overexpression vector GLgpd-SREBP into the Ganoderma lucidum protoplast cell solution, mix well, spread it on the IM solid medium covered with cellophane, after co-culturing in the dark, remove the cellophane on the IM solid medium, transfer the cellophane to the M-100 solid medium containing carbenicillin and hygromycin, culture it, after colonies grow, transfer the colonies into a 24-well plate containing the M-100 solid medium with carbenicillin and hygromycin, and perform secondary screening to obtain the product; the volume ratio of the agrobacterium competent EHA105 cell suspension to the Ganoderma lucidum protoplast cell solution is 1:0.8 - 1.2; the time for co-culturing in the dark is 1 - 3 d; in the M-100 solid medium, the concentrations of carbenicillin and hygromycin are both 50 - 150 μg / mL; the time for culturing on the M-100 solid medium is 7 - 10 d; the time for secondary screening is 5 - 7 d.

Images