Antiviral prodrugs, pharmaceutical formulations, and methods

Abstract

Compounds comprising antiviral prodrugs, and pharmaceutical formulations comprising the compounds, which can be orally bioavailable or formulated for intramuscular injection. Methods for making compounds such as antiviral prodrugs. Methods for treating coronavirus and other RNA viral infections in mammals. Methods for producing pharmaceutical triphosphates.

Description

[0001] Cross-reference to related applications

[0002] This application claims priority to U.S. Provisional Patent Application No. 63 / 145,698, filed February 4, 2021; U.S. Provisional Patent Application No. 63 / 110,596, filed November 6, 2020; U.S. Provisional Patent Application No. 63 / 078,427, filed September 15, 2020; U.S. Provisional Patent Application No. 63 / 070,695, filed August 26, 2020; and U.S. Provisional Patent Application No. 63 / 055,944, filed July 24, 2020, which are incorporated herein by reference.

[0003] Statement regarding federally funded research or development

[0004] This invention was made with government grant number AI131424 granted by the National Institutes of Health in the United States. The government enjoys certain rights in this invention. Technical Field

[0005] This invention relates to an antiviral prodrug, a method for producing the antiviral prodrug, and a method for its use in treating coronavirus infection in mammals. Background Technology

[0006] Over the past two decades, spillover events have introduced highly transmissible beta-coronavirus strains such as SARS-CoV, MERS-CoV, and SARS-CoV-2 into the human population. While case fatality rates have varied, each has demonstrated the ability to cause significant morbidity and mortality—particularly in individuals over 55 years of age and / or with underlying comorbid medical conditions. Although SARS-CoV and MERS-CoV have been largely contained by epidemiological interventions, SARS-CoV-2 has evolved into a global pandemic.

[0007] Efforts to develop a SARS-CoV-2 vaccine have faced challenges including strain diversity, the possibility that vaccine-induced immunity will be short-lived, potentially reduced immune recognition in individuals as young as 30 years old, and the possibility of observed antibody-dependent enhancement. Reported cases of reinfection have raised new and substantial concerns about long-term immunity—even after recovery from natural infection. While the development of a SARS-CoV-2 vaccine holds promise, an AIDS vaccine remains elusive a third of a century later. Highly successful drug development efforts have transformed the face of HIV by providing extremely effective, affordable, and scalable tools for prevention and treatment. Treatment studies of equal intensiveness are needed during coronavirus vaccine research.

[0008] Remdesivir nucleoside triphosphate (RVn triphosphate) effectively inhibits the enzymatic activity of polymerases for every coronavirus tested to date, including SARS CoV-2 (see, for example, Yan, VC et al., ACS Med. Chem. Lett., 2020; 11(7): 1361-1366).

[0009] This broad activity may reflect the relative molecular conservation of coronavirus RNA-dependent RNA polymerase (RdRp). Remdesivir (RDV) is an aryloxyaminophosphate prodrug that must be converted to RVn triphosphate, the active antiviral metabolite, via a series of reactions. Although RVn-triphosphate is an excellent inhibitor of viral RdRp (see, e.g., Gordon, CJ et al., J. Biol. Chem., 2020; 295: 4773-4779), the antiviral activity of RDV is highly variable across different cell types, likely due to the variable expression of the four enzymes required for conversion to RVn-P (Yan, VC et al., ACS Medicinal Chemistry Letters, 2020; 11(7): 1361-1366). The base of RDV is a 1'-cyano-substituted adenine C nucleoside (GS-441524, RVn), which is thought to be poorly phosphorylated. To bypass the notoriously slow first phosphorylation, the developers relied on an aryloxyaminophosphate prodrug, which is converted to remdesivir nucleoside monophosphate (RVn-P) via a complex four-step reaction, and then efficiently converted to the active metabolite RVn triphosphate. RDV may be more active in some SARS-CoV-2 infected tissues than in others, which may explain its incomplete clinical impact on SARS-CoV-2.

[0010] Remdesivir has shown beneficial antiviral and clinical effects in animal models of coronavirus infection (see, e.g., de Wit, E. et al., Proceedings of the National Academy of Sciences (Proc. Natl. Acad. Sci. USA), 2020; 115:6771-6776). These effects are primarily demonstrable when administered shortly before or after viral challenge. RDV is not highly bioavailable after oral administration and must be administered intravenously, which functionally limits its clinical use in hospitalized patients with relatively advanced disease. Furthermore, RDV is known to have very short persistence in plasma.

[0011] Specifically, RDV is a prodrug designed to bypass the first phosphorylation of remdesivir nucleoside (RVn), which may be a limiting factor in the synthesis of the active metabolite RVn triphosphate. However, this approach did not appear to provide any benefit in the monkey kidney cell line Vero E6 (see, e.g., Pruijssers, AJ et al., Cell Reports, July 21, 2020; 32(3):107940), and results showed that RVn had greater antiviral activity than RDV. Other notable drawbacks of RDV include lack of oral bioavailability, difficult synthesis, plasma instability, inadequate delivery to the lungs, and / or hepatotoxicity. In patients with Covid-19 and in Syrian hamster models of SARS-CoV-2 disease, in addition to high viral loads in the nasal turbinates, trachea, and lungs, many other tissues were also infected with SARS-CoV-2 as the infection progressed, including the intestine, heart, liver, spleen, kidney, brain, lymph nodes, and vascular endothelium. However, the antiviral activity of RDV appears to differ significantly between lung and kidney cell lines, particularly in Vero E6 cells with EC50. 50 The value was 1.65 μM, compared to 0.28 μM in Calu3 2B4 and 0.010 μM in human alveolar epithelial cells (HAE), a difference of 165-fold (see, e.g., Pruijssers, AJ et al., Cell Reports, July 21, 2020; 32(3):107940). It has been suggested that this may be due to the variable amount of enzyme that converts RDV to RVn-P (see, e.g., Yan, VC et al., ACS Medicinal Chemistry Letters, 2020; 11(7):1361-1366).

[0012] There remains a need for highly active and / or orally bioavailable analogues of RVn that can provide sustained levels of the complete antiviral agent in plasma, including those that provide increased oral bioavailability by improving lung exposure to the active antiviral agent. Summary of the Invention

[0013] This document provides compounds, such as antiviral prodrugs and pharmaceutical formulations, that overcome one or more drawbacks of currently used drugs. For example, examples of compounds and pharmaceutical formulations provided herein comprise orally useful antiviral prodrugs that can specifically target the organ where viral replication is most extensive and can be conveniently administered on a large scale at any stage of disease. For oral use and enhanced lung exposure, examples of novel RVn prodrugs provided herein can accomplish one or more of three steps: 1) first-nucleoside phosphorylation kinase bypass, 2) providing increased oral bioavailability, and 3) delivering significant antiviral concentrations to the lungs and gastrointestinal tract. This document also provides methods for synthesizing and antivirally evaluating said compounds comprising novel lipophilic prodrugs of RVn-monophosphate, which are substantially more active than remdesivir in Vero E6 cells infected with SARS-CoV-2. Without wishing to be bound by any particular theory, the examples of compounds described herein are prodrugs that could allow for earlier and / or more effective treatment at the time of diagnosis of SARS-CoV-2 infection. The prodrugs described herein may represent a method that could potentially target antiviral agents to the lungs and away from the liver, which is the primary dose-limiting target of remdesivir.

[0014] In one aspect, this document provides compounds comprising antiviral prodrugs. In some embodiments, the compounds have a structure according to formula (I):

[0015]

[0016] Nuc is selected from the group consisting of antiviral nucleosides and antiviral nucleoside analogs; Y is independently selected from hydrogen, C1-C. 30 The group consisting of a hydrocarbon group, a pharmaceutically acceptable cation, and a covalent bond between the carbon atom of the pentose sugar moiety of an antiviral nucleoside or antiviral nucleoside analogue; x is 0 or 1; L is a C1-C6 hydrocarbon group; and R is independently chosen from C 10 -C 30 The group consisting of hydrocarbon groups and substituents of formula (A);

[0017]

[0018] Where R 1 and R 2 Independently selectable from hydrogen and C1-C 30 A group composed of hydrocarbon groups.

[0019] On the other hand, pharmaceutical formulations are provided. In some embodiments, the pharmaceutical formulation comprises one or more compounds described herein. The pharmaceutical formulation may be formulated for intramuscular injection. The pharmaceutical formulation may be orally bioavailable.

[0020] In another aspect, treatment methods are provided, such as methods for treating viruses (e.g., coronaviruses), including viral infections in mammals. In some embodiments, the methods comprise administering an effective amount of the compounds or pharmaceutical preparations described herein.

[0021] In another aspect, a method for producing compounds such as prodrugs is provided. In some embodiments, the method comprises (i) providing a compound of formula (a):

[0022]

[0023] (ii) Provide compounds of formula (b):

[0024]

[0025] (iii) Contacting the compound of formula (a) and the compound of formula (b) to form the compound of formula (c):

[0026]

[0027] (iv) Contacting the compound of formula (c) with an acid to form the compound of formula (d):

[0028]

[0029] Where Het is a C1-C bond containing at least one heteroatom. 30 Hydrocarbon group; Y is selected from hydrogen, C1-C 30 A group consisting of hydrocarbon groups and pharmaceutically acceptable cations; x is 0 or 1; L is a C1-C6 hydrocarbon group; and R is selected from C 10 -C 30 The group consisting of hydrocarbon groups and substituents of formula (A);

[0030]

[0031] Where R 1 and R 2 Independently selectable from hydrogen and C1-C 30 A group consisting of hydrocarbon groups. The method may include performing an intramolecular esterification reaction of the product, such as a phosphate diester, to form a cyclic phosphate ester, such as a 3′,5′-cyclic phosphate ester.

[0032] On the other hand, a method for producing a drug triphosphate is also provided. In some embodiments, the method includes providing a plurality of cells, contacting the plurality of cells with a certain amount of drug, and incubating the plurality of cells and the certain amount of drug for a period of time to effectively form the drug triphosphate.

[0033] Additional aspects will be set forth in part in the description which follows, and in part will be apparent from the description, or may be learned by practicing the aspects described herein. The advantages described herein can be realized and obtained by means of the elements and combinations particularly pointed out in the appended claims. It should be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only, and not restrictive. Attached Figure Description

[0034] Figure 1A Examples of the compounds described herein are depicted as concentration-response curves for SARS-CoV-2 infection in Vero E6 cells in two independent experiments conducted in duplicate.

[0035] Figure 1B Examples of the compounds described herein are depicted in two independent experiments conducted in duplicate, showing concentration-response curves in Vero E6 cells against SARS-CoV-2 infection.

[0036] Figure 1C Examples of the compounds described herein are depicted in two independent experiments conducted in duplicate, showing concentration-response curves in Vero E6 cells against SARS-CoV-2 infection.

[0037] Figure 1D The concentration-response curves of remdesivir against SARS-CoV-2 infection in Vero E6 cells were plotted in two independent experiments conducted in duplicate.

[0038] Figure 1E The concentration-response curves of remdesivir nucleoside in Vero E6 cells against SARS-CoV-2 infection are described in two independent experiments conducted in duplicate.

[0039] Figure 1F Depicting Figures 1A-1E The concentration-response curve.

[0040] Figure 2 A graph depicting the relative survival rates of several examples of the compounds described herein, remdesivir, and remdesivir nucleoside.

[0041] Figure 3 The results of the embodiment are described, in which remdesivir triphosphate was synthesized in Vero E6 cells.

[0042] Figure 4A Antiviral dose-response curves for remdesivir (GS-5734) and the compounds described herein against human coronavirus 229E were plotted in MRC-5 cells.

[0043] Figure 4B Cytotoxicity in MRC-5 cells incubated for 72 hours in the presence of the indicated drug and the indicated concentrations of the compounds described herein is depicted.

[0044] Figure 5A The seven-day oral pharmacokinetics of the compounds described herein in Syrian hamsters are depicted.

[0045] Figure 5B The seven-day oral pharmacokinetics of remdesivir in Syrian hamsters were described.

[0046] Figure 6A The stability of ODE-P-RVn and ODBG-P-RVn in human plasma with K2EDTA as an anticoagulant was described.

[0047] Figure 6B The stability of ODE-P-RVn and ODBG-P-RVn in human plasma with heparin sodium as an anticoagulant was described. Detailed Implementation

[0048] On the one hand, this article provides compounds, including compounds of formula (I):

[0049]

[0050] In formula (I), “Nuc” can be any suitable nucleoside. Nucleosides can be attached to compounds in any way. For example, the 5'-hydroxyl group of a nucleoside can be attached to the phosphate moiety as an ester bond.

[0051] In some embodiments, the nucleoside is an antiviral nucleoside. The antiviral nucleoside may be an antiviral ribonucleoside. In some embodiments, the nucleoside is an antiviral nucleoside analog. The antiviral nucleoside analog may be an antiviral ribonucleoside analog.

[0052] In some embodiments, Nuc is RVn (GS-441524), β-D-N4-hydroxycytidine (NHC), or (2'R)-2-amino-2'-deoxy-2'-fluoro-N,2'-dimethyladenosine (CAS No. 1998705-62-6). In some embodiments, Nuc is GS-441524, and the compound of formula (I) has the following structure:

[0053]

[0054] Other antiviral drugs used for coronavirus infections can also be modified in the manner described in this article. For example, N 4 1,3-hydroxycytidine (NHC) is an antiviral candidate that has entered Phase I clinical evaluation. Other nucleoside analogs known to inhibit RNA viruses are also suitable for formulation according to the modifications disclosed herein.

[0055] In formula (I), "Y" can be any substituent described herein. In some embodiments, Y is hydrogen, C1-C 30 Hydrocarbon group, pharmaceutically acceptable cation, or covalent bond of carbon atoms in the pentose sugar moiety of antiviral nucleosides or antiviral nucleoside analogs.

[0056] When Y is a covalent bond to a carbon atom of the pentose sugar moiety of an antiviral nucleoside or antiviral nucleoside analogue, the covalent bond can be a covalent bond to any carbon atom (e.g., 1', 2', 3', or 4' carbon) of the pentose sugar moiety of the antiviral nucleoside or antiviral nucleoside analogue. In other words, the covalent bond can be a covalent bond between (i) the oxygen atom bonded to Y in formula (I) and (ii) any carbon atom (e.g., 1', 2', 3', or 4' carbon) of the pentose sugar moiety of the antiviral nucleoside or antiviral nucleoside analogue. For example, Nuc can be GS-441524; the covalent bond can be between the oxygen atom bonded to Y in formula (I) and the 3' carbon of the pentose sugar moiety of GS-441524, and the compound of formula (I) has the following structure:

[0057]

[0058] When Y is a pharmaceutically acceptable cation, the pharmaceutically acceptable cation can be Na. + .

[0059] In some embodiments, Y is C1-C 20 Hydrocarbon group, C1-C 10 A hydrocarbon group or a C1-C6 hydrocarbon group. In some embodiments, Y is a C1-C6 alkyl group, which may be unsubstituted. In some embodiments, Y comprises at least one cyclic moiety. The at least one cyclic moiety may be a monocyclic moiety or a polycyclic moiety, such as a bicyclic moiety, a spirocyclic moiety, etc. In some embodiments, Y is an aryl, arylalkyl, heteroaryl, heteroarylalkyl, or heterocyclic alkyl group, each of which may be unsubstituted or substituted. In some embodiments, Y is an unsubstituted or substituted pyridyl group. In some embodiments, Y is an unsubstituted or substituted benzyl group. An unsubstituted or substituted benzyl group may have a structure according to formula (B):

[0060]

[0061] Where R 3 R 4 R 5 R 6 and R 7Independently selected from the group consisting of: hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclic, aryl(alkyl), heteroaryl(alkyl), (heterocyclic)alkyl, hydroxyl, alkoxy, acyl, cyano, halogen, thiocarbonyl, O-carbamoyl, N-carbamoyl, O-thiocarbamoyl, N-thiocarbamoyl, C-acylamino, N-acylamino, S-sulfonylamino, N-sulfonylamino, C-carboxyl, O-carboxyl, isocyanate, thiocyanate, isothiocyanate, nitro, azide, silyl, thionyl, sulfinyl, sulfonyl, haloalkyl, haloalkoxy, trihalomethanesulfonyl, trihalomethanesulfonylamino, amino, monosubstituted amino, and disubstituted amino. In some embodiments, R 3 R 4 R 5 R 6 and R 7 It is hydrogen. In some embodiments, R 3 R 4 R 5 R 6 and R 7 At least two of them are hydrogen. In some embodiments, R 3 R 4 R 5 R 6 and R 7 At least three of the components are hydrogen. In some embodiments, R 3 R 4 R 5 R 6 and R 7 At least four of them are hydrogen.

[0062] When Y is an unsubstituted or substituted benzyl group of formula (B), the compound of formula (I) has the following structure:

[0063]

[0064] In formula (I), x can be 1 or 0. When x is 1, the "-OL-" moiety exists in the compound of formula (I). When x is 0, R is directly bonded to the oxygen atom of the phosphonate moiety, as shown in the following structure:

[0065]

[0066] When “L” is present in a compound of formula (I), “L” can be selected from any substituents described herein. In some embodiments, L is C1-C 30 Hydrocarbon group, C1-C 20 Hydrocarbon group, C1-C 10The hydrocarbon group, C1-C6 hydrocarbon group, C1-C5 hydrocarbon group, C1-C4 hydrocarbon group, C1-C3 hydrocarbon group, or C1-C2 hydrocarbon group. In some embodiments, L is an ethyl group, which may be unsubstituted. In some embodiments, L is a methyl group, which may be unsubstituted. In some embodiments, L is a propyl group, which may be unsubstituted.

[0067] In formula (I), “R” can be selected from any substituent described herein. In some embodiments, R is C1-C 30 Hydrocarbon group, C5-C 30 hydrocarbon group, C 10 -C 30 hydrocarbon group, C 12 -C 24 hydrocarbon group, C 13 -C 29 hydrocarbon group, C 15 -C 24 hydrocarbon group or C 20 -C 24 A hydrocarbon group. In some embodiments, R is a heteroalkyl group. R may contain 0 to 6 unsaturated bonds, 1 to 6 unsaturated bonds, 2 to 6 unsaturated bonds, 3 to 6 unsaturated bonds, or 4 to 6 unsaturated bonds. The term "unsaturated bond" as used herein may include any non-single bond, and when more than one unsaturated bond is present, two or more unsaturated bonds may be independently selected from double or triple bonds. When one or more double bonds are present, the one or more double bonds may be cis, trans, or a combination thereof. R may contain a cyclopropyl moiety, such as a terminal cyclopropyl moiety.

[0068] In some embodiments, R is

[0069]

[0070] Where a is 1 to 29. In some embodiments, a is 15 to 25. In some embodiments, a is 18 to 22. In some embodiments, a is 19. In some embodiments, a is 6 to 10. In some embodiments, a is 8.

[0071] In some embodiments, R is

[0072]

[0073] Where b is 1 to 29, c is 0 to 28, and the sum of b and c is 29 or less. In some embodiments, b is 1 to 4, and c is 15 to 20. In some embodiments, b is 3, and c is 15. In some embodiments, b is 2, and c is 17.

[0074] In some embodiments, R is a substituent of formula (A);

[0075]

[0076] Where R 1 and R 2 It is hydrogen or C1-C 30 Hydrocarbon groups, such as C 10 -C 30 hydrocarbon group or C 12 -C 24 Hydrocarbon group. R 1 R 2 Or R 1 and R 2 Both can contain at least one annular portion, which can be a single-ring portion or a multi-ring portion, such as a double-ring portion, a spiral portion, etc. R 1 R 2 Or R 1 and R 2 Both can contain 0 to 6, 1 to 6, 2 to 6, 3 to 6, or 4 to 6 unsaturated bonds. When one or more double bonds are present, they can be cis, trans, or a combination thereof. 1 R 2 Or R 1 and R 2 Both can contain branched hydrocarbon groups, such as the penultimate branched hydrocarbon group. In some embodiments, R 1 and R 2 At least one of them is hydrogen. In some embodiments, R 1 and R 2 Both were independently selected from C1-C 30 Hydrocarbon group.

[0077] In some embodiments, R 1 R 2 Or R 1 and R 2 Both are independently selected from the group consisting of aryl, arylalkyl, heteroaryl, heteroarylalkyl, and heterocyclic alkyl groups, each of which may be unsubstituted or substituted. The arylalkyl group may be an unsubstituted or substituted benzyl group. An unsubstituted or substituted benzyl group may have a structure according to formula (C):

[0078]

[0079] Where R 8 R 9 R 10 R 11 and R 12Independently selected from the group consisting of: hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclic, aryl(alkyl), heteroaryl(alkyl), (heterocyclic)alkyl, hydroxyl, alkoxy, acyl, cyano, halogen, thiocarbonyl, O-carbamoyl, N-carbamoyl, O-thiocarbamoyl, N-thiocarbamoyl, C-acylamino, N-acylamino, S-sulfonylamino, N-sulfonylamino, C-carboxyl, O-carboxyl, isocyanate, thiocyanate, isothiocyanate, nitro, azide, silyl, thionyl, sulfinyl, sulfonyl, haloalkyl, haloalkoxy, trihalomethanesulfonyl, trihalomethanesulfonylamino, amino, monosubstituted amino, and disubstituted amino. In some embodiments, R 8 R 9 R 10 R 11 and R 12 Each of them is hydrogen. In some embodiments, R 8 R 9 R 10 R 11 and R 12 At least two of them are hydrogen. In some embodiments, R 8 R 9 R 10 R 11 and R 12 At least three of the components are hydrogen. In some embodiments, R 8 R 9 R 10 R 11 and R 12 At least four of them are hydrogen. In some embodiments, R 8 R 9 R 10 R 11 and R 12 At least five of them are hydrogen.

[0080] In some embodiments, R 1 yes

[0081]

[0082] Where d is 1 to 29. In some embodiments, d is 5 to 29, 10 to 29, 15 to 29, 20 to 29, 25 to 29, 1 to 25, 1 to 20, 1 to 15, 1 to 10, or 1 to 5.

[0083] In some embodiments, R 1 yes

[0084]

[0085] Where e is 1 to 27, f is 0 to 26, and the sum of e and f is 27 or less.

[0086] In some embodiments, R 2 Choose from the following groups:

[0087]

[0088] Where g is 1 to 29. In some embodiments, g is 5 to 10. In some embodiments, g is 7.

[0089] The substituents in formula (A) can be racemic, sn-1 stereoisomers, or sn-3 stereoisomers. Throughout this disclosure, when a formula (such as formula (A)) is described without an indication of spatial orientation, the formula represents all isomers of the compound, such as stereoisomers. For example, in some embodiments, the compound may have a structure according to formula (I), where x is 0 and R is a substituent of formula (A):

[0090]

[0091] This formula lacks any indication of spatial orientation, therefore it represents its sn-3 isomer, its sn-1 isomer, and mixtures of sn-3 and sn-1 isomers, including its racemic mixtures:

[0092]

[0093] Further non-limiting examples of compounds of formula (I) are provided in the table below:

[0094]

[0095]

[0096]

[0097] When used herein with regard to the choice of substituents, the term “independently” means (i) that the substituents at a particular position can be the same or different for each molecule of formula (e.g., (i) a compound of formula (i) can contain two molecules of formula (i), wherein each molecule has the same or different C1-C selected for R). 30 (i) a hydrocarbon group; and / or (ii) two different labeled substituents selected from the same group of substituents may be the same or different (e.g., R and Y of the molecule of the compound of formula (I) are both selected from "C1-C2"). 30 "hydrocarbon group", and C1-C selected for R and Y 30 The hydrocarbon groups can be the same or different.

[0098] As used in this article, the phrase "C1-C"30 "hydrocarbon group", "C" 10 -C 30 "Hydrocarbon group" generally refers to an aliphatic, aryl, or arylalkyl group containing 1 to 30 carbon atoms or 10 to 30 carbon atoms, including its substituted derivatives. As described herein, it may include, but is not limited to, heteroaryl, heteroarylalkyl, heterocycloalkyl, etc. In each case, examples of aliphatic groups include, but are not limited to, alkyl, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, dienyl, cyclic groups, etc., and include all their substituted, unsubstituted, branched, and / or linear analogs or derivatives. In each case, for "C1-C..." 30 "hydrocarbon group" and "C" 10 -C 30 The "alkyl group" has 1 to 30 total carbon atoms or 10 to 30 total carbon atoms. Examples of alkyl groups include, but are not limited to, methyl, ethyl, propyl, isopropyl, n-butyl, tert-butyl, isobutyl, pentyl, hexyl, isohexyl, heptyl, 4,4-dimethylpentyl, octyl, 2,2,4-trimethylpentyl, nonyl, decyl, undecyl, and dodecyl. The cycloalkyl moiety can be monocyclic or polycyclic, and examples include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and adamantane. Alkyl moiety, including derivatives with any heteroatom substitutions. Additional examples of alkyl moiety have straight-chain, branched, and / or cyclic moieties (e.g., 1-ethyl-4-methyl-cyclohexyl). Representative alkenyl moieties include vinyl, allyl, 1-butenyl, 2-butenyl, isobutenyl, 1-pentenyl, 2-pentenyl, 3-methyl-1-butenyl, 2-methyl-2-butenyl, 2,3-dimethyl-2-butenyl, 1-hexenyl, 2-hexenyl, 3-hexenyl, 1-Heptenyl, 2-Heptenyl, 3-Heptenyl, 1-Octenyl, 2-Octenyl, 3-Octenyl, 1-Nonenyl, 2-Nonenyl, 3-Nonenyl, 1-Depenyl, 2-Depenyl, and 3-Depenyl. Representative alkynyl moieties include ethynyl, propynyl, 1-butynyl, 2-butynyl, 1-pentynyl, 2-pentynyl, 3-methyl-1-butynyl, 4-pentynyl, 1-hexynyl, 2-hexynyl, 5-hexynyl, 1-heptynyl, 2-heptenyl. Alkynyl, 6-heptynyl, 1-octynyl, 2-octynyl, 7-octynyl, 1-nonynyl, 2-nonynyl, 8-nonynyl, 1-decynyl, 2-decynyl, and 9-decynyl. Examples of aryl or arylalkyl moieties include, but are not limited to, anthraceneyl, azyl, biphenyl, fluorenyl, indane, indene, naphthyl, phenanthryl, phenyl, 1,2,3,4-tetrahydronaphthalene, anthraceneyl, tolyl, xylyl, isopropylacetone, benzyl, etc., including derivatives with any heteroatom substitutions thereof.

[0099] Unless otherwise stated, when used to describe a chemical structure or part, the term "substituted" refers to a derivative of that structure or part, wherein (i) a polyvalent noncarbon atom (e.g., oxygen, nitrogen, sulfur, phosphorus, etc.) is bonded to one or more carbon atoms of the chemical structure or part (e.g., a "substituted" C4 hydrocarbon group may include, but is not limited to, a pyrimidinyl moiety, a dioxaneyl moiety, an ether moiety, a methyl propionate moiety, an N,N-dimethylacetamide moiety, a butoxy moiety, etc., and a "substituted" aryl C4 hydrocarbon group). 12 The hydrocarbon group may include, but is not limited to, a diphenyl oxide moiety, a benzophenone moiety, etc.) or (ii) one or more of its hydrogen atoms (e.g., chlorobenzene can generally be characterized as an aryl C6 hydrocarbon group “replaced” by a chlorine atom) being substituted by a chemical moiety or functional group, such as acyl, alcohol, alkoxy, alkanoyloxy, alkoxycarbonyl, alkenyl, alkyl (e.g., methyl, ethyl, propyl, tert-butyl), alkynyl, alkylcarbonyloxy (-OC(O)alkyl), amide (-C(O)NH-alkyl- or -alkylNHC(O)alkyl), primary amino, secondary amino and tertiary amino (e.g., alkylamino, arylamino, arylalkylamino), aryl, arylalkyl, aryloxy, azo, azido, carbamoyl (-NHC(O)O-alkyl- or -OC(O)NH-alkyl), carbamoyl (e.g., CONH2, to and CONH-alkyl, CONH-aryl and CONH-arylalkyl), carboxyl, carboxylic acid, cyano, cycloalkyl, cycloalkenyl, ester, ether (e.g. methoxy, ethoxy), halogen, haloalkyl (e.g., -CCl3, -CF3, -C(CF3)3), haloalkoxy, trihalomethanesulfonyl, trihalomethanesulfonylamino, heteroalkyl, heterocycloalkyl, heteroaryl, heteroarylalkyl, isocyanate, isothiocyanate, nitrile, oxo, phosphate diester, silyl, sulfide, sulfonylamino (e.g. SO2NH2), sulfone, thio, sulfinyl, sulfonyl (including alkylsulfonyl, arylsulfonyl and arylalkylsulfonyl), sulfoxide, thiocarbonyl, thiocarbamoyl, thiocyanate, thiol (e.g. mercapto, thioether) or urea (-NHCONH-alkyl-).

[0100] pharmaceutical preparations

[0101] This document also provides pharmaceutical formulations. Pharmaceutical formulations may comprise compounds as described herein, such as compounds of formula (I). In some embodiments, the pharmaceutical formulation is orally bioavailable. In some embodiments, the pharmaceutical formulation is formulated for intramuscular injection.

[0102] Pharmaceutical formulations may contain one or more of the compounds described herein (e.g., two, three, etc.).

[0103] Pharmaceutical formulations may contain any one or more pharmaceutically acceptable excipients.

[0104] Treatment

[0105] This article also provides treatment methods, including those for treating viral infections such as coronavirus infections. Viral infections can occur in mammals.

[0106] In some embodiments, the method comprises administering an effective amount of the compound or pharmaceutical preparation described herein to a mammal.

[0107] Viral infection can be an RNA virus infection. In some embodiments, RNA virus infection is caused by RNA viruses selected from the group consisting of the families of viruses including Filoviridae, Orthomyxoviridae, Paramyxoviridae, Pneumoviridae, Lepusviridae, Neloviridae, Arenaviridae, Flaviviridae, and Coronaviridae.

[0108] Using standard techniques for evaluating anti-coronavirus activity and cytotoxicity, the compounds presented in this article (including prodrugs) can be screened for inhibitory activity against SARS-CoV-2 and related coronaviruses (or other viruses). Typically, compounds that inhibit coronaviruses are first screened in vitro, followed by in vivo screening to assess the efficacy of compounds that demonstrate significant antiviral activity.

[0109] Non-limiting examples of potentially useful in vitro assays include: a) the use of the OC43β coronavirus strain (ATCC 1558) in the human adenocarcinoma cell line HCT-8 (ATCCCCL-244), or coronavirus 229E in MRC-5 human lung fibroblasts. Endpoints may include semi-quantitative RT-PCR and PFU, as determined by three consecutive dilutions. b) The activity of compounds can be investigated using laboratory and clinical isolates of SARS-CoV-2 in Vero E6 cells, Caco-2, Calu-3, HPSC human lung cells, or Huh7.5 cells. Initial SARS-CoV-2 growth inhibition assays can quantify plaque reduction on Vero cells grown in 12-well plates using a commercially available mouse anti-SARS-CoV-2 spike protein detection antibody (Project 40021-MM07, SinoBiological.com). Virus in the culture supernatant can also be quantified by serial dilution on Vero cell lawns and by RT-PCR. Laboratory strains (strains NR52281 and NR522282) obtainable from resources such as BEI, as well as clinical strains isolated from patients participating in clinical trials, can be used. Cytotoxicity can be measured using commercial MTT assays or Cell Titer-Glo (Cell Titer Glo). Compounds with the lowest 90% inhibitory concentration and the highest concentration required to induce cytotoxicity can be selected for further evaluation. Anticoronavirus compounds can also be evaluated in lung explant models of SARS-CoV infection. To determine activity from primary cells of organs most clinically affected by the virus, candidate molecules with the highest therapeutic index in Vero E6 cells can be advanced to human lung explant studies.

[0110] Methods for producing compounds

[0111] This article also provides methods for producing compounds (such as those described herein), which may be prodrugs.

[0112] The compounds provided herein can be prepared by a variety of processes, including those described herein. In some embodiments, a protected analogue of remdesivir nucleoside, RVn,2, is prepared and then coupled to a suitable alkoxyalkyl phosphate to form a phosphate diester. Removal of the protecting group yields the compound of formula (I).

[0113]

[0114] In some embodiments, 2-C-(4-aminopyrrolo[2,1-f][1,2,4]triazine-7-yl)-2,5-dehydrated-D-altrononitrile (RVn, 2) is first converted to its 2',3'-isopropylidene derivative. The mixture of the alkoxyalkyl phosphate and the protected RVn is then treated with N,N-dicyclohexylcarbodiimide (DCC) and N,N-dimethylaminopyridine (DMAP) under conditions suitable for the preparation of phosphate diesters. The compound of formula (I) can be provided in suitable yield and purity by removing the isopropylidene protecting group with dilute HCl or other suitable acid.

[0115] In some embodiments, the method comprises providing a compound of formula (a).

[0116]

[0117] Where x, R, L and Y are as defined in this paper.

[0118] In some embodiments, the method comprises providing a compound of formula (b).

[0119]

[0120] Wherein Het is as defined herein. In some embodiments, Het is selected from the group consisting of:

[0121]

[0122] Furthermore, as explained herein, formula (b) does not contain any stereochemical indications, and therefore represents at least the stereoisomers of the following formula (b):

[0123]

[0124] In some embodiments, the method includes contacting a compound of formula (a) and a compound of formula (b) to form a compound of formula (c).

[0125]

[0126] Contact between the compound of formula (a) and the compound of formula (b) can be carried out at any temperature or pressure and in the presence of any suitable liquid. This liquid may contain C1-C2. 30 Hydrocarbon groups, such as C1-C groups containing at least one cyclic moiety, at least one heteroatom (such as nitrogen), or combinations thereof. 30 Hydrocarbon group. In some embodiments, the liquid is N,N-dicyclohexylcarbodiimide, 4-dimethylaminopyridine, or a combination thereof.

[0127] In some embodiments, the method contacts the compound of formula (c) with an acid to form the compound of formula (d).

[0128]

[0129] The acid can include any acid capable of promoting the formation of the compound of formula (d). The acid can be organic or inorganic. The acid can contain hydrogen halides, such as hydrogen chloride. Contact between the compound of formula (c) and the acid can be carried out in the presence of any suitable liquid. The liquid can be C1-C2. 30 Hydrocarbon groups, such as C1-C groups containing at least one cyclic moiety, at least one heteroatom, or a combination thereof. 30 Hydrocarbon group. In some embodiments, the liquid is tetrahydrofuran.

[0130] In some embodiments, the method comprises carrying out an intramolecular esterification reaction of a compound of formula (d) to form a cyclic phosphate ester, such as a 3′,5′-cyclic phosphate ester.

[0131] Methods for producing drug triphosphates

[0132] This document also provides a method for producing a drug triphosphate. In some embodiments, the method includes providing a plurality of cells, contacting the plurality of cells with a quantity of drug, and incubating the plurality of cells and the quantity of drug for a sustained period of time to effectively form the drug triphosphate. The plurality of cells may comprise any suitable cell type. In some embodiments, the plurality of cells comprises Vero E6 cells, Calu-2 cells, Caco-2 cells, MRC5 human lung fibroblasts, Huh7.5 cells, and PSC human lung cells. In some embodiments, the drug comprises remdesivir or remdesivir nucleoside (GS441524).

[0133] Furthermore, where the definition or use of a term in a reference incorporated herein by way of citation is inconsistent with or contrary to the definition of the term provided herein, the definition of the term provided herein shall apply and the definition of the term in the reference shall not apply.

[0134] Unless otherwise defined, all technical and scientific terms and any acronyms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While any methods and materials similar to or equivalent to those described herein may be used in the practice of this invention, exemplary methods, apparatus, and materials are described herein.

[0135] Unless otherwise indicated, the practice of this invention will employ conventional molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology techniques within the scope of the art. These techniques are well explained in the literature, such as *Molecular Cloning: A Laboratory Manual*, 2nd edition (Sambrook et al., 1989); *Oligonucleotide Synthesis* (edited by M.J. Gait, 1984); *Animal Cell Culture* (edited by R.R. Freshney, 1987); *Methods in Enzymology* (Academic Press, Inc.); *Current Protocols in Molecular Biology* (edited by F.M. Usubel et al., 1987, and updated regularly); *PCR: The Polymerase Chain Reaction* (edited by Mullis et al., 1994); and *The Science and Practice of Pharmacy*, 20th edition (Lippincott, Williams & Wilkins). 2003), and Remington, The Science and Practice of Pharmacy, 22nd edition (Pharmaceutical Press and Philadelphia College of Pharmacy at University of the Sciences, 2012).

[0136] Although certain aspects of conventional techniques have been discussed to facilitate the disclosure of various embodiments, the applicant does not deny these technical aspects, and it is contemplated that this disclosure may cover one or more conventional technical aspects discussed herein.

[0137] This disclosure can solve one or more problems and defects of known methods and processes. However, various embodiments are expected to prove useful in solving other problems and defects in many technical fields. Therefore, this disclosure should not be construed as limiting itself to solving any particular problem or defect discussed herein.

[0138] In this specification, when references or discussions are made to documents, acts, or knowledge items, such references or discussions do not imply that such documents, acts, or knowledge items, or any combination thereof, were publicly available, known to the public, part of common general knowledge, or otherwise constitute prior art under applicable statutory provisions as of the priority date; or are known to be related to any attempt to solve any problem covered in this specification.

[0139] As used herein, the terms “comprises,” “comprising,” “includes,” “including,” “has,” “having,” “contains,” “containing,” “characterized in,” or any other variations thereof are intended to cover a non-exclusive inclusion of the listed components, subject to any limitations otherwise expressly indicated. For example, a fusion protein, pharmaceutical composition, and / or method of “comprising” a list of elements (e.g., components, features, or steps) is not necessarily limited to those elements (or components or steps) but may include other elements (or components or steps) not expressly listed or inherent to the fusion protein, pharmaceutical composition, and / or method.

[0140] As used herein, the transitional phrases “consists of” and “consisting of” do not include any unspecified elements, steps, or components. For example, the use of “consists of” or “consisting of” in a claim limits the claim to the components, materials, or steps specifically listed in the claim, except for impurities typically associated with them (i.e., impurities within a given component). When the phrase “consists of” or “consisting of” appears in a clause of the body of a claim, rather than immediately following the preamble, the phrase “consists of” or “consisting of” limits only the elements (or components or steps) set forth in that clause; other elements (or components) are not excluded from the claim as a whole.

[0141] As used herein, the transitional phrases “consists essentially of” and “consisting essentially of” are used to define fusion proteins, pharmaceutical compositions, and / or methods that, in addition to those literally disclosed, comprise materials, steps, features, components, or elements, provided that such additional materials, steps, features, components, or elements do not materially affect the fundamental and novel characteristics of the claimed invention. The term “consistently of” occupies an intermediate position between “comprising” and “consisting of”.

[0142] It should be understood that the aspects and embodiments of the invention described herein include “consisting of aspects and embodiments” and / or “consisting substantially of aspects and embodiments”.

[0143] The terms “a / an” and “the” are intended to include a plurality of alternatives, such as at least one / a. For example, unless otherwise stated, the public meaning of “compound,” “pharmaceutical preparation,” “acid,” etc., covers a mixture or combination of one or more compounds, pharmaceutical preparations, acids, etc.

[0144] When used in a list of two or more items, the term "and / or" means that any of the listed items can be used alone or in combination with any one or more of the listed items. For example, the expression "A and / or B" is intended to mean either A or both of B, i.e., A alone, B alone, or a combination of A and B. The expression "A, B and / or C" is intended to mean A alone, B alone, C alone, a combination of A and B, a combination of A and C, a combination of B and C, or a combination of A, B and C.

[0145] This document discloses various ranges of numerical values. Unless otherwise stated, when an applicant discloses or claims any type of range, the applicant intends to individually disclose or claim each possible numerical value that such range can reasonably cover, including the endpoints of the range and any subranges and combinations thereof covered therein. Furthermore, all endpoint values ​​of the ranges disclosed herein are approximate values. As a representative example, in some embodiments, the applicant discloses "a is 15 to 25". This range should be interpreted as covering 15 and 25, and further covering each of 16, 17, 18, 19, 20, 21, 22, 23, and 24, encompassing any range and subranges between any of these values.

[0146] When expressing such values ​​or ranges, other disclosed embodiments include the specific values ​​listed, from one specific value, and / or to other specific values. Similarly, when a value is expressed as an approximation using the antecedent “about,” it will be understood that the specific value forms another embodiment. It will be further understood that multiple values ​​are disclosed, and each value is also disclosed herein as “about” the specific value in addition to the value itself. In embodiments, “about” may be used to mean, for example, within 10% of the value, within 5% of the value, or within 2% of the value.

[0147] As used herein, the term "pharmaceutical composition" refers to a pharmaceutically acceptable composition comprising a pharmaceutically active agent and, in some embodiments, further comprising a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical composition may be a combination of a pharmaceutically active agent and a carrier.

[0148] The term "combination" refers to a fixed combination or kit for combined administration in the form of a single dose unit, wherein one or more active compounds and a combination conjugate (e.g., another drug described below, also referred to as a "therapeutic agent" or "adjuvant") can be administered independently, either simultaneously or separately, at time intervals. In some cases, the combination conjugate exhibits synergistic effects, such as a co-administration effect. As used herein, the terms "co-administration" or "combination administration," etc., mean to cover the administration of a selected combination conjugate to a single subject (e.g., a patient) in need, and are intended to include treatment regimens in which the agents are not necessarily administered via the same route of administration or simultaneously. As used herein, the term "pharmaceutical composition" means a product consisting of a mixture or combination of more than one active ingredient, and includes both fixed and non-fixed combinations of active ingredients. The term "fixed combination" means that the active ingredients, such as a compound and a combination conjugate, are both administered simultaneously to a patient in the form of a single entity or dose. The term "non-fixed combination" means that the active ingredients, such as a compound and a combination conjugate, are both administered simultaneously, concurrently, or sequentially to a patient as separate entities without a specific time limit, wherein such administration provides a therapeutically effective level of the two compounds in the patient. The latter also applies to cocktail therapy, such as the application of three or more active ingredients.

[0149] As used herein, the term "pharmaceutical acceptable" means, except for other formulations that are safe for use in animals and more specifically in humans and / or non-human mammals, approved by federal or state regulatory agencies or listed in the United States Pharmacopeia or other recognized pharmacopoeias.

[0150] As used herein, the term "pharmaceutically acceptable carrier" refers to excipients, diluents, preservatives, solubilizers, emulsifiers, adjuvants, and / or catalysts applied with a demethylated compound. Such carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, plant, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, etc., polyethylene glycol, glycerin, propylene glycol, or other synthetic solvents. Antimicrobial agents, such as benzyl alcohol or methylparaben; antioxidants, such as ascorbic acid or sodium bisulfite; chelating agents, such as ethylenediaminetetraacetic acid; and agents for modulating tension, such as sodium chloride or glucose, can also be carriers. Methods for producing compositions in combination with carriers are known to those skilled in the art. In some embodiments, the language "pharmaceuticalally acceptable carrier" is intended to include any and all solvents, dispersion media, coatings, isotonic agents, and absorption delay agents compatible with drug administration. The use of such media and agents for pharmaceutically active substances is well known in the art. See, for example, Remington, The Science and Practice of Pharmaceuticals, 20th Edition (Lippincott, Williams & Wilkins 2003). Consider the use of such media or agents in the composition, except where any conventional media or agents are incompatible with the active compound.

[0151] As used herein, a “therapeutic effective amount” means an amount of a pharmaceutically active compound sufficient to treat or improve, or in some way alleviate, the symptoms associated with a disease or medical condition. When the reference method is used, the method is sufficient to effectively treat or improve, or in some way alleviate, the symptoms associated with a disease or condition. For example, an effective amount with respect to a disease is an amount sufficient to block or prevent an attack; or, if the pathology of a disease has already begun, to alleviate, improve, stabilize, reverse, or slow the progression of the disease, or otherwise reduce the pathological consequences of the disease. In any case, an effective amount may be given as a single dose or in separate doses.

[0152] As used herein, the terms “treat,” “treatment,” or “treating” include at least improvement in symptoms associated with a disease in a patient, where improvement is broadly used to refer to at least a reduction in the magnitude of a parameter, such as symptoms associated with the disease or symptom being treated. Therefore, “treatment” also includes the complete suppression (e.g., prevention of occurrence) or cessation (e.g., termination) of the disease, condition, or pathological state, or at least the symptoms associated with it, so that the patient no longer suffers from the condition or at least the symptoms characterizing the condition.

[0153] As used herein, unless otherwise stated, the terms “prevent,” “preventing,” and “prevention” mean the prevention of the onset, recurrence, or spread of a disease or condition or one or more of its symptoms. In some embodiments, the terms refer to treatment with or specifically administration of a compound or dosage form provided herein, having one or more other additional active agents, to a subject at risk of having the disease or condition provided herein, prior to the onset of symptoms. These terms cover the suppression or reduction of symptoms of a particular disease. In some embodiments, subjects with a family history of the disease are potential candidates for prevention programs. In some embodiments, subjects with a history of recurrent symptoms are also potential candidates for prevention. In this regard, the term “prevention” may be used interchangeably with the term “preventive treatment.”

[0154] As used herein, unless otherwise stated, a "preventively effective amount" of a compound is an amount sufficient to prevent disease or symptom or to prevent its recurrence. A preventively effective amount of a compound refers to the amount of a therapeutic agent, alone or in combination with one or more other agents, that provides preventive benefit in disease prevention. The term "preventively effective amount" may encompass amounts that improve overall prevention or enhance the preventive efficacy of another preventive agent. As used herein and unless otherwise stated, the term "subject" is defined herein as including animals, such as mammals, including but not limited to primates (e.g., humans), cattle, sheep, goats, horses, dogs, cats, rabbits, rats, mice, etc. In specific embodiments, the subject is a human. The terms "subject" and "patient" are used interchangeably herein, for example, to refer to a mammalian subject, such as a human.

[0155] As used herein, and unless otherwise stated, the compounds described herein are intended to cover all possible stereoisomers unless a specific stereochemistry is specified. Where structural isomers of a compound can interconvert via low energy barriers, the compound may exist as a single tautomer or a mixture of tautomers. This can take the form of proton tautomerism; or so-called valence tautomerism in the compound, such as in compounds containing aromatic moieties.

[0156] "Nucleic acid" or "nucleic acid molecule" refers to a polymeric compound comprising two or more covalently bonded nucleosides or nucleoside analogs or base analogs having nitrogen-containing heterocyclic bases, wherein the nucleosides are linked together by phosphodiester bonds or other bonds to form a polynucleotide. Nucleic acids include RNA, DNA, or chimeric DNA-RNA polymers or oligonucleotides and their analogs. The nucleic acid backbone can be composed of a variety of bonds, including one or more of sugar-phosphodiester bonds, peptide-nucleic acid bonds, thiophosphate bonds, methylphosphonate bonds, or combinations thereof. The sugar moiety of a nucleic acid can be ribose, deoxyribose, or similar compounds with known substitutions (e.g., 2′-methoxy substitution and 2′-halogen substitution). The nitrogenous bases can be conventional bases (A, G, C, T, U) or their analogs (e.g., inosine, 5-methylisocytosine, isoguanine). Nucleic acids may contain only conventional sugars, bases, and bonds as found in RNA and DNA, or they may contain conventional components and substitutions (e.g., conventional bases linked by a 2′-methoxy backbone, or nucleic acids containing a mixture of conventional bases and one or more base analogs). Nucleic acids may contain “locked nucleic acids” (LNAs), in which one or more nucleotide monomers have a bicyclic furanose unit locked in a sugar-mimicking conformation of RNA, which enhances hybridization affinity for complementary sequences in single-stranded RNA (ssRNA), single-stranded DNA (ssDNA), or double-stranded DNA (dsDNA). Nucleic acids may contain modified bases to alter the function or behavior of the nucleic acid (e.g., adding a 3′ dideoxynucleotide to prevent the addition of additional nucleotides to the nucleic acid). Although nucleic acids can be purified from natural sources using conventional techniques, synthetic methods for the in vitro preparation of nucleic acids are well known in the art. Nucleic acids may be single-stranded or double-stranded.

[0157] Nucleic acids are typically single-stranded or double-stranded and usually contain phosphodiester bonds, although in some cases, as described herein, they may contain nucleic acid analogs that may have an alternative backbone, including, for example but not limited to, phosphoramides (Beaucage et al., (1993), Tetrahedron, 49(10): 1925 and references therein; Letsinger (1970), Journal of Organic Chemistry, 35: 3800; Sprinzl et al., (1977), European Journal of Biochemistry, 81: 579; Letsinger et al., (1986), Nucleic Acids Research). Res.), 14:3487; Sawai et al., (1984) Chem. Lett. 805; Letsinger et al., (1988) Journal of the American Chemical Society (J. Am. Chem. Soc.), 110:4470; and Pauwels et al., (1986) Chemica Scripta 26:1419, all of which are incorporated by reference), thiophosphates (Mag et al., (1991) Nucleic Acids Res., 19:1437; and US Patent No. 5,644,048, all of which are incorporated by reference), dithiophosphates (Briu et al., (1989) Journal of the American Chemical Society, 111:2321, all of which are incorporated by reference), O-methylphosphorimide bond (see Eckstein, Oligonucleotides and Analogues: A Practical Approach) Practical Approach), Oxford University Press (1992), which is incorporated by reference, and peptide nucleic acid backbone and bonds (see Egholm (1992), Journal of the American Chemical Society, 114:1895; Meier et al., (1992), Chem. Int. Ed. Engl. 31:1008; Nielsen (1993), Nature, 365:566; and Carlsson et al., (1996), Nature, 380:207, all of which are incorporated by reference).Other similar nucleic acids include those with a positively charged backbone (Denpcy et al., (1995) Proceedings of the National Academy of Sciences, 92:6097, which is incorporated herein by reference); and a nonionic backbone (US Patent Nos. 5,386,023, 5,637,684, 5,602,240, 5,216,141 and 4,469,863; Angew (1991) Chem. Intl. Ed. English 30:423; Letsinger et al., (1988) Journal of the American Chemical Society, 110:4470; Letsinger et al., (1994) Nucleoside & Nucleotide, 13:1597; Chapters 2 and 3, ASC Symposium Series 580 580), “Carbohydrate Modifications in Antisense Research”, Ed. YSSanghvi and P. Dan Cook; Mesmaeker et al., (1994), Bioorganic & Medicinal Chemistry Letters, 4:395; Jeffs et al., (1994), Journal of Biomolecular NMR, 34:17; and Tetrahedron Letters, 37:743 (1996), all of which are incorporated herein by reference) and nonribose backbone, including in U.S. Patent Nos. 5,235,033 and 5,034,506 and ASC Symposium Series 580, Chapters 6 and 7, “Carbohydrate Modifications in Antisense Research”. Those references described in Ed. YSSanghvi and P. Dan Cook, “Research”, are all incorporated herein by reference. Nucleic acids containing one or more carbon-cyclic sugars are also included in the definition of nucleic acids (see Jenkins et al. (1995), Chem. Soc. Rev., pp. 169–176, which is incorporated herein by reference). Several nucleic acid analogs are also described, for example, in Rawls, C&E News, June 2, 1997, page 35, which is incorporated herein by reference. These modifications can be made to the phosphoribosyl backbone to allow for the addition of additional parts such as labels, or to alter the stability and half-life of such molecules in physiological environments.

[0158] In addition to the naturally occurring heterocyclic bases (e.g., adenine, guanine, thymine, cytosine, and uracil) commonly found in nucleic acids, nucleic acid analogs also include those with non-naturally occurring heterocyclic or modified bases, many of which are described herein or otherwise mentioned. In particular, many non-naturally occurring bases are further described, for example, in Seela et al. (1991), *Helv. Chim. Acta*, 74:1790; Grein et al. (1994), *Bioorg. Med. Chem. Lett.*, 4:971-976; and Seela et al. (1999), *Helv. Chim. Acta*, 82:1640, both of which are incorporated herein by reference. For further illustration, certain bases used in nucleotides are optionally included as melting temperatures (modifiers). For example, some of these contain 7-deazonine (e.g., 7-deazonguanine, 7-deazonadenine, etc.), pyrazolo[3,4-d]pyrimidine, propynyl-dN (e.g., propynyl-dU, propynyl-dC, etc.), and so on. See, for example, U.S. Patent No. 5,990,303 entitled “Synthesis of 7-DEAZA-2'-DEOXYGUANOSINE NUCLEOTIDES”, granted to Seela on November 23, 1999, which is incorporated herein by reference. Other representative heterocyclic bases include, for example, hypoxanthine, inosine, xanthine; 8-aza derivatives of 2-aminopurine, 2,6-diaminopurine, 2-amino-6-chloropurine, hypoxanthine, inosine, and xanthine; and 7-deazo-8-aza derivatives of adenine, guanine, 2-aminopurine, 2,6-diaminopurine, 2-amino-6-chloropurine, hypoxanthine, inosine, and xanthine. Biological; 6-azacytosine; 5-fluorocytosine; 5-chlorocytosine; 5-iodocytosine; 5-bromocytosine; 5-methylcytosine; 5-propynylcytosine; 5-bromovinyluracil; 5-fluorouracil; 5-chlorouracil; 5-iodouracil; 5-bromouracil; 5-trifluoromethyluracil; 5-methoxymethyluracil; 5-ethynyluracil; 5-propynyluracil, etc.

[0159] Examples of modified bases and nucleotides are also described in, for example, U.S. Patent No. 5,484,908 entitled "Oligonucleotides containing 5-propynylpyrimidines" granted to Froehler et al. on January 16, 1996; U.S. Patent No. 5,645,985 entitled "Enhanced Triple-Helix and Double-Helix Formation with Oligomers containing Modified Pyrimidines" granted to Froehler et al. on July 8, 1997; and U.S. Patent No. 5,645,985 entitled "Methods of Using Oligomers containing Modified Pyrimidines" granted to Froehler et al. on November 3, 1998. U.S. Patent No. 5,830,653 entitled “[2.2.1] Synthesis of Bicyclic Nucleosides”, granted to Kochkine et al. on October 28, 2003, U.S. Patent No. 6,639,059 entitled “[2.2.1] Synthesis of Bicyclic Nucleosides”, granted to Kochkine et al. on October 16, 2001, U.S. Patent No. 6,303,315 entitled “One Step Sample Preparation and Detection of Nucleic Acids in Complex Biological Samples”, granted to Skov on October 16, 2001, and U.S. Patent Application Publication No. 2003 / 0092905 entitled “[2.2.1] Synthesis of Bicyclic Nucleosides”, published by Kochkine et al. on May 15, 2003, are all incorporated herein by reference.

[0160] "Oligonucleotide" or "oligomery" refers to a nucleic acid containing at least two, usually more than three, and more often more than ten, monomeric units (such as nucleotides). The exact size of an oligonucleotide often depends on various factors, including the final function or use of the oligonucleotide. Oligonucleotides may optionally be prepared by any suitable method, including but not limited to the isolation of existing or natural sequences, DNA replication or amplification, reverse transcription, cloning and restriction digestion of suitable sequences, or direct chemical synthesis by methods such as: the phosphotriester method of Narang et al. (1979), Enzymatic Methods, 68:90-99; the phosphodiester method of Brown et al. (1979), Enzymatic Methods, 68:109-151; the diethylphosphamide method of Beaucage et al. (1981), Tetrahedral Letters 22:1859-1862; the triester method of Matteucci et al. (1981), Journal of the American Chemical Society, 103:3185-3191; automated synthetic methods; or the solid-carrier method of U.S. Patent No. 4,458,066, or other methods known in the art. All of these references are incorporated herein by reference.

[0161] The compounds of this invention and the methods for using them to inhibit RNA viruses comprise the following virus families: Filoviridae, Orthomyxoviridae, Paramyxoviridae, Pneumoviridae, Lepusviridae, Neloviridae, Arenaviridae, Flaviviridae, and Coronaviridae. Exemplary virus names from each family are included in the table below.

[0162]

[0163]

[0164] Example

[0165] Examples of the compounds, pharmaceutical formulations, and methods described herein are provided in the following list:

[0166] Example 1. A compound of formula (I):

[0167]

[0168] Nuc is selected from the group consisting of antiviral nucleosides and antiviral nucleoside analogs; Y is independently selected from hydrogen, C1-C. 30 The group consisting of a hydrocarbon group, a pharmaceutically acceptable cation, and a covalent bond between the carbon atom of the pentose sugar moiety of an antiviral nucleoside or antiviral nucleoside analogue; x is 0 or 1; L is a C1-C6 hydrocarbon group; and R is independently chosen from C. 10 -C 30 The group consisting of hydrocarbon groups and substituents of formula (A);

[0169]

[0170] Where R 1 and R 2 Independently selectable from hydrogen and C1-C 30 A group composed of hydrocarbon groups.

[0171] Example 2. The compound according to Example 1, wherein the antiviral nucleoside or antiviral nucleoside analog is an antiviral ribonucleoside or an antiviral ribonucleoside analog.

[0172] Example 3. The compound according to any of the foregoing examples, wherein Nuc is selected from the group consisting of GS-441524, β-D-N4-hydroxycytidine (NHC) and (2'R)-2-amino-2'-deoxy-2'-fluoro-N,2'-dimethyladenosine.

[0173] Example 4. The compound according to any of the foregoing examples, wherein Nuc is GS-441524:

[0174]

[0175] Example 5. A compound according to any of the foregoing examples, wherein Y is an unsubstituted C1-C6 alkyl, ... 20 Hydrocarbon group, C1-C 10 Hydrocarbon group, C1-C6 hydrocarbon group or Na + .

[0176] Example 6. The compound according to any of the foregoing examples, wherein Y comprises at least one cyclic portion.

[0177] Example 7. A compound according to any of the foregoing examples, wherein Y is selected from the group consisting of aryl, arylalkyl, heteroaryl, heteroarylalkyl and heterocyclic alkyl, each of which is unsubstituted or substituted.

[0178] Example 8. A compound according to any of the foregoing examples, wherein the heteroaryl group is an unsubstituted or substituted pyridyl group.

[0179] Example 9. A compound according to any of the foregoing examples, wherein the aryl alkyl group is an unsubstituted or substituted benzyl group.

[0180] Example 10. A compound according to any of the foregoing examples, wherein the unsubstituted or substituted benzyl group has a structure according to formula (B):

[0181]

[0182] Where R 3R 4 R 5 R 6 and R 7 Independently selected from the group consisting of: hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclic, aryl(alkyl), heteroaryl(alkyl), (heterocyclic)alkyl, hydroxyl, alkoxy, acyl, cyano, halogen, thiocarbonyl, O-carbamoyl, N-carbamoyl, O-thiocarbamoyl, N-thiocarbamoyl, C-acylamino, N-acylamino, S-sulfonylamino, N-sulfonylamino, C-carboxyl, O-carboxyl, isocyanate, thiocyanate, isothiocyanate, nitro, azide, silyl, thionyl, sulfinyl, sulfonyl, haloalkyl, haloalkoxy, trihalomethanesulfonyl, trihalomethanesulfonylamino, amino, monosubstituted amino and disubstituted amino.

[0183] Example 11. The compound according to any of the foregoing examples, wherein R 3 R 4 R 5 R 6 and R 7 At least two of them are hydrogen.

[0184] Example 12. A compound according to any of the foregoing examples, wherein R(i) is an unsubstituted or substituted C 12 -C 24 The hydrocarbon group, (ii) comprising 0 to 6 unsaturated bonds, (iii) comprising a cyclopropyl moiety, or (iv) a combination thereof.

[0185] Example 13. A compound according to any of the foregoing examples, wherein R(i) is an unsubstituted or substituted C 13 -C 29 Heteroalkyl, (ii) comprising 0 to 6 unsaturated bonds, or (iii) combinations thereof.

[0186] Example 14. A compound according to any of the foregoing examples, wherein R is selected from the group consisting of:

[0187] (i) Where a is 1 to 29; and

[0188] (ii) Where b is 1 to 29, c is 0 to 28, and the sum of b and c is 29 or less.

[0189] Example 15. The compound according to any of the preceding examples, wherein (i)a is 15 to 25, or (ii)b is 1 to 4 and c is 15 to 20.

[0190] Example 16. The compound according to any of the preceding examples, wherein (i)a is 19, (ii)b is 3 and c is 15, or (iii)b is 2 and c is 17.

[0191] Example 17. The compound according to any of the foregoing examples, wherein a is 8.

[0192] Example 18. The compound according to any of the foregoing examples, wherein R 1 (i) is an unsubstituted or substituted C 12 -C 24 Hydrocarbon group, (ii) comprising 0 to 6 unsaturated bonds, or (iii) combinations thereof.

[0193] Example 19. The compound according to any of the foregoing examples, wherein (i) R 1 (ii)R 2 Or (iii)R 1 and R 2 Both are independently selected from C1-C, which includes at least one annular portion. 30 Hydrocarbon group.

[0194] Example 20. The compound according to any of the foregoing examples, wherein (i) R 1 (ii)R 2 Or (iii)R 1 and R 2 Both are independently selected from the group consisting of aryl, arylalkyl, heteroaryl, heteroarylalkyl, and heterocyclic alkyl groups, each of which is either unsubstituted or substituted.

[0195] Example 21. A compound according to any of the foregoing examples, wherein the aryl alkyl group is an unsubstituted or substituted benzyl group.

[0196] Example 22. A compound according to any of the foregoing examples, wherein the unsubstituted or substituted benzyl group has a structure according to formula (C):

[0197]

[0198] Where R 8 R 9 R 10 R 11 and R 12Independently selected from the group consisting of: hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclic, aryl(alkyl), heteroaryl(alkyl), (heterocyclic)alkyl, hydroxyl, alkoxy, acyl, cyano, halogen, thiocarbonyl, O-carbamoyl, N-carbamoyl, O-thiocarbamoyl, N-thiocarbamoyl, C-acylamino, N-acylamino, S-sulfonylamino, N-sulfonylamino, C-carboxyl, O-carboxyl, isocyanate, thiocyanate, isothiocyanate, nitro, azide, silyl, thionyl, sulfinyl, sulfonyl, haloalkyl, haloalkoxy, trihalomethanesulfonyl, trihalomethanesulfonylamino, amino, monosubstituted amino and disubstituted amino.

[0199] Example 23. The compound according to any of the foregoing examples, wherein R 8 R 9 R 10 R 11 and R 12 At least two of them are hydrogen.

[0200] Example 24. A compound according to any of the foregoing examples, wherein the substituent of formula (A) is a racemic mixture, a sn-1 stereoisomer, or a sn-3 stereoisomer.

[0201] Example 25. The compound according to any of the foregoing examples, wherein

[0202] (i)R 1 Choose from the following groups:

[0203] (a) Where d is from 1 to 29; and

[0204] (b)

[0205] Where e is 1 to 27, f is 0 to 26, and the sum of e and f is 27 or less;

[0206] (ii)R 2 Choose from the following groups:

[0207]

[0208]

[0209] Where g is 1 to 29; or

[0210] (iii) Its combination.

[0211] Example 26. The compound according to any of the foregoing examples, wherein g is 5 to 10.

[0212] Example 27. The compound according to any of the foregoing examples, wherein g is 7.

[0213] Example 28. A compound according to any of the foregoing examples, wherein x is 1 and L is an unsubstituted or substituted C1-C3 hydrocarbon group.

[0214] Example 29. A compound according to any of the foregoing examples, wherein L is selected from the group consisting of unsubstituted methyl, unsubstituted ethyl and unsubstituted propyl.

[0215] Example 30. A pharmaceutical preparation comprising the compound according to any one of Examples 1 to 29.

[0216] Example 31. The pharmaceutical formulation according to Example 30, wherein the pharmaceutical formulation is orally bioavailable.

[0217] Example 32. The pharmaceutical preparation according to Example 30, wherein the pharmaceutical preparation is formulated for intramuscular injection.

[0218] Example 33. A method for treating coronavirus infection in a mammal, the method comprising administering to the mammal an effective amount of a compound according to any one of Examples 1 to 29, or a pharmaceutical preparation according to any one of Examples 30 to 32.

[0219] Example 34. A method for treating viral infection in a mammal, the method comprising administering to the mammal an effective amount of a compound according to any one of Examples 1 to 29 or a pharmaceutical preparation according to any one of Examples 30 to 32, wherein the virus is an RNA virus selected from the group consisting of the families of viruses including Filoviridae, Orthomyxoviridae, Paramyxoviridae, Pneumoviridae, Lepusviridae, Neloviridae, Arenaviridae, Flaviviridae, and Coronaviridae.

[0220] Example 35. A method for producing a prodrug, the method comprising:

[0221] (i) Provide compounds of formula (a):

[0222]

[0223] (ii) Provide compounds of formula (b):

[0224]

[0225] (iii) Contacting the compound of formula (a) and the compound of formula (b) to form the compound of formula (c):

[0226]

[0227] (iv) Contacting the compound of formula (c) with an acid to form the compound of formula (d):

[0228]

[0229] Where Het is a C1-C bond containing at least one heteroatom. 30 Hydrocarbon group; Y is selected from hydrogen and C 1 -C 30 A group consisting of hydrocarbon groups and pharmaceutically acceptable cations; x is 0 or 1; L is a C1-C6 hydrocarbon group; and R is selected from C 10 -C 30 The group consisting of hydrocarbon groups and substituents of formula (A);

[0230]

[0231] Where R 1 and R 2 Independently selectable from hydrogen and C1-C 30 A group composed of hydrocarbon groups.

[0232] Example 36. A method for producing a prodrug according to any of the foregoing examples, wherein the contact between the compound of formula (a) and the compound of formula (b) occurs in the presence of N,N-dicyclohexylcarbodiimide, 4-dimethylaminopyridine, or a combination thereof.

[0233] Example 37. A method for producing a prodrug according to any of the foregoing examples, wherein the acid includes HCl.

[0234] Example 38. A method for producing a prodrug according to any of the foregoing examples, wherein the contact of formula (c) with the acid occurs in the presence of tetrahydrofuran (THF).

[0235] Example 39. A method for producing a prodrug according to any of the foregoing examples, wherein Het is selected from the group consisting of:

[0236]

[0237] Example 40. A method for producing a prodrug according to any of the foregoing examples, further comprising carrying out an intramolecular esterification reaction of a compound of formula (d) to form a cyclic phosphate ester, such as a 3′,5′-cyclic phosphate ester.

[0238] Example 41. A method for producing a drug triphosphate, the method comprising providing a plurality of cells, contacting the plurality of cells with a certain amount of drug, and incubating the plurality of cells and the amount of drug for a period of time for effective formation of the drug triphosphate.

[0239] Example 42. The method according to Example 41, wherein the plurality of cells includes Vero E6 cells.

[0240] Example 43. The method according to Example 41 or 42, wherein the drug comprises remdesivir.

[0241] Example

[0242] The invention is further illustrated by the following examples, which in no way should be construed as limiting the scope of the invention. Rather, it should be clearly understood that various other aspects, embodiments, modifications, and equivalents may be employed, as described herein after reading the description, and are intended to imply to those skilled in the art without departing from the spirit of the invention or the scope of the appended claims. Therefore, other aspects of the invention will be apparent to those skilled in the art from the description and practice of the invention disclosed herein.

[0243] Example 1 – Preparation of Compounds

[0244] In this example, several general methods are used to produce a variety of products and / or intermediates, but other known synthetic techniques may also be used.

[0245] Synthesis of Alkyl and Alkoxyalkyl Esters of 5′-Monophosphate (A.GS-441524)

[0246]

[0247] Scheme 1. Synthesis of alkyl and alkoxyalkyl esters of 5'-monophosphate (GS-441524). Reagents: a) POCl3, TEA, THF; b) GS-441524 acetone compound, DCC / DMAP or DIC / NMI, pyridine; c) formic acid, room temperature or concentrated HCl / THF; d) PyBOP, DIEA, DMF

[0248] Synthesis of alkyl and alkoxyalkyl phosphates (Scheme 1, 2a-c)

[0249] General Method A.

[0250] The long-chain alcohol 1a-c was phosphorylated to provide phosphate esters 2a-c, as previously described (Ruiz, J., Beadle, JR, Aldern, KA, Keith, K., Hartline, C., Kern, E., Hostetler, KY (2007), “Synthesis and antiviral evaluation of alkoxyalkyl-phosphate conjugates of cidofovir and adefovir,” *Antiviral Res.*, 75, 87-90). Briefly, a solution of the long-chain alcohol (1 equivalent) and triethylamine (2 equivalents) in anhydrous tetrahydrofuran (THF) was added dropwise to a solution of phosphorus oxychloride (1.5 equivalents) in THF with stirring, while the temperature was kept below 20°C. Continue stirring at 0°C for an additional hour, then add water and continue stirring overnight, followed by extraction with diethyl ether. The crude solid from the ether layer is recrystallized from hexane to give phosphate esters 2a-c.

[0251] 2a Eicosyl phosphate dihydrogen salt 1 ¹H NMR (400MHz, chloroform-d) δ 8.30 (s, 1H), 3.98 (t, 2H), 1.61 (m, 1H), 1.26 (br s, 16H), 0.86 (t, 1H). ESI-MS 650.38 [MH] -

[0252] 2b 3-(hexadecyloxy)propyl phosphate dihydrogen ester 1 ¹H NMR (400MHz, chloroform-d) δ 4.03 (dt, 2H), 3.49 (t, 2H), 3.40 (t, 2H), 1.94 (p, 2H), 1.59–1.55 (m, 2H), 1.26 (br s, 18H), 0.86 (t, 3H).

[0253] 2c 2-(octadecyloxy)ethyl dihydrogen phosphate 1 ¹H NMR (400 MHz, chloroform-d) δ 4.12 (dt, 2H), 3.77 (t, 2H), 3.42 (t, 2H), 1.29 (br s, 20H), 0.94–0.85 (t, 3H).

[0254] Coupling of phosphate ester 2a-c with GS-441524 acetone (remdesivir nucleoside, RVn acetone)

[0255] General Method B.

[0256] N,N-dicyclohexylcarbodiimide (DCC, 1.5 equivalents) was added to a mixture of GS-441524 acetone (1 equivalent, CAS#1191237-80-5, purchased from Ontario Chemicals) in dried pyridine, a long-chain dihydrogen phosphate (1.0 equivalent), and 4-dimethylaminopyridine (DMAP, 1.0 equivalent). The mixture was then heated to 90 °C and stirred for 24 hours. Water was added to quench the reaction, and the pyridine was evaporated under vacuum. The residue was adsorbed onto silica gel and purified by rapid column chromatography on silica gel 60. Gradient elution (CH2Cl2 / methanol 10-20%) yielded the protected phosphate diester compound.

[0257] General method C.

[0258] N,N-diisopropylcarbodiimide (DIC, 3.3 mmol) was added to a mixture of GS-441524 acetone (1.65 mmol), lipid phosphate (1.65 mmol), and 1-methylimidazole (NMI, 406 mg, 4.95 mmol) in dried pyridine (30 mL). The mixture was then stirred at room temperature for 48 hours until analysis of the reaction mixture by TLC indicated the formation of a large amount of coupling product. Water (5 mL) was then added, and the mixture was concentrated on a rotary centrifuge. The residue was adsorbed onto silica gel and purified by rapid column chromatography on silica gel 60. Gradient elution (100% CH2Cl2 to CH2Cl2 / 20% methanol) yielded the protected phosphate diester analog.

[0259] 3a Eicosyl phosphate RVn acetone. GS-441524 acetone was coupled to 2a according to general method C. Analyzed by ESI-MS 690.50 [MH]. - Confirm the structure.

[0260] 3b 3-(hexadecyloxy)propyl phosphate-RVn acetone. GS-441524 acetone was coupled with 2b according to general method B. N,N-dicyclohexylcarbodiimide (DCC, 619 mg, 3 mmol) was added to a mixture of GS-441524 acetone (300 mg, 0.91 mmol), 3-(hexadecyloxy)propyl phosphate (2b, 414 mg, 1.10 mmol), and 4-dimethylaminopyridine (DMAP, 122 mg, 1.0 mmol) in 25 mL of dry pyridine. The mixture was then heated to 90 °C and stirred for 24 hours. The pyridine was then evaporated, and the residue was purified by rapid column chromatography on silica gel 60. Gradient elution (CH2Cl2 / methanol 10–20%) gave 423 mg (67% yield) of compound 3b. 1 ¹H NMR (500MHz, chloroform-d) δ 8.42 (s, 1H), 7.98 (s, 1H), 7.70 (s, 2H), 6.22 (d, J = 6.0 Hz, 1H), 5.68 (d, J = 6.2 Hz, 1H), 5.15 (d, J = 1.0 Hz, 1H), 4.70 (dd, J = 3.8, 0.9 Hz, 1H), 4.48–4.42 (m, 1H), 4.26 (ddd, J = 11.2, 8.5, 2.6 Hz, 1H), 4.15 (ddd,J=11.1,8.5,2.6Hz,1H),4.02(dt,J=8.5,6.3Hz,2H),3.49(t,J=6.1Hz,2H),3.40(t,J=6.1Hz,2H),1. 95(p,J=6.2Hz,2H),1.54(tt,J=7.4,6.1Hz,2H),1.31(s,3H),1.32–1.24(m,26H),0.94–0.85(m,3H).ESI-MS 691.6[MH] - .

[0261] 3c 2-(octadecyloxy)ethyl phosphate-RVn acetone. GS-441524 acetone was coupled with 2c according to general method B. N,N-dicyclohexylcarbodiimide (DCC, 0.3 g, 1.4 mmol) was added to a mixture of GS-441524 acetone (0.23 g, 0.7 mmol), phosphate ester 2c (0.27 g, 0.68 mmol), and 4-dimethylaminopyridine (DMAP, 0.07 g, 0.6 mmol) in 10 mL of dry pyridine. The mixture was then heated to 90 °C and stirred for 3 days. The pyridine was then evaporated, and the residue was purified by rapid column chromatography on silica gel 60. Gradient elution (CH2Cl2 / methanol 10–20%) gave 0.22 g (45% yield) of phosphate diester 3c.

[0262] Synthesis of 4a-c: Removal of protecting groups from acetone compounds

[0263] General method D. (HCl / THF)

[0264] At room temperature, concentrated HCl (0.1 mL) in tetrahydrofuran (THF, 1 mL) was added to a stirred solution of acetone-protected (2',3'-isopropylidene) phosphate diester (0.25 mmol) in THF (10 mL). The mixture was stirred for 3 hours, and then sodium bicarbonate (50 mg) and water (2 mL) were added. After stirring for an additional 15 minutes, the solvent was evaporated, and cold water (10 mL) was added to the residue. The crude product was collected by vacuum filtration and dried under vacuum. Purification by rapid column chromatography (100% CH2Cl2 to CH2Cl2 / 35% methanol) yielded a pure phosphate diester analog.

[0265] General Method E.

[0266] At room temperature, an acetone analogue (1 mmol) was added to formic acid (25 mL) and stirred. The reaction was monitored by TLC until deprotection was complete in approximately 4 hours. Formic acid was removed by rotary evaporation, and the residue was co-evaporated with EtOH (2 × 25 mL), then adsorbed onto silica gel and purified by rapid column chromatography. Gradient elution (100% CH₂Cl₂ to CH₂Cl₂ / 35% methanol) gave the product.

[0267] 4a-Eicosylphosphonic acid-RVn – prepared from 3a according to general method E. Resolved by ESI-MS 650.38 [MH]. - Confirm the structure.

[0268] 4b 3-(hexadecyloxy)propyl phosphate RVn. Prepared from 3b according to general method D. At room temperature, concentrated HCl (0.1 mL) in tetrahydrofuran (THF, 1 mL) was added to a stirred solution of 3b (100 mg, 0.14 mmol) in THF (10 mL). The mixture was stirred for 3 hours, and then sodium bicarbonate (50 mg) and water (2 mL) were added. After stirring for an additional 15 minutes, the solvent was evaporated, and cold water (10 mL) was added to the residue. The solid product was collected by vacuum filtration and dried under vacuum to give 4b (79 mg, 87% yield) as a grayish-white solid. 1H NMR(500MHz, CDCl3-methanol-d4)δ8.42(s,1H),7.98(s,1H),7.70(s,1H),6.22(d,J=6.0Hz,1H),5.70(d,J=6.0Hz,1H), 5.12(d,J=4.2Hz,1H),4.55(ddd,J=5.5,2.7,0.9Hz,1H),4.40(dtd,J=6.8,2.6,0.8Hz,1H),4.33–4.27(m,2H),4. 25(ddd,J=11.1,8.4,2.6Hz,1H),4.16(ddd,J=11.3,8.5,2.6Hz,1H),4.02(dt,J=8.5,6.3Hz,2H),3.49(t,J=6.1H z,2H),3.40(t,J=6.1Hz,2H),1.95(p,J=6.2Hz,2H),1.59–1.50(m,1H),1.34–1.24(m,23H),0.94–0.85(m,3H).ESI MS:652.39[MH] - Purity as determined by HPLC: 99.7%

[0269] 4c 2-(octadecyloxy)ethyl-phosphoric acid-RVn, which was prepared from 3c according to general method D. At 0 °C, concentrated HCl (0.3 mL) was slowly added to a stirred solution of 3c (0.2 g, 0.28 mmol) in THF (10 mL). The mixture was allowed to heat to room temperature overnight, then diluted with water (2 mL) and adjusted to pH 8 by adding saturated sodium bicarbonate. The product was extracted with chloroform (3 × 30 mL), and the organic layer was concentrated under reduced pressure. The residue was purified by rapid chromatography on silica gel. Elution with 20% MeOH / CH2Cl2 gave 0.10 g (55% yield) of compound 4c. 1 H NMR (400MHz, CDCl3-methanol-d4) δppm7.89(s,1H),6.94(d,J=4.65Hz,1H),6.89(d,J=4.65Hz ,1H),4.40(d,J=4.65Hz,2H),4.21-4.28(m,1H),4.12-4.20(m,1H),4.04-4.12(m,1H),3 .91(d,J=4.89Hz,2H),3.46-3.57(m,2H),3.42(td,J=6.85,1.96Hz,2H),3.34(dt,J=3. 18,1.59Hz,2H),1.53(d,J=6.85Hz,2H),1.20-1.37(m,30H),0.89(t,J=6.97Hz,3H).ESI MS:666.43[MH]- The purity was 98.4% as determined by HPLC.

[0270] Synthesis of B.2-(octadecyloxy)ethylbenzylphosphonic acid-RVn (long-acting formulation) (Scheme 1, 6c)

[0271] Compound 3c (160 mg, 0.22 mmol), benzyl alcohol (48 mg, 0.45 mmol), diisopropylethylamine (DIEA, 58 mg, 0.45 mmol), and (1H-benzotriazol-1-yloxy)-tripyrrolidinephosphonium hexafluorophosphate (PyBOP, 230 mg, 0.45 mmol) were stirred at room temperature for 3 hours. The DMF was then evaporated, and the residue was dissolved in ethyl acetate (50 mL) and washed with saturated NaHCO3 (3 x 10 mL). The organic layer was dried over MgSO4 and concentrated. The residue was purified by column chromatography on silica gel, eluting with chloroform / methanol (0–15%) to give 5c (60 mg, 35% yield). 1 H NMR (400MHz, CDCl3-CD3OD) δppm 7.87(d,J=4.03Hz,1H),7.27-7.37(m,5H),6.91-6.95(m,1H),6.83-6.89(m,1H),5.41( d,J=6.97Hz,1H),4.92-5.06(m,3H),4.54-4.60(m,1H),4.24-4.31(m,2H),4.07-4.15(m ,2H),3.53-3.60(m,2H),3.38-3.51(m,2H),3.32-3.37(m,2H),1.78-1.96(m,2H),1.75 (s,3H),1.50-1.60(m,2H),1.42(s,3H),1.15-1.38(m,30H),0.89(t,J=6.54Hz,3H).ESI MS:798.51[M+H] + 820.56 [M+Na] + .

[0272] At 0°C, concentrated HCl (0.1 mL) was added to a solution of 5c (60 mg, 0.075 mmol) in THF (2 mL). After 20 minutes, the ice bath was removed, and the reaction was monitored by TLC. After 3 hours, the mixture was returned to the ice bath and neutralized with saturated NaHCO3. The mixture was concentrated under vacuum, and the residue was purified by column chromatography (silica gel, dichloromethane / methanol 10-20%) to give 35 mg (62% yield) of 6c. 1¹H NMR (400MHz, CDCl₃ + methanol d₄) δppm 7.84-7.90 (m, 1H), 7.29-7.38 (m, 5H), 6.89-6.93 (m, 1H), 6.82-6.86 (m, 1H), 5.03 (d, J = 11.36Hz, 2H), 4.76-4.81 (m, 1H), 4.40-4.45 (m, 1H), 4.30-4.37 (m, 1H), 4.17-4.31 (m, 2H), 4. 06-4.14(m,2H),3.54-3.60(m,2H),3.39-3.47(m,2H),3.33-3.37(m,2H),3.12-3.18(m,2 H),1.82-1.91(m,2H),1.49-1.59(m,2H),1.20-1.37(m,30H),0.89(t,J=6.60Hz,3H).ESI MS:758.32[M+H] + 780.43 [M+Na] + .

[0273] Synthesis of 1-O-alkyl-2-O-substituted sn-glycerol esters of 5'-monophosphate (C.GS-441524)

[0274] The following scheme (Scheme 2) describes an example of the synthesis method for producing the following embodiments of 1-O-alkyl-2-O-substituted -sn-glycerol ester of GS-441524 5'-monophosphate.

[0275]

[0276] Scheme 2.1 Synthesis of -O-alkyl-2-O-substituted -sn-glycerol. Reagents: a) R1 bromide or methanesulfonate, NaH, DMF; b) 80% CH3COOH, reflux; c) triphenylmethyl chloride, TEA, DMAP, CH2Cl2; d) R2 bromide or methanesulfonate, NaH, DMF; e) acidic deprotection.

[0277] Synthesis of 1-O-alkyl-sn-glycerol (Scheme 2, 10a-d)

[0278] General method F.

[0279] In this embodiment, as described in the literature (Fernández, DM; Contreras, LJ; Moreno, BM; Silva, EG; Mayorga, HW, “Enantiomeric synthesis of natural alkylglycerols and their antibacterial and antibiofilm activities”, *Nat. Prod. Res.*, 2019, 1–7), alkyl methanesulfonate was used for the alkylation of 2,3-isopropylglycerol. Briefly, sodium hydride and DMF were stirred in a flask. Isopropylglycerol was slowly added (hydrogen evolution!), and cooling was applied if necessary to maintain the temperature below 35°C. Stirring was continued for an additional 30 minutes. The alkyl methanesulfonate was added all at once, and the mixture was stirred vigorously for 5 hours. The reaction mixture was poured onto crushed ice and stirred gently. The solids were collected in a glass funnel. The mixture was washed with water. Deprotection: The filter cake was added to 80% acetic acid and heated at 80°C for 1 hour. The flask was cooled, and the crystallized product was collected, filtered under vacuum, and dried. The crude product was recrystallized in hexane or purified by rapid column chromatography on silica gel 60.

[0280] General method G. (using alkylation of 1-bromoalkane / olefin, as described in the literature: (Halldorsson, A. et al., Tetrahedron: Asymmetry, 2004, 15, 2893-2899).

[0281] In short, isopropylglycerol (1 equivalent), 1-bromoalkane / olefin (1 equivalent), and tetrabutylammonium bromide (0.2 equivalent) were vigorously stirred in a round-bottom flask. Grinded potassium hydroxide (2 equivalents) was slowly added, and the mixture was stirred in an oil bath at 35–40 °C for approximately 15 hours. The alkylated product was extracted into hexane, and the organic phase was washed with H₂O and then evaporated to give 1-O-alkyl-2,3-isopropyl-sn-glycerol. Deprotection: The product was refluxed overnight with p-toluenesulfonic acid (10 mol%) in THF / water. After concentration under vacuum, the residue was dissolved in diethyl ether, washed with a solution of water and brine, dried over anhydrous magnesium sulfate, and the solvent was removed under vacuum on a rotary evaporator to give 1-O-alkyl-sn-glycerol.

[0282] 10a.1-O-tetradecyl-sn-glycerol. Synthesized according to general method F. Analytical data are consistent with literature values ​​(Barragán, CA; Silva, EG; Moreno, BM; Mayorga, HW, "Inhibition of quorum sensing by compounds from two Eunicea species and synthetic saturated alkylglycerols", Vitae, 2018, 25, 92–103).

[0283] 10b.1-O-hexadecyl-sn-glycerol was purchased from Bachem America.

[0284] 10c.1-O-octadecyl-sn-glycerol was purchased from Bachem America.

[0285] 10d. 1-O--sn-glycerol. Synthesized according to general method G. A mixture of oleyl bromide (541 mg, 1.63 mmol), Bu4NBr (0.2 equivalents), 2,3-isopropylidene-sn-glycerol (1 equivalent), and KOH (powder, 2.5 equivalents) was stirred overnight at 40 °C. Post-treatment yielded 583 mg of crude product 9d as an oil. Crude product 9d was treated overnight with p-TsOH·H2O (0.15 equivalents) in refluxed THF (6 mL) and H2O (2.5 mL). The crude oil (540 mg) was purified by rapid column chromatography (MeOH in DCM 0-8%) to give 420 mg of 1-O-oleyl-sn-glycerol 10d as an oil. Yield 75% (two steps). 1 ¹H NMR (CDCl₃) δ 5.36–5.33 (m, 2H), 3.86–3.85 (m, 1H), 3.72 (dd, 1H), 3.62 (dd, 1H), 3.52 (dd, 1H), 3.46 (dd, 1H), 3.50–3.42 (m, 2H), 2.02–1.99 (m, 4H), 1.59–1.55 (quadbit, 2H), 1.35–1.26 (m, 22H), 0.88 (t, 3H) ESI-MS: 343.67 [M+H] + 365.61 [M+Na] + .

[0286] Synthesis of 1-O-alkyl-2-O-substituted -sn-glycerol (Scheme 2, 12a-m)

[0287] General method H.

[0288] The protection of the 3-hydroxyl group of 1-O-substituted sn-glycerol was carried out as described in the literature: (Kini, GD, Hostetler, SE, Beadle, JR, Aldern, KA, “Synthesis and antiviral activity of 1-O-octadecyl-2-O-alkyl-sn-glycero-3-foscarnet conjugates in human cytomegalovirus-infected cells”, *Antiviral Research*, 1997, 36, 115; and Huang, Z., Szoka, Z. (2008), “Sterol-Modified Phospholipids: Cholesterol and Phospholipid Chimeras with Improved Biomembrane Properties”. (Biomembrane Properties), JAMA Journal, 130, 15702-15712. Briefly, triethylamine (1.5 equivalents) was added to a solution of 1-O-alkyl-sn-glycerol (1 equivalent), N,N-dimethylaminopyridine (DMAP, 0.1 equivalents), and triphenylchloro(TrCl, 1.5 equivalents) in anhydrous dichloromethane, and the mixture was stirred for 18 hours. The reaction mixture was then quenched with water, evaporated, and adsorbed onto silica gel, and purified by rapid column chromatography on silica gel. The correct fraction was eluted by a gradient of ethyl acetate in hexane (0-20%).

[0289] 11a 1-O-tetradecyl-3-O-triphenylmethyl-sn-glycerol – prepared as described in the literature (Huang, Z., Szoka, Z. (2008), “Sterol-modified phospholipids: cholesterol and phospholipid chimeras with improved biomembrane properties”, JAMA Journal, 130, 15702-15712).

[0290] 11b 1-O-hexadecyl-3-O-triphenylmethyl-sn-glycerol - prepared as described in the literature (Huang, Z., Szoka, Z. (2008), "Sterol-modified phospholipids: cholesterol and phospholipid chimeras with improved biomembrane properties", JAMA Journal, 130, 15702-15712).

[0291] 11c 1-O-octadecyl-3-O-triphenylmethyl-sn-glycerol. Prepared from 10c by general method H. Yield 87%. 1 H NMR(CDCl3): δ0.9(t,3H),1.3(bs,30H),1.55(m,4H)3.2(m,2H),3.4–3.6(m,3H),3.95(m,1H)7.2–7.5(m,15H).

[0292] 11d 1-O-oleylenyl-3-O-triphenylmethyl-sn-glycerol. Prepared from 10d according to general method H. Yield 77%. 1 H NMR (CDCl3), δ0.88 (t, J = 7.2, 3H); 1.27 (br, 22H); 1.55 (m, 2H); 2.0 (m, 4H); 2.40 (br, 1H); 3 .20(m,2H);3.41-3.56(m,4H);3.95(m,1H);5.35(m,2H);7.25(m,9H);7.45(m,6H).ESI-MS 607.75[M+Na] +

[0293] General Method I.

[0294] Alkylation and deprotection of 1-O-alkyl-3-O-triphenylmethyl-sn-glycerol were carried out as previously described (Kini, GD, Hostetler, SE, Beadle, JR, Aldern, KA, “Synthesis and antiviral activity of 1-O-octadecyl-2-O-alkyl-sn-glycero-3-phosphocarboxylate conjugates in human cytomegalovirus-infected cells,” *Antiviral Research*, 1997, 36, 115). Briefly, sodium hydride (2.5 equivalents) was added to a stirred solution of 1-O-alkyl-3-O-triphenylmethyl-sn-glycerol (1 equivalent) in DMF at 0 °C. After 20 minutes, R2- (1.8 equivalents) of a brominated or methanesulfonate derivative was added. The reaction mixture was then stirred at room temperature for 5 hours or until the reaction was substantially complete as detected by TLC. Post-treatment and column chromatography yielded 1-O-alkyl-2-O-substituted -3-O-triphenylmethyl-sn-glycerol, which was detriphenylmethylated by acid.

[0295] 12a 1-O-tetradecyl-2-O-benzyl-sn-glycerol – prepared by general method I from 11a and benzyl bromide. ESI-MS: 401.51 [M+Na] + Confirm the structure.

[0296] 12b 1-O-hexadecyl-2-O-benzyl-sn-glycerol - prepared from 11b and benzyl bromide according to general method I. 1 HNMR (300MHz, CDCl3): δ7.36-7.27(m,5H),4.65(m,2H),3.79-3.59(m,5H),3.55(t,2H),1.57-1.51(m,2H),1.29(br s,26H),0.89(t,3H).

[0297] 12c 1-O-hexadecyl-2-O-(3-fluoro-4-methoxybenzyl)-sn-glycerol was prepared from 11b and 3-fluoro-4-methoxybenzyl bromide according to general method I.

[0298] 12d 1-O-octadecyl-2-O-benzyl-sn-glycerol,

[0299] 12e 1-O-octadecyl-2-O-benzyl-rac-glycerol,

[0300] 12f 1-O-octadecyl-2-O-octyl-sn-glycerol,

[0301] 12g 1-O-octadecyl-2-O-(cyclohexylmethyl)-sn-glycerol,

[0302] 12h 1-O-octadecyl-2-O-(3-fluorobenzyl)-sn-glycerol,

[0303] 12i 1-O-octadecyl-2-O-(4-methoxybenzyl)-sn-glycerol,

[0304] 12j 1-O-octadecyl-2-O-(3-fluoro-4-methoxybenzyl)-sn-glycerol, and

[0305] 12k 1-O-octadecyl-2-O-(pyridin-3-yl-methyl)-sn-glycerol is prepared from 11c and a suitable bromide according to general method I.

[0306] 12L 1-O-oleenoyl-2-O-benzyl-sn-glycerol. Sodium hydride (1.3 equivalents) was added to 11d (531 mg, 0.91 mmol) in DMF (4 mL) at 0 °C. The resulting mixture was stirred at room temperature for 1 hour, followed by the addition of benzyl bromide (1.3 equivalents). The reaction mixture was stirred overnight at room temperature. Post-treatment and column chromatography yielded 354 mg of crude product, with 200 mg of 11d also recovered. Deprotection gave 12L. 1¹H NMR (300MHz, chloroform-d) δ 7.35–7.26 (m, 4H), 5.36–5.32 (m, 2H), 3.84–3.62 (m, 5H), 3.54–3.46 (m, 2H), 3.44 (t, 2H), 2.88–2.75 (m, 2H), 2.02 (m, 4H), 1.54–1.50 (pentet 2H), 1.29 (br s, 22H), 0.88 (t, 3H). 455.73 [M+Na] +

[0307] 12m 1-O-oleylenyl-2-O-(3-fluoro-4-methoxybenzyl)-sn-glycerol. Prepared from 11d and 3-fluoro-4-methoxybenzyl bromide according to general method I. 1 ¹H NMR (300MHz, chloroform-d) δ 7.12 (m, 2H), 6.95 (t, 1H), 5.36–5.32 (m, 2H), 4.65–4.52 (dd, 2H), 3.75–3.70 (m, 2H), 3.67–3.60 (m, 2H), 3.57–3.55 (m, 2H), 3.45 (t, 2H), 2.01–1.97 (m, 2H), 1.28 (br s, 16H), 0.87 (t, 3H). ESI-MS: 50 3.79 [M+Na] +

[0308] GS-441524 Synthesis of 1-O-alkyl-2-O-substituted -sn-glycerol esters of 5′-monophosphate (Scheme 3, 15a-m)

[0309] The following scheme describes an example of the synthetic steps for producing 1-O-alkyl-2-O-substituted -sn-glycerol ester of GS-441524 5'-monophosphate.

[0310]

[0311] Scheme 3. GS-441524 Synthesis of 1-O-alkyl-2-O-substituted sn-glycerol esters of 5'-monophosphate. Reagents: a) POCl3 or bis(trichloroethyl) chlorophosphate / zinc powder; b) DCC / DMAP or DIC / NMI, pyridine; c) formic acid or concentrated HCl / THF.

[0312] Phosphorylation of 1-O-alkyl-2-O-substituted sn-glycerol was performed as described in the literature (Kates, M., Adams, GA, Blank, ML, Snyder, FM (1991), “Chemical synthesis and physiological activity of sulfonium analogues of platelet activating factor,” *Lipids*, 26, 1095-1101). Briefly, 1-O-alkyl-2-O-substituted sn-glycerol (11.5 mmol) and 1-methylimidazole (14.4 mmol) were dissolved in dry pyridine (100 mL) and stirred at room temperature. A solution of di(trichloroethyl)chlorophosphate (5.5 g, 14.4 mmol) in diethyl ether (20 mL) was added dropwise over 10 minutes, and the mixture was stirred overnight. Analysis by TLC showed complete phosphorylation. Water (10 mL) was added to quench excess reagent, and the mixture was then concentrated by rotary evaporation and co-evaporated with toluene to remove pyridine. The residue was adsorbed onto silica gel 60 (approximately 30 g) and purified by rapid column chromatography. Gradient elution from 100% hexane to 25% EtOAc / hexane was used to separate the protected phosphorylation product.

[0313] The product (9.65 mmol) was dissolved in a mixture of chloroform (50 mL) and glacial acetic acid (90 mL), then stirred vigorously and cooled in an ice-water bath. Zinc powder (5 g) was added to the mixture, and the mixture was stirred for 1 hour. The ice-water bath was then removed, and stirring continued for another 2 hours. Residual zinc was removed by vacuum filtration, and the clear filtrate was concentrated by rotary evaporation. The residue was dissolved in 20% MeOH / CH₂Cl₂ (250 mL) and extracted with 1 M HCl (3 x 50 mL). The organic layer was then concentrated and co-evaporated with ethanol (2 x 50 mL). The waxy residue was dissolved in 1,4-dioxane, frozen, and then lyophilized under vacuum (18 hours) to provide glycerol phosphate.

[0314] Compounds 13a, 13b, 13c, 13d, 13e, 13f, 13g, 13h, 13i, 13j and 13k were prepared according to general method J.

[0315] 13l 1-O-oleylenyl-2-O-benzyl-sn-glycero-3-phosphate. Prepared according to general method A. 1H NMR (300MHz, chloroform-d) δ7.36–7.23(m,5H),5.36–5.32(m,2H),4.69(d,J=11.9Hz,1H),4.62(d,J=11.8Hz,1H),4.11–4.09(m,2H ),3.80–3.77(m,2H),3.76–3.69(m,1H),3.53–3.47(m,1H),3.42(t,2H),2.00(tq,J=7.1,3.7Hz,4H),1.50(m,2H),1.26(br s,22H),0.87(t,3H).ESI-MS:513.72[M+1] +

[0316] 13m 1-O-oleylenyl-2-O-(3-fluoro-4-methoxybenzyl)-sn-glycero-3-phosphate. Prepared according to general method A.

[0317] Coupling of phosphate ester 13a-m with GS-441524 acetone (remdesivir nucleoside, RVn acetone)

[0318] 14a 1-O-tetradecyl-2-O-benzyl-sn-glycero-phosphate-RVn acetone compound - prepared according to general method C from GS-441524 acetone compound and 13a. Resolved by ESI-MS 770.50 [MH]. - Confirm the structure.

[0319] 14b 1-O-hexadecyl-2-O-benzyl-sn-glycero-phosphate-RVn acetone compound - prepared according to general method C from GS-441524 acetone compound and 13b

[0320] 14c 1-O-hexadecyl-2-O-(3-fluoro-4-methoxy-benzyl)-sn-glycero-phosphate-RVn acetone compound - prepared according to general method C from GS-441524 acetone compound and 13c

[0321] 14d 1-O-octadecyl-2-O-benzyl-sn-glycero-phosphate-RVn acetone compound was prepared according to general method B from GS-441524 acetone compound and 13d. N,N-dicyclohexylcarbodiimide (DCC, 310 mg, 1.5 mmol) was added to a mixture of acetone compound (300 mg, 0.91 mmol), phosphate ester 13d (515 mg, 1.0 mmol), and 4-dimethylaminopyridine (DMAP, 122 mg, 1.0 mmol) in 25 mL of dry pyridine. The mixture was then heated to 90 °C and stirred for 24 h. The pyridine was then evaporated, and the residue was purified by rapid column chromatography on silica gel 60. Gradient elution (CH2Cl2 / methanol 10–20%) gave 210 mg (28% yield) of compound 14d. ESI MS 826.58 [MH] - .

[0322] 14e 1-O-octadecyl-2-O-benzyl-rac-glycero-phosphate-RVn acetone. - Prepared according to general method C from GS-441524 acetone and 13e.

[0323] 14f 1-O-octadecyl-2-O-octyl-sn-glycero-phosphoric acid-RVn acetone compound - prepared according to general method C from GS-441524 acetone compound and 13f.

[0324] 14g of 1-O-octadecyl-2-O-(cyclohexylmethyl)-sn-glycero-phosphoric acid-RVn acetone compound – can be prepared by general method C from GS-441524 acetone compound and 13g.

[0325] 1-O-octadecyl-2-O-(3-fluoro-benzyl)-sn-glycero-phosphoric acid-RVn acetone compound - prepared by general method C from GS-441524 acetone compound and 13h.

[0326] 14i 1-O-octadecyl-2-O-(4-methoxy-benzyl)-sn-glycero-phosphate-RVn acetone. – It can be prepared according to general method C from GS-441524 acetone and 13i.

[0327] 14j 1-O-octadecyl-2-O-(3-fluoro-4-methoxy-benzyl)-sn-glycero-phosphoric acid-RVn acetone compound - prepared according to general method C from GS-441524 acetone compound and 13j.

[0328] 14k 1-O-octadecyl-2-O-(pyridin-3-yl-methyl)-sn-glycero-phosphoric acid-RVn acetone compound – can be prepared by general method C from GS-441524 acetone compound and 13k.

[0329] 14l 1-O-oleylenyl-2-O-benzyl-sn-glycero-phosphoric acid-RVn acetone, prepared according to general method B from GS-441524 acetone and 13l.

[0330] 14m 1-O-oleylenyl-2-O-(3-fluoro-4-methoxy-benzyl)-sn-glycero-phosphoric acid-RVn acetone, prepared according to general method B from GS-441524 acetone and 13m

[0331] Removal of acetone protecting groups

[0332] 15a 1-O-tetradecyl-2-O-benzyl-sn-glycero-phosphate-RVn- was prepared from compound 14a according to general method E and isolated as a grayish-white powder. [Methyl ether ether] was determined by ESI-MS [MH]. - =730.41 Confirmed structure.

[0333] 15b 1-O-hexadecyl-2-O-benzyl-sn-glycero-phosphate-RVn. Prepared from compound 14b according to general method E. 1 H NMR (500MHz, DMSO-d6) δ7.94(s,1H),7.89(s,1H),7.81(s,1H),7.32–7.25(m,3H),7.22(ddd,J=8.7,5.4,2.6Hz,1H),6.88(d,J =4.5Hz,1H),6.80(d,J=4.5Hz,1H),6.24(s,1H),5.95(d,J=4.0Hz,1H),4.55(q,J=12.1,12.1,12.1Hz,3H),4.09(dt,J=6.7,4.3 ,4.3Hz,1H),3.92(d,J=4.5Hz,1H),3.78(dtt,J=24.4,7.8,7.8,4.4,4.4Hz,2H),3.66–3.55(m,3H),3.43(dd,J=10.6,3.5Hz,1H ),3.32–3.28(m,2H),1.42(q,J=6.5,6.5,6.0Hz,2H),1.20(d,J=7.7Hz,24H),0.83(t,J=7.0,7.0Hz,3H).LC / MS purity=99.8%; [M+H] + 760.6.

[0334] 15c 1-O-hexadecyl-2-O-(3-fluoro,4-methoxybenzyl)-sn-glycero-phosphate-RVn. Prepared from compound 14c according to general method E. 1 H NMR (500MHz, DMSO-d6) δ7.89(s,1H),7.80(s,1H),7.11(d,J=12.3Hz,1H),7.04(d,J=6.1Hz,2H),6.87(d,J =4.6Hz,1H),6.81(d,J=4.5Hz,1H),6.17(s,1H),4.56(d,J=5.0Hz,1H),4.52–4.41(m,2H),4.10(s,1H),3. 93(q,J=5.4,5.2,5.2Hz,1H),3.78(s,3H),3.63(s,2H),3.57(d,J=4.6Hz,1H),3.41(dd,J=10.4,3.5Hz,1H ), 3.29 (s, 3H), 1.41 (d, J=6.5Hz, 2H), 1.25–1.17 (m, 24H), 0.83 (t, J=7.0, 7.0Hz, 3H). LC / MS purity 99.8%; [M+H] + 808.9.

[0335] 15f 1-O-octadecyl-2-O-octyl-sn-glycero-phosphate-RVn- is prepared from compound 14f according to general method E. 1 H NMR (500MHz, DMSO-d6) δ7.89(s,1H),7.79(s,1H),6.88(d,J=4.5Hz,1H),6.80(d,J=4.5Hz,1H),6.10(s,1 H),5.92(s,1H),4.56(t,J=5.2,5.2Hz,1H),4.08(t,J=5.7,5.7Hz,1H),3.91(q,J=5.0,4.9,4.9Hz,1H),3 .79(d,J=18.1Hz,3H),3.54(d,J=19.3Hz,3H),3.46–3.35(m,5H),3.33(s,2H),3.27–3.23(m,1H),1.41(d t, J=16.0, 7.4, 7.4Hz, 4H), 1.21 (d, J=4.5Hz, 36H), 0.83 (td, J=7.1, 7.0, 5.7Hz, 6H). LC / MS purity 99.7%; [M+H] + 810.7.

[0336] 15g of 1-O-octadecyl-2-O-(ethylcyclohexyl)-sn-glycero-phosphate-RVn- can be prepared from 14g of compound E according to general method E.

[0337] 1-O-octadecyl-2-O-(3-fluoro-benzyl)-sn-glycero-phosphate-RVn- was prepared from compound E by general method E for 14 hours. 1 H NMR (500MHz, DMSO-d6) δ8.47(s,2H),7.88(s,2H),7.36–7.26(m,1H),7.12(q,J=8.4,6.9,6.9Hz,2H),7.03(td,J=8.5,8.4,2. 9Hz,1H),6.88(d,J=4.5Hz,1H),6.80(d,J=4.5Hz,1H),6.30(s,1H),5.97(s,1H),4.64–4.50(m,3H),4.13–4.07(m,1H),3.92(t ,J=5.8,5.8Hz,1H),3.79(dddd,J=33.7,12.0,7.6,4.3Hz,2H),3.63(dtt,J=14.0,10.1,10.1,5.7,5.7Hz,3H),3.43(dd,J=10.7,3.4Hz,2H),1.43(p,J=6.5,6.5,6.5,6.5Hz,2H),1.20(d,J=11.1Hz,30H),0.83(t,J=6.9,6.9Hz,3H). LC / MS purity 98.7%; [M+H] + 806.8.

[0338] 15i 1-O-octadecyl-2-O-(4-methoxybenzyl)-sn-glycero-phosphate-RVn- can be prepared from compound 14i by general method E.

[0339] 15j 1-O-octadecyl-2-O-(3-fluoro-4-methoxy-benzyl)-sn-glycero-phosphate-RVn- is prepared from compound 14j according to general method E. 1H NMR (500MHz, DMSO-d6) δ8.43(d,J=6.7Hz,2H),7.99–7.73(m,2H),7.04(d,J=5.5Hz,1H),6.87(q,J=3.7,3.7,3.2Hz,1H),6.82(dd,J=7.3 ,4.3Hz,1H),6.17–5.74(m,1H),4.59(t,J=4.9,4.9Hz,1H),4.53–4.41(m,1H),4.11(q,J=4.9,4.9,4.9Hz,1H),3.93(q,J=5.4,5.4,5.4Hz ,1H), 3.84(dq,J=11.3,6.5,5.1,5.1Hz,1H), 3.80–3.70(m,3H), 3.61(ddd,J=27.7,10.9,5.2Hz,3H), 3.30(dd,J=6.6,3.0Hz,3H), 3.21(dq,J=9.8,5.1,5.1,4.9Hz,1H), 1.43(p,J=6.6,6.6,6.5,6.5Hz,2H), 1.27–1.16(m,30H), 0.83(t,J=6.8,6.8Hz,3H). LC / MS purity 94.7%; [M+H] + 836.8.

[0340] 15k 1-O-octadecyl-2-O-(pyridin-3-yl-methyl)-sn-glycero-phosphate-RVn- can be prepared from compound 14k by general method E.

[0341] 15l 1-O-oleoyl-2-O-benzyl-sn-glycero-phosphoric acid-RVn was prepared from compound 14l according to general method D and isolated as a grayish-white solid in 84% yield. 1H NMR (300MHz, CDCl3+CD3OD) δ7.79(s,1H),7.38(s,2H),7.27–7.21(m,5H),6.92(d,J=6.0Hz,1H),6.90( d,J=6.0Hz,1H),5.30(t,J=6.0Hz,2H),4.70(d,J=11Hz,1H),4.62(d,J=5Hz,1H),4.34–4.49(m,1H),4. 20 (m, 1H), 3.90–3.87 (m, 2H), 4.18–4.06 (m, 2H), 3.71–3.69 (m, 2H), 3.52 (ddd, J = 11.7, 3.1, 1.3 Hz, 1H), 3.35 (t, 2H), 1.96–1.93 (m, 4H), 1.49–1.47 (m, 2H), 1.33–1.23 (m, 20H), 0.83 (t, 2H). LC / MS purity 99%; [M+H] + 786.78.

[0342] 15m 1-O-oleylenyl-2-O-(3-fluoro,4-methoxybenzyl)-sn-glycero-phosphate-RVn was prepared from compound 14m according to general method D and isolated as a grayish-white solid. The yield was 92%. 1 H NMR (300MHz, CD3OD) δ7.74(s,1H),7.32(s,2H),6.99(d,J=6.0Hz,1H),6.92–6.77(m,3H),5.23(t,J=6.0Hz,2H),4.67(d,J=11Hz,1H),4.49( d,J=5Hz,2H),4.30(m,1H),4.20(m,1H),3.83–3.81(m,2H),3.75(s,3H),3.63(m,1H),3.31(t,2H),1.91-1.89(m,4H),1.44(m,2H),1.18(br s,22H),0.77(t,2H).LC / MS purity 99%; [M+H] + 834.87.

[0343] Synthesis of D. 1-O-octadecyl-2-O-benzyl-sn-glycero-benzyl-phosphate-RVn

[0344]

[0345] Option 4. Reagents: a) Benzyl alcohol, PyBOP, DIEA, DMF; b) Formic acid, room temperature.

[0346] Compound 14d (160 mg, 0.22 mmol), benzyl alcohol (48 mg, 0.45 mmol), diisopropylethylamine (DIEA, 58 mg, 0.45 mmol), and (1H-benzotriazol-1-yloxy)-tripyrrolidinephosphonium hexafluorophosphate (PyBOP, 230 mg, 0.45 mmol) were stirred in anhydrous DMF (5 mL) for 3 hours at room temperature. The DMF was then evaporated, and the residue was dissolved in ethyl acetate (50 mL) and washed with saturated NaHCO3 (3 x 10 mL). The organic layer was dried over MgSO4 and concentrated. The residue was purified by column chromatography on silica gel, eluting with chloroform / methanol (0–15%) to give 16. ESI-MS 918.33 [MH] - .

[0347] Compound 16 was added to formic acid, and deprotection was monitored by TLC. The mixture was concentrated under vacuum, and the residue was purified by column chromatography (silica gel, dichloromethane / methanol 10-20%) to give compound 17. ESI-MS: 878.35 [M+H] + 900.43[M+Na] + Confirm the structure.

[0348] Synthesis of E.GS-441524-3′,5′ cyclic monophosphate, 1-O-octadecyl-2-O-benzyl-sn-glycerol ester

[0349] In another embodiment, the compound of the present invention is a 3′,5′-cyclic phosphate. The 3′,5′-cyclic phosphate can be prepared from known or readily prepared starting materials according to methods known to those skilled in the art of organic synthesis. As an example, 3′,5′-cyclic phosphate 18 can be prepared from phosphate diester 15d via an intramolecular esterification reaction.

[0350] A solution of 1-O-octadecyl-2-O-benzyl-sn-glycero-phosphate-RVn (1 mmol) in dried pyridine (25 mL) was added dropwise to a solution of triisopropylbenzenesulfonyl chloride (3 mmol) and 1-methylimidazole (1 mmol) in dried pyridine (100 mL). The mixture was stirred at room temperature for 2 days, or until TLC showed a substantial conversion to 3′,5′-cyclic phosphate. The solvent was evaporated under vacuum, and the residue was purified by column chromatography on silica gel to give compound 18 as a mixture of equatorial and axial isomers. The isomers were separated using preparative HPLC or preparative chiral HPLC prior to antiviral testing.

[0351]

[0352] To measure the cell-based anti-SARS-CoV-2 activity of the RVn 3',5'-cyclic phosphate prodrug, assays as described in Examples 2-11 below can be performed. The obtained data may indicate that these compounds possess significant antiviral activity.

[0353] Example 2 – Determination of anti-coronavirus activity in Vero E6 cells

[0354] In this example, the following compounds, which contain remdesivir nucleoside analogs and related intermediates, were referenced:

[0355]

[0356] The anticoronavirus activity of the compounds in this study was determined in Vero E6 cells and compared with that of remdesivir (RDV) and remdesivir nucleoside (RVn). Ten thousand Vero E6 cells were seeded in 100 μL of medium in 96-well plates. The next day, serial 2-fold dilutions of the antiviral compound or a DMSO-containing vector were added to each well. After 30 minutes, the US WA-01 strain of SARS-CoV-2 was added to each well at a multiplicity of infection of 0.1. Cells were incubated for 48 hours, washed twice in PBS, and lysed with TRIzol. RNA was extracted using a Directzol microRNA column. The RNA was converted to cDNA, and SARS-CoV-2 spike protein and housekeeping gene (RPLPO) RNA were determined by qPCR. Data represent the average of duplicate wells. Cytotoxicity was also measured in Vero E6 cells. As shown below, each synthesized compound exhibited enhanced anti-SARS-CoV-2 activity compared to remdesivir or remdesivir nucleoside, with selectivity indices ranging from 22.8 to >227. Cytotoxicity (CC) 50 The evaluation was conducted using commercially available MTT assays.

[0357] As shown in the table below, in Vero E6 cells, ODE-P-RVn (4c) and ODBG-P-RVn (15d) exhibited 9 to 15 times higher activity against the US WA-1 strain of SARS-CoV-2019. Similarly, HDP-P-RVn (4b) showed 3.3 times the activity of remdesivir.

[0358]

[0359]

[0360] Abbreviation: EC 50 50% effective concentration; EC 90 90% effective concentration; CC 5050% cytotoxic concentration. Selectivity index = CC 50 / EC 50 .

[0361] Example 3. Additional synthesis and testing of RVn monophosphate prodrug.

[0362] Antiviral activity: In two independent experiments conducted in duplicate, concentration-response curves for ODBG-P-RVn (15d), ODE-P-RVn (4c), and HDP-P-RVn (4b), remdesivir (RDV), and remdesivir nucleoside (RVn) were generated for SARS-CoV-2 infection in Vero E6 cells. Figures 1A-1F Three remdesivir analogues ( Figure 1A , Figure 1B and Figure 1C Remdesivir (GS-5734) Figure 1D ) and remdesivir nucleoside (GS-441524) Figure 1E Dose-response curves for anti-SARS-CoV-2 infection in Vero E6 cells. Vero E6 cells were pretreated with the specified dose of the designated drug for 30 min and then infected with the SARS-CoV-2 isolate USA-WA1 / 2020 for 48 h. Relative SARS-CoV-2 spike RNA expression was determined by qRT-PCR. Dose-response comparisons were performed simultaneously for all drugs at two different events. Data from both experiments show... Figures 1A-1F The data points represent the average relative expression from two sets of orifices. The error bars represent the standard deviation (SD). The black vertical dashed line indicates the presence of 50% suppression (EC). 50 The concentration of ). Figure 1F The inhibition curves of all five compounds and DMSO were combined into a single graph. The carrier DMSO for all compounds had no effect on SARS-CoV-2 replication at the applied concentration. All three lipid esters of RVn-monophosphate were significantly more active than RDV and RVn.

[0363] The following table shows the effective concentration (EC) of the compound. 50 EC 90 ), 50% cytotoxic concentration (CC) 50 ) and selectivity index, mean ± SD. Cytotoxicity (CC) was assessed using Cell Titer-Glo. 50 ECs for RDV and RVn 50 The values ​​were 4.6 μM and 1.7 μM, respectively. The lipid prodrug was more active, with EC... 50Within the range of 0.19±0.023 to 0.96±0.17, ODBG-P-RVn and ODE-P-RVn were the most active and selective compounds. (Based on EC...) 50 The highest activity of the compound ODBG-P-RVn was 24 times higher than that of RDV and 8.9 times higher than that of RVn (p<0.001 and 0.005, respectively), with a selectivity index of 240.

[0364]

[0365]

[0366] Among all the apparent drawbacks of RDV, this example chose to design a prodrug of RVn that can provide oral bioavailability because an effective oral medication would allow for much earlier treatment of individuals diagnosed with SARS-CoV-2 infection. As shown in this example, this is achieved by constructing liponucleotides of RVn that resemble lysophospholipids, which are normally absorbed in the gastrointestinal tract. RVn liponucleotides are not rapidly metabolized in plasma and enter cells rapidly, typically exhibiting significantly enhanced antiviral activity.

[0367] In contrast to the activation of RDV, which requires four transformations, nucleoside monophosphates are generated by the intracellular kinase bypass of this compound when the lipid ester moiety is cleaved in a single reaction catalyzed by acid phospholipase C or acid sphingomyelinase (sphingomyelin phosphodiesterase I).

[0368] One of the compounds, ODBG-P-RVn(15d), may deliver relatively more drug to the lungs and less to the liver, as previously shown in lethal mousepox infection (Hostetler KY, Beadle JR, Trahan J, Aldern KA, Owens G, Schriewer J, Melman L, Buller RM., "Oral 1-O-octadecyl-2-O-benzyl-sn-glycero-3-cidofovir targets the lung and is effective against a lethal respiratory challenge with ectromelia virus in mice," Antiviral Drugs). Res.), March 2007; 73(3):212-8. doi:10.1016 / j.antiviral.2006.10.009, published electronically on November 9, 2006, PMID:17123638; PMCID:PMC1859865).

[0369] The synthesis of the lipid prodrug in this example is much simpler than that of RDV and is easier to scale up.

[0370] In this example, three lipid prodrugs of RVn were synthesized, exhibiting significantly higher activity in Vero E6 cells than RDV or RVn alone. The two most active compounds, ODBG-P-RVn and ODE-P-RVn, showed activities 24-fold and 9.8-fold higher than RDV, respectively. These compounds are expected to be orally bioavailable, stable in plasma, and provide significant exposure and antiviral activity against all tissues infected with SARS-CoV-2.

[0371] Compounds: Remdesivir (GS-5734) and remdesivir nucleoside (GS-441524) were purchased from AA Blocks (San Diego, CA) and Mason-Chem (Palo Alto, CA), respectively.

[0372] Cells: Vero E6 cells were obtained from ATCC and grown in DMEM (Corning) containing 10% FBS and penicillin-streptomycin (Gibco).

[0373] SARS-CoV-2 infection: SARS-CoV-2 isolate USA-WA1 / 2020 (BEI Resources) was propagated, and infection units were quantified using Vero E6 (ATCC) cells via plaque assay. Approximately 10 cells per well were used. 4 Vero E6 cells were seeded in 96-well plates and incubated overnight. The compound or control was added at the specified concentration 30 minutes before infection, followed by SARS-CoV-2 at a multiplicity of infection (MCI) of 0.01. After incubation at 37°C and 5% CO2 for 48 hours, the cells were washed twice with PBS and lysed in 200 μL of TRIzol (ThermoFisher).

[0374] RNA extraction, cDNA synthesis, and qPCR: RNA was purified from TRIzol lysates using the Direct-zol RNA Microprep Kit (ZymoResearch) according to the manufacturer's recommendations regarding the inclusion of DNase treatment. RNA was converted to cDNA using the iScript cDNA Synthesis Kit (BioRad), and qPCR was performed using an iTaq universal SYBR greensupermix (BioRad) and an ABI 7300 real-time PCR system. cDNA was amplified using the following primers: RPLP0 F–GTGTTCGACAATGGCAGCAT; RPLP0 R–GACACCCTCCAGGAAGCGA; SARS-CoV-2 spike F–CCTACTAAATTAAATGATCTCTGCTTTACT; SARS-CoV-2 spike R–CAAGCTATAACGCAGCCTGTA. The relative expression of SARS-CoV-2 spike RNA was calculated by δ-δ-Ct by first normalizing the housekeeping gene RPLP0 and then comparing it to untreated SARS-CoV-2-infected Vero E6 cells (reference control). Fit the curves and calculate the 50% and 90% effective concentrations of EC using Prism 8. 50 and EC 90 value.

[0375] CellTiter-glo luminescent cell viability assay: Approximately 10 cells were placed in each well. 4Vero E6 cells were seeded in 96-well cell culture plates with opaque walls and incubated overnight. Compounds or controls were added at the specified concentrations. After incubation at 37°C and 5% CO2 for 48.5 hours, an equal volume of CellTiter-Glo reagent (catalog number G7570, Promega, Madison, WI) was added, mixed, and luminescence was recorded on an EnSpire multi-template reader (PerkinElmer) according to the manufacturer's instructions. Viability was calculated compared to the untreated control, and CC was calculated using a Prism 8. 50 Values ​​(Table S10).

[0376] Cytotoxicity assay: 50% cytotoxicity concentration (CC) was determined using Cell Titer-Glo (catalog number G7570, Promega, Madison, Wisconsin) according to the manufacturer's instructions. 50 ). Calculated CC 50 The values ​​are shown in the table above.

[0377] Vero E6 cells were treated for 48.5 hours with increased concentrations of remdesivir analogue, remdesivir (GS-5734), remdesivir nucleoside (GS441524), or DMSO vector (control). Figure 2 As shown, relative viability was measured using the CellTiter-Glo luminescent cell viability assay.

[0378] Example 4 – Production of Remdesivir Triphosphate in Vero E6 Cells

[0379] In this example, Vero E6 cells were spaced at approximately 3.4 × 10⁶ cells per well. 5 One cell was seeded in 2 mL of culture medium (DMEM, 10% FBS) in a 6-well plate.

[0380] The cells were then incubated at 37°C for 24 hours. The culture medium was then aspirated and replaced with 2 mL of control medium (fresh Dulbecco's modified Eagle's medium (DMEM), 10% FBS) or 2 mL of medium containing 1 μM of the drug. The cells were incubated with each drug for 48 hours. The culture medium was aspirated, the cells were washed twice with phosphate-buffered saline (PBS), digested with 1 mL of ATV trypsin for 5 minutes, homogenized, and transferred to a 15 mL centrifuge tube. The cells were washed with 1 mL of PBS, then transferred to another 15 mL centrifuge tube, and homogenized again. Cells were counted using two 10 μL samples in a Reichert hemocytometer to determine the cell count in each sample.

[0381] The cells were centrifuged at 1200 rpm for 10 minutes, the diluent was removed, and the precipitate was resuspended in 250 μL of methanol / distilled water (70 / 30) and analyzed by LC / MS / MS. Figure 3 The results shown are in picomoles / 10 6 The number of cells is counted, and it is the average of two or three determinations. Figure 3 Abbreviations: RDV, Remdesivir; RVn, Remdesivir nucleoside (GS-441524); ODE-P-RVn, Octadecyloxyethyl-phosphate-RVn(4c); ODBG-P-RVn, 1-O-octadecyl-2-O-benzyl-glycero-sn-3-phosphate-RVn(15d)

[0382] like Figure 3 As shown, in Vero E6 cells, remdesivir triphosphate (RVn-TP) synthesis gradually increased up to 48 hours upon exposure to 1 μmol of ODE-P-RVn and OBDG-P-RVn. For RVn, RVn-TP levels peaked at 8 hours and then declined. At 8 hours and 24 hours, RVn-TP levels with RDV were below the quantification level.

[0383] Example 5 – Human Coronavirus 229E Infection

[0384] In this instance, human coronavirus 229E (ATCC) was replicated, and the infective unit was TCID. 50 Quantification was performed using MRC-5 cells. For the antiviral assay, approximately 10 cells per well were used at 37°C. 4 MRC-5 cells were seeded overnight in 96-well plates using EMEM (10% FCS). Culture medium was removed from each well and diluted with 100 TCID45 in 100 μL of culture medium. 50 The virus infected the cells for two hours.

[0385] Cells were washed once with culture medium, and then the specified concentration of the compound or control was added. Three days later, CPE was observed under a microscope and quantified using the MTT Cell Proliferation Assay Kit (Abcam) on an ELx800 Universal Microplate Reader (BIO-TEK Instruments, INC).

[0386] Effect of compounds on HCoV-229E replication in MRC-5 cells

[0387]

[0388]

[0389] nd = Undetermined;

[0390] Inhibition percentage was calculated as (Atv – Acv) / (Acd – Acv) × 100%, where Atv represents the absorbance of the test compound in virus-infected cells, and Acv and Acd represent the absorbance of the virus control and cell control, respectively. Mean half-maximum effective concentration (EC50) 50 It is defined as the concentration required to achieve 50% inhibition of virus-induced cytopathic effects.

[0391] Example 6 – SARS-CoV-2 Infection Assay

[0392] Approximately 12e3 TMPRSS2-Vero cells or 20e3 Huh7.5 cells were seeded into each black well of a 96-well plate with a clear, flat bottom and incubated overnight. About 30 to 60 minutes prior to infection, either the compound or the control was added at the specified concentration, followed by SARS-CoV-2. The multiplicity of infection (FFU / cell) was equal to 0.01 for TMPRSS2-Vero and 0.1 for Huh7.5.

[0393] After incubating TMPRSS2-Vero at 37°C and 5% CO2 for 32 hours or Huh7.5 for 48 hours, the culture medium was removed and the cells were incubated in 4% formaldehyde at room temperature for 30 minutes. Formaldehyde-fixed cells were washed with PBS and subjected to immunofluorescence permeation in 0.1% Triton-X 100 in PBS containing 1% bovine serum albumin (BSA) fraction V (Millipore-Sigma). SARS-CoV-2 staining was performed with primary anti-nuclear capsid antibody (GeneTex GTX135357), followed by staining with secondary antibody (ThermoFisher Scientific A-11012) with Sytox Green (ThermoFisher Scientific) nuclear counterstain.

[0394] Five images per well were obtained using the S3 (Sartorius) incus at 10x magnification. The percentage of infected cells and nuclei was calculated using the S3's built-in image analysis tools. EC 50 EC 90 and CC 50 The calculations were performed using nonlinear regression analysis in GraphPad Prism 9, with the bottom and top parameters constrained to 0 and 100, respectively.

[0395] Effects of compounds on in vitro replication of SARS-CoV-2

[0396]

[0397]

[0398] nd = Undetermined; a Data from Instance 7

[0399] Example 7 – Antiviral activity in various cell types infected with SARS-CoV-2

[0400] Vero E6, Caco-2, and Calu-3 cell lines were obtained from ATCC. Huh7.5 cells were obtained from Apath LLC. Calu-3 and Caco-2 cells were proliferated in MEM (Kangning), 10% FBS, and penicillin-streptomycin (Gibco). Vero E6 and Huh7.5 cells were proliferated in DMEM (Kangning) containing 10% FBS and penicillin-streptomycin (Gibco). Human PSC-lung cell generation, as previously described, to generate human lung organoids (Leibel SL, McVicar RN, Winquist AM, Niles WD, Snyder EY, “Generation of complete multi-cell type lung organoids from human embryonic and patient-specific induced pluripotent stem cells for infectious disease modeling and therapeutics validation”, Curr. Protoc. Stem Cell Biol., 54(1)(September 2020), e118). H9 embryonic stem cells (WiCell) were cultured in mTeSR medium (StemCellTech#85850) on Matrigel (Corning#354230) coated plates under feeder-free conditions. The medium was changed daily and the enzyme-free dissociation reagent ReLeSR was used. TM (Stem Cell Tech #05872) Stem cells were passaged. The cultures were kept undifferentiated in a 37°C, 5% CO2 incubator.

[0401] For the production of proximal lung organoids, human PSCs were dissociated into single cells, and then on day 1, 5.3 × 10⁻⁶ cells were generated. 4 cells / cm 2Cells were seeded at a density on Matrigel-coated plates (BD Biosciences) in final endoderm (DE) induction medium (RPMI 1640, 2% B27 supplement, 1% HEPES, 1% glutamax, 50 U / mL penicillin / streptomycin) supplemented with 100 ng / mL human activin A (R&D), 5 μM CHIR99021 (Stemgent), and 10 μM ROCK inhibitor, Y-27632 (R&D Systems). On days 2 and 3, cells were cultured in DE induction medium containing only 100 ng / mL human activin A. Foregut endoderm (AFE) was generated by supplementing serum-free basal medium (3 parts IMDM: 1 part F12, B27+N2 supplement, 50 U / mL penicillin / streptomycin, 0.25% BSA, 0.05 mg / mL L-ascorbic acid, 0.4 mM monothioglycerol) with 10 μM SB431542 (R&D) and 2 μM Dorsomorphin (StemGent) on days 4-6. On day 7, the AFE medium was converted to lung progenitor cell (LPC) induction medium containing serum-free basal medium supplemented with 10 ng / mL recombinant human BMP4 (R&D), 0.1 μM all-trans retinoic acid (Sigma-Aldrich), and 3 μM CHIR99021. The medium was changed every other day for 9-11 days. To generate 3D human proximal lung organoids, we modified the previously published protocol (KB McCauley, F. Hawkins, M. Serra, DC Thomas, A. Jacob and D. N. Kotton. (2017), “Efficient Derivation of Functional Human Airway Epithelium from Pluripotent Stem Cells via Temporal Regulation of Wnt Signaling”, Cell Stem Cell; 20(6): 844-857).

[0402] LPC dissociated in acutase for 10 minutes and at a rate of 5.0 × 10⁻⁶. 4Cells were resuspended in Matrigel at 200 μL / 22 wells in 0.4 μm Transwell culture inserts. Cells were cultured in proximal lung organoid maturation medium supplemented with serum-free basal medium containing 250 ng / mL FGF2, 100 ng / mL rhFGF10, 50 nM dexamethasone (Dex), 100 μM 8-bromoadenosine 3',5'-cyclic monophosphate sodium salt (Br-cAMP), 100 μM 3-isobutyl-1-methylxanthine (IBMX), and 10 μM ROCK inhibitor (Y-27632). The proximal lung organoid medium was changed every other day for 3 weeks. One day before transfection, human PSC-derived lung organoids were dissociated into single cells and seeded at 20,000 cells per well in Matrigel-coated 96-well plates. Transwells containing proximal organoids in Matrigel were incubated at 37°C for 30 minutes with 2 U / ml dispersant enzyme. Cold PBS was added to the mixture, followed by centrifugation at 400 x g for 5 minutes.

[0403] Carefully remove the supernatant and resuspend the cells in 2–3 mL of TrypLE Express (Gibco #12605010) at 37°C for 20 min. Quench the cells with 2% FBS in DMEM / F12, then centrifuge at 400 x g for 5 min. Aspirate the supernatant and resuspend the cell pellet in 1 mL of quenching medium supplemented with 10 μM Rock inhibitor (Y-27632). Count the cells and transfer the appropriate volume to the reagent storage tank, resuspend in proximal lung organoid maturation medium, and seed 100 μL per well as a monolayer into 96-well plates using multichannel pipettes.

[0404] SARS-CoV-2 Infection: SARS-CoV-2 isolate USA-WA1 / 2020 (BEI Resources) was propagated, and infection units were quantified using Vero E6 (ATCC) cells via plaque assay. Approximately 12,000 cells from each cell line were seeded into each well of a 96-well plate. Vero E6 and Huh7.5 were seeded approximately 24 hours prior to treatment / infection. Calu-3 and Caco-2 were seeded approximately 48 hours prior to treatment / infection. Human PSC lung cell infection and cytotoxicity assays were performed when cells reached 100% confluence. The compound or control was added at a specified concentration 30 minutes prior to infection, followed by SARS-CoV-2 at a multiplicity of infection (MCI) of 0.01. After incubation at 37°C and 5% CO2 for 48 hours, cells were washed twice with PBS and lysed in 200 μL TRIzol (ThermoFisher). With the approval of the Institutional Biosafety Committee, all work on SARS-CoV-2 was conducted under biosafety level 3 conditions at the University of California, San Diego.

[0405] RNA extraction, cDNA synthesis, and qPCR: RNA was purified from TRIzol lysates using the Direct-zol RNA Microprep Kit (ZymoResearch) according to the manufacturer's recommendations regarding the inclusion of DNase treatment. RNA was converted to cDNA using the iScript cDNA Synthesis Kit (BioRad), and qPCR was performed using an iTaq universal SYBR greensupermix (BioRad) and an ABI 7300 real-time PCR system. cDNA was amplified using the following primers: RPLP0 F–GTGTTCGACAATGGCAGCAT; RPLP0 R–GACACCCTCCAGGAAGCGA; SARS-CoV-2 spike F–CCTACTAAATTAAATGATCTCTGCTTTACT; SARS-CoV-2 spike R–CAAGCTATAACGCAGCCTGTA. The relative expression of SARS-CoV-2 spike RNA was calculated by δ-δ-Ct by first normalizing the housekeeping gene RPLP0 and then comparing it to untreated SARS-CoV-2-infected Vero E6 cells (reference control). The curve was fitted using a nonlinear regression-log(inhibitor) versus response (four-parameter) model with Prism 9. To calculate the effective concentration of EC... 50 and EC 90The qRT-PCR values ​​were normalized to the percentage of inhibition, and the curve was fitted using a nonlinear regression-log(agonist) versus response (four-parameter) model, where the bottom and top were constrained to 0 and 100, respectively, using Prism 9.

[0406] Cell viability assays: Cell types were seeded according to the SARS-CoV-2 infection studies in opaque-walled 96-well cell culture plates or the 229E infection studies in clear 96-well cell culture plates, and incubated overnight. Compounds or controls were added at the specified concentrations. For SARS-CoV-2-related studies, cells were incubated at 37°C and 5% CO2 for 48.5 hours, an equal volume of CellTiter-Glo reagent (catalog number G7570, Promega, Madison, Wisconsin) was added, mixed, and luminescence was recorded on a Veritas Microplate Luminometer (Turner BioSystems) according to the manufacturer's recommendations. For 229E-related studies, cells were incubated at 37°C and 5% CO2 for 72 hours, the supernatant was removed, 50 μL of serum-free medium and 50 μL of MTT reagent (Abcam ab211091) were added to each well, and the cells were incubated at 37°C for 3 hours. As recommended by the manufacturer, absorbance was measured on an ELx800 universal microplate reader (BIO-TEK Instruments, INC). Viability percentage was calculated compared to an untreated control, and CC was calculated using Prism9. 50 value.

[0407]

[0408]

[0409] In all cell lines, dose-dependent inhibition of viral RNA was observed via ODBG-P-RVn, ODE-P-RVn, HDP-P-RVn, remdesivir (RDV), and remdesivir nucleoside (RVn). In Vero E6 cells, the mean half-maximum effective concentration (Cmax) of ODBG-P-RVn was [not specified]. 50 ) and an average effective concentration of 90% (EC 90 The concentrations were 0.14 μM and 0.16 μM, respectively. ODBG-P-RVn in Vero E6 cells EC50 50 Significantly lower than RDV. ODE-P-RVn and HDP-P-RVn are also effective antiviral drugs, with EC50 in Vero E6 being particularly effective. 50 The values ​​were 0.3 μM and 0.63 μM. ODBG-P-RVn and ODE-P-RVn showed positive ECG values ​​in two human lung infection models, PSC-lung and Calu-3. 50Less than 0.35 μM. In PSC-lung cells, ODBG-P-RVn and ODE-P-RVn showed significantly better antiviral activity than RVn. ODBG-P-RVn, ODE-P-RVn, and HDP-P-RVn exhibited strong antiviral activity in Huh7.5 cells, among which EC 50 Less than 0.2 μM, which was not significantly different from RDV or RVn. In the Caco-2 cell line, the EC50 of ODBG-P-RVn... 50 The concentration was 0.3 μM, significantly lower than RVn but similar to RDV. In the same cell line, the EC50 of ODE-P-RVn was... 50 The value was 0.77 μM, which was significantly higher than that of RDV.

[0410] The cytotoxicity of each compound was assessed by incubating each of these cell lines with a series of dilutions of each compound from 1.23 μM to 100 μM for 48 hours. The mean 50% cytotoxic concentration (Cc) of all compounds was determined. 50 The concentration of CC was greater than 60 μM in all cell lines except RDV, which had 32.7 μM in PSC-lung cells. 50 Furthermore, it possesses 15.2 μM CC in Huh7.5 (a human hepatocyte cell line). 50 In this study, the selectivity index of ODBG-P-RV ranged from 295 to 699 across the five cell types tested. The antiviral activity and cytotoxicity of ODBG-P-RVn ranged (EC50). 50 0.14μM–0.30μM and CC 50 (61.5 μM–98.2 μM) compared to RDV (EC) across cell types 50 0.06μM–1.13μM and CC 50 The results (15.2 μM–>100 μM) were more consistent (Table 1). Overall, these data demonstrate that the lipid RVn monophosphate prodrug is an effective antiviral agent against SARS-CoV-2 in vitro, exhibiting low toxicity and excellent selectivity.

[0411] Example 8 - The Role of Antiviral Drugs in Human Coronavirus 229E-Infected Cells

[0412] Human coronavirus 229E (ATCC) was replicated and administered via TCID using MRC-5 cells. 50 The number of infected units was quantified. For antiviral testing, approximately 10... 4 MRC-5 cells were seeded overnight in each well of a 96-well plate with EMEM (10% FCS) at 37°C. The culture medium was removed from each well and diluted with 100 TCID35 in 100 μL of medium. 50The virus infected the cells for two hours.

[0413] Cells were washed once with culture medium, and then the compound or control was added at the specified concentration. After three days, CPE was observed under a microscope and quantified using an MTT cell proliferation assay kit (Abcam) read on an ELx800 universal microplate reader (BIO-TEK Instruments, INC). Inhibition % was calculated as (A... tv –A cv ) / (A cd –A cv )×100%, where A tv This indicates the absorbance of the test compound in the case of virus-infected cells, and A cv and A cd These represent the absorbance of the virus control and the cell control, respectively. Mean half-maximum effective concentration (EC50) 50 It is defined as the concentration required to achieve 50% inhibition of virus-induced cytopathic effects.

[0414] Figure 4A and Figure 4B ODBG-P-RVn(15d) inhibits human alpha coronavirus 229E. Figure 4A Antiviral dose-response curves for remdesivir (GS-5734) and ODBG-P-RVn against human coronavirus 229E were plotted in MRC-5 cells. Cells were infected with 229E for 2 hours and then treated with the designated dose of the designated drug for 72 hours. Relative cell viability (CPE) was determined by measuring cell viability using an MTT assay.

[0415] Figure 4B Cytotoxicity in MRC-5 cells incubated for 72 hours at specified concentrations of the designated drug was depicted, followed by cell viability measurement using the CellTiter-Glo assay. Data points represent the average of three independent experiments performed in duplicate. Error bars represent the standard error mean (SEM).

[0416] Both ODBG-P-RVn and RDV exhibited dose-dependent inhibition of cytopathic effects (CPE). The EC50 values ​​of ODBG-P-RVn and RDV... 50 The values ​​were 0.15 μM and 0.04 μM, respectively, and EC 90 The concentrations were 0.54 mM and 0.26 mM, respectively. In MRC-5 cells, the CC values ​​of ODBG-P-RVn and RDV... 50 Greater than 50 μM. Together with the antiviral data for SARS-CoV-2, this demonstrates that ODBG-P-RVn has antiviral activity against two genetically distinct human pathogenic coronaviruses.

[0417] Example 9 - Oral administration of ODBG-P-RVn (15d) achieved therapeutic plasma levels in Syrian hamsters.

[0418] Syrian hamsters were administered ODBG-P-RVn in 0.1M sodium carbonate / sodium bicarbonate buffer (pH 9.0) via oral tube feeding every 12 hours for 7 days. ODBG-P-RVn was present as a sodium salt. It was well tolerated, and no adverse clinical signs were observed. Peak plasma levels of ODBG-P-RVn were observed at 1 hour and decreased by 50% over approximately 5 hours.

[0419] On days 1 and 7, plasma curves were roughly similar, except that the value on day 7 was slightly higher than that on day 1 at 16.9 mg / kg. At 12 hours, ODBG-P-RVn levels were higher than those on day 1 in all studied cell lines (including Vero E6 cells and PSC lung cells on days 1 and 7). 90 The level of the nucleoside metabolite RVn of ODBG-P-RVn peaked 3 hours after administration and then declined. In PSC lung cells and Vero E6 cells, plasma levels of RVn were lower than those of RVn in EC5 cells. 90 The observed low levels of RVn indicate that the antiviral activity attributable to this metabolite will be minimal, and are also consistent with the findings of OBDG-P-RVn stability in human plasma. In summary, these results suggest that OBDG-P-RVn will effectively inhibit viral replication in various tissue types in vivo.

[0420] Figure 5A and Figure 5B The pharmacokinetics of oral administration in Syrian hamsters over a seven-day period were characterized. Syrian hamsters were administered the carrier or ODBG-P-RVn orally via tube feeding every 12 hours for seven days. Three animals per group received either the carrier or the drug at doses of 16.9 and 13.2 mg / kg. Animals were weighed daily, and clinical signs were monitored. Plasma samples were obtained at 1, 3, 6, and 12 hours on days 1 and 7 and frozen for analysis by LC / MS / MS. Figure 5A ODBG-P-RVn and ( Figure 5B )RVn

[0421] Analytical Method: ODBG-P-RVn: A hamster plasma sample (10 μL) containing ODBG-P-RVn and K2EDTA as an anticoagulant was added to a polypropylene tube containing water (100 μL), internal standard solution (10 μL; 1,000 ng / mL ODBG-P-RVn in ACN:DMF (1:1, v / v), and 10 μL of ACN:DMF (1:1, v / v). The solutions were mixed, acidified with 85% w / v phosphoric acid:water (1:19, v / v; 10 μL), mixed, diluted with 200 μL of IPA, mixed, and then diluted with 500 μL of water and mixed. Samples were extracted using a tC18 96-well solid-phase extraction plate (25 mg; Waters, Milford, MA). Extraction was performed under positive pressure using nitrogen. Samples were washed sequentially with 1 mL of water:acetonitrile:formic acid (475:25:0.5, v / v / v) and 0.4 mL of water:acetonitrile:formic acid (350:150:0.5, v / v / v), followed by elution with 100 μL and 150 μL of water:{acetonitrile:isopropanol (1:1, v / v)}:formic acid:ammonium formate:citric acid solution, 2% w / v (15:85:0.1:0.1:0.1, v / v / v / v). Citric acid solution was prepared as water:citric acid monohydrate (20:0.4, v / w). After elution, 100 μL of water was added to each sample. The ODBG-P-RVn extract was analyzed using an Agilent 1200 HPLC system (Agilent, Santa Clara, CA) coupled with an API 5500 quality analyzer (SCIEX, Foster City, CA). Analytes were chromatographically separated using a Dacapo DX-C18 MF column (100 x 2 mm, 2.5 μm; Imtakt USA, Portland, Oregon) using a mobile phase system consisting of mobile phase A (water:formic acid:[water:ammonium formate:citric acid (25:5:0.5, v / w / w)] (1,000:1:1, v / v / v) and mobile phase B (acetonitrile:isopropanol:formic acid:[water:ammonium formate:citric acid (25:5:0.5, v / w / w)] (800:200:1:1, v / v / v / v). The total analytical run time was 4.5 minutes. The mobile phase was nebulized with heated nitrogen in a Turbo-V source / interface set to positive ionization electrospray mode. Ionized compounds were detected using multiple reaction monitoring, where the transition m / z was determined. 788.4 > 229 (V2043) and 668.4 > 467.2 (V2041). This method is applicable to the measurement of ODBG-P-RVn concentrations in the range of 6.25 to 3,000 ng / mL using 10.0 μL of plasma for extraction. Peak areas of ODBG-P-RVn and RVn were obtained using Analyst v.1.6.2 (SCIEX, Framingham, MA). Calibration curves were obtained using Analyst by fitting the peak area ratios of analyte / IS and standard concentrations to a linear equation with a 1 / x2 weighting. The equation of the calibration curves was then used to interpolate the analyte concentrations in the sample using the peak area ratios. The peak areas used for calculation were not rounded.

[0422] Analytical Method: RVn (GS-441524): Hamster plasma sample (20 μL) containing GS-441524 and K2EDTA as an anticoagulant was added to an Eppendorf LoBind microcentrifuge tube containing acetonitrile (300 μL) and water:acetonitrile (2:8, v / v; 60 μL). The solutions were mixed and centrifuged at 16,000 g for 5 min. The supernatant (300 μL) was then filtered through an Ostro protein precipitation and phospholipid removal plate (25 mg; Waters, Milford, MA). Filtration was performed under positive pressure using nitrogen. The collected filtered sample was capped, mixed, and stored at 10 °C for analysis. The GS-441524 extract was analyzed using an Acquity UPLC system (Waters, Milford, MA) coupled to a G2-S QTof mass analyzer (Waters, Milford, MA). Analytes were chromatographically separated using a Unison-UK aminoHT column (100 x 2 mm, 3 μm; Imtakt USA, Portland, OR) with a mobile phase system consisting of mobile phase A (0.008% ammonium hydroxide, 0.012% aqueous acetic acid, v / v / v) and mobile phase B (0.008% ammonium hydroxide, 0.012% acetic acid in acetonitrile, v / v / v). The total analytical run time was 12.5 min. The mobile phase was nebulized with heated nitrogen in a Z-spray source / interface set to positive ionization electrospray mode. Ionized compounds were monitored using Tof MS scans at a sensitivity of 50.0 to 700 m / z. This method is applicable to the determination of GS-441524 concentrations in the range of 1.00 to 1,000 ng / mL using 20.0 μL of plasma for extraction. The peak area of ​​GS-441524 was obtained using MassLynx V4.2 (Waters, Milford, MA). The peak area ratio of the analyte and standard concentrations was fitted to a value with 1 / x using MassLynx. 2 A weighted linear equation is used to obtain the calibration curve. Then, the equation of the calibration curve is used to interpolate the concentration of the analyte in the sample using the peak area. The peak areas used for calculation are not rounded.

[0423] Example 10 - Stability of ODE-P-RVn (4c) and ODBG-P-RVn (15d) in human plasma

[0424] One drawback of remdesivir is its instability in plasma; reportedly, plasma levels at virologically significant levels persist for less than 2 hours after intravenous infusion (1, 2). Remdesivir exhibits limited in vitro stability in human plasma, with reported T... 1 / 2For 69 minutes (Siegel D, Hui HC, Doerffler E, Clarke MO, Chun K, Zhang L, Neville S, Carra E, Lew W, Ross B, Wang Q, Wolfe L, Jordan R, Soloveva V, Knox J, Perry J, Perron M, Stray KM, Barauskas O, Feng JY, Xu Y, Lee G, Rheingold AL, Ray AS, Bannister R, Strickley R, Swaminathan S, Lee WA, Bavari S, Cihlar T, Lo MK, Warren TK, Mackman RL. "Discovery and Synthesis of a Phosphoramidate Prodrug of a Pyrrolo[2,1-f][triazine-4-amino]adenine C-nucleoside (GS-5734) for the treatment of Ebola virus and emerging viruses." Pyrrolo[2,1-f][triazin-4-amino]Adenine C-Nucleoside (GS-5734) for the Treatment of Ebola and Emerging Viruses, Journal of Medical Chemistry, March 9, 2017; 60(5):1648-1661.

[0425] The stability of ODE-P-RVn and ODBG-P-RVn in human plasma was evaluated using K2EDTA or sodium heparin as anticoagulants.

[0426] Plasma was infused with 2 μg / ml of ODE-P-RVn or ODBG-P-RVn and incubated at 37°C. Samples were collected at 0.5, 1, 2, 4, 8, and 24 hours and frozen for subsequent analysis by LC / MS / MS using the method shown in Example C. Figure 6A and Figure 6B The results showed that both ODE-P-RVn and ODBG-P-RVn contained K2EDTA ( Figure 6A ) or heparin sodium ( Figure 6BAs an anticoagulant, it is stable in human plasma for at least 24 hours (see, for example, Warren TK et al., Nature, March 17, 2016; 531(7594):381-5; and Tempestilli, M. et al., Journal of Antimicrob Chemother., October 1, 2020; 75(10):2977-2980).

Claims

1. A compound of formula (I): Equation (I); in The NUC is GS-441524: GS-441524; Y is independently selected from the group consisting of free hydrogen and pharmaceutically acceptable cations; x is 0; and R is independently selected from (a)CH3(CH2). 15 O(CH2)3-, (b) CH3(CH2) 17 O(CH2)2-, or （c） 。 2. The compound according to claim 1, wherein Y is hydrogen.

3. The compound according to claim 1, wherein Y is a pharmaceutically acceptable cation.

4. The compound according to claim 1, wherein R is CH3(CH2). 15 O(CH2)3-.

5. The compound according to claim 1, wherein R is CH3(CH2). 17 O(CH2)2-.

6. The compound according to claim 1, wherein R is .

7. The compound according to claim 1, wherein the compound is hexadecyloxypropyl phosphate-RVn: Hexadecyloxypropyl phosphate-RVn.

8. The compound according to claim 1, wherein the compound is octadecyloxyethyl-phosphate-RVn: Octadecyloxyethyl-phosphate-RVn.

9. The compound according to claim 1, wherein the compound is 1-O-octadecyl-2-O-benzyl-sn-glycero-phosphate-RVn: 1-O-octadecyl-2-O-benzyl-sn-glycero-phosphate-RVn.

Images