Tkt gene mutant and its application in the preparation of L-lysine

Abstract

The present invention discloses a tkt gene mutant and its application in the preparation of L-lysine. The tkt gene mutant disclosed in the present invention is a DNA molecule shown in SEQ ID No.3, 5, 7, 9, 11, and 13 in the sequence table, encoding the protein shown in SEQ ID No.4, 6, 8, 10, 12, and 14, and the wild-type tkt gene is a DNA molecule shown in SEQ ID No.1, encoding the protein shown in SEQ ID No.2. Experiments have shown that the tkt gene and its mutant of the present invention can increase L-lysine production, can be used to produce L-lysine, and have good application prospects.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and relates to a tkt gene mutant and application thereof in the preparation of L-lysine. Background Art

[0002] L-lysine has physiological benefits such as promoting growth, enhancing immunity, and improving central nervous system function. It is one of the eight essential amino acids that humans and animals cannot synthesize on their own and are essential for growth. Currently, L-lysine is the second most common amino acid in the world. The main production method is fermentation, with Corynebacterium glutamicum being a key lysine-producing strain. Approximately 90% of industrial L-lysine production is used as a nutritional supplement in the feed industry, 10% as a flavor enhancer and sweetener in the food industry, and as a pharmaceutical intermediate in the pharmaceutical industry.

[0003] Improvements to the fermentation process for producing L-lysine may relate to fermentation technology such as stirring and supplying oxygen; or to the composition of the nutrient medium, such as the sugar concentration during the fermentation process; or to processing the fermentation broth into a suitable product form, such as by drying and granulating the fermentation broth or ion exchange chromatography; or may relate to the inherent performance properties of the relevant microorganisms themselves.

[0004] Methods for improving the performance properties of these microorganisms include mutagenesis, selection of mutants and screening. The strains obtained in this way are resistant to antimetabolites or are auxotrophic for metabolites of regulatory importance and produce L-lysine. Summary of the Invention

[0005] The object of the present invention is to provide a protein that can be used to produce L-lysine, wherein the protein is called tkt protein, and the tkt protein is as follows A1) or A2) or A3):

[0006] A1) comprising (or being) the protein represented by SEQ ID No. 2, or a mutant protein obtained by mutating the alanine residue at position 327 of SEQ ID No. 2 to a threonine residue, a serine residue, a cysteine ​​residue, a proline residue, an asparagine residue, a glutamine residue, a phenylalanine residue, a leucine residue, a valine residue, an isoleucine residue, an aspartic acid residue, a methionine residue, an arginine residue, a glutamic acid residue, a glycine residue, a histidine residue, a lysine residue, a tryptophan residue, or a tyrosine residue;

[0007] A2) a protein having the same function as the protein of A1) by substitution and / or deletion and / or addition of one or more amino acid residues in the amino acid sequence except for position 327;

[0008] A3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of A1) or A2).

[0009] To facilitate purification of the protein in A1), a tag as shown in the following table can be attached to its amino or carboxyl terminus.

[0010] Table: Sequence of tags

[0011] Label residue sequence Poly-Arg 5-6 (usually 5) RRRRR Poly-His 2-10 (usually 6) HHHHHH FLAG 8 DYKDDDDK Strep-tag II 8 WSHPQFEK c-myc 10 EQKLISEEDL

[0012] The protein in A2) is a protein having an amino acid sequence identity of 75% or greater to that of the protein in A1) and having the same function. The 75% or greater identity includes 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity.

[0013] The protein in A2) above can be synthesized artificially, or its encoding gene can be synthesized first and then expressed biologically.

[0014] The gene encoding the protein in A2) above can be obtained by deleting one or more amino acid residue codons from the DNA sequence set forth in SEQ ID No. 3, SEQ ID No. 5, SEQ ID No. 7, SEQ ID No. 9, SEQ ID No. 11, SEQ ID No. 13, or SEQ ID No. 1, and / or performing missense mutations of one or more base pairs, and / or attaching the coding sequence of the tag set forth in the table above to the 5′ and / or 3′ ends of the DNA sequence set forth in SEQ ID No. 3, SEQ ID No. 5, SEQ ID No. 7, SEQ ID No. 9, SEQ ID No. 11, SEQ ID No. 13, and SEQ ID No. 1, respectively, encoding the proteins set forth in SEQ ID No. 4, SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10, SEQ ID No. 12, SEQ ID No. 14, and SEQ ID No. 2.

[0015] The present invention also provides a biological material related to the tkt protein, wherein the biological material is any one of the following B1) to B4):

[0016] B1) a nucleic acid molecule encoding a tkt protein;

[0017] B2) an expression cassette containing the nucleic acid molecule described in B1);

[0018] B3) a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0019] B4) A recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3).

[0020] In the above-mentioned biological material, the nucleic acid molecule in B1) may be any one of the following b11) to b19):

[0021] b11) the DNA molecule shown in SEQ ID No. 3 in the sequence listing;

[0022] b12) the DNA molecule shown in SEQ ID No. 5 in the sequence listing;

[0023] b13) the DNA molecule shown in SEQ ID No. 7 in the sequence listing;

[0024] b14) the DNA molecule shown in SEQ ID No. 9 in the sequence listing;

[0025] b15) the DNA molecule shown in SEQ ID No. 11 in the sequence listing;

[0026] b16) the DNA molecule shown in SEQ ID No. 13 in the sequence listing;

[0027] b17) the DNA molecule shown in SEQ ID No. 1 in the sequence listing;

[0028] b18) a DNA molecule that has 75% or more identity with the nucleotide sequence defined in any one of b11) to b17) and encodes a tkt protein;

[0029] b19) A genomic DNA molecule that hybridizes under stringent conditions to the nucleotide sequence defined in any one of b11) to b18) and encodes a tkt protein.

[0030] The nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA.

[0031] Those skilled in the art can readily mutate the nucleotide sequences encoding the TKT proteins of the present invention using known methods, such as directed evolution and point mutagenesis. Artificially modified nucleotide sequences that share 75% or greater identity with the nucleotide sequences of the TKT proteins of the present invention are derived from and are equivalent to the nucleotide sequences of the present invention, as long as they encode the TKT protein and possess TKT protein function.

[0032] As used herein, the term "identity" refers to sequence similarity to a naturally occurring nucleic acid sequence. "Identity" includes nucleotide sequences that are 75% or greater, or 85% or greater, or 90% or greater, or 95% or greater identical to a nucleotide sequence encoding a tkt protein of the present invention. Identity can be assessed visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to assess identity between related sequences.

[0033] In the above biological materials, the stringent conditions may be as follows: hybridization at 50°C in a mixed solution of 7% sodium dodecyl sulfate (SDS), 0.5M NaPO4 and 1mM EDTA, and washing at 50°C in 2×SSC, 0.1% SDS; hybridization at 50°C in a mixed solution of 7% SDS, 0.5M NaPO4 and 1mM EDTA, and washing at 50°C in 1×SSC, 0.1% SDS; hybridization at 50°C in a mixed solution of 7% SDS, 0.5M NaPO4 and 1mM EDTA, and washing at 50°C in 0.5×SSC, 0.1% SDS; hybridization at 50°C in a mixed solution of 7% SDS, 0.5M NaPO4 and 1mM EDTA, and washing at 50°C in 0.1×SSC, 0.1% The membrane can be rinsed in SDS; alternatively, hybridization can be performed at 50°C in a mixed solution of 7% SDS, 0.5M NaPO4 and 1mM EDTA, and then rinsed in 0.1×SSC, 0.1% SDS at 65°C; alternatively, hybridization can be performed at 65°C in a solution of 6×SSC, 0.5% SDS, followed by washing the membrane once with 2×SSC, 0.1% SDS and once with 1×SSC, 0.1% SDS; alternatively, hybridization and washing the membrane twice at 68°C in a solution of 2×SSC, 0.1% SDS, each for 5 minutes, and then hybridization and washing the membrane twice at 68°C in a solution of 0.5×SSC, 0.1% SDS, each for 15 minutes; alternatively, hybridization and washing the membrane in a solution of 0.1×SSPE (or 0.1×SSC), 0.1% SDS, at 65°C.

[0034] The aforementioned 75% or greater identity may be 80%, 85%, 90% or 95% or greater identity.

[0035] In the above-mentioned biological material, the expression cassette containing a nucleic acid molecule encoding a tkt protein (tkt gene expression cassette) described in B2) refers to DNA capable of expressing the tkt protein in a host cell. This DNA may include both a promoter for initiating transcription of the tkt gene and a terminator for terminating transcription of the tkt gene. Furthermore, the expression cassette may also include an enhancer sequence.

[0036] In the above biological material, the promoter in the expression cassette described in B2) can be the DNA molecule shown at positions 35-437 of SEQ ID No. 15.

[0037] In the above-mentioned biological material, the vector can be a plasmid, cosmid, phage or viral vector. Specifically, the plasmid can be pXMJ19 or pK18mobsacB plasmid.

[0038] B3) The recombinant vector may be pXMJ19-tkt, pXMJ19-tkt A327T 、pXMJ19-tkt A327S 、pXMJ19-tkt A327C 、pXMJ19-tkt A327P 、pXMJ19-tkt A327N 、pXMJ19-tkt A327Q or pK18-tkt A327T .

[0039] pXMJ19-tkt is a recombinant vector obtained by replacing the DNA fragment between the Xbal I and BamH I recognition sequences of pXMJ19 with the DNA fragment shown in SEQ ID No. 15;

[0040] pXMJ19-tkt A327T The difference from pXMJ19-tkt is that pXMJ19-tkt A327T A recombinant vector obtained by replacing the gene shown in SEQ ID No. 1 in pXMJ19-tkt with the gene shown in SEQ ID No. 3;

[0041] pXMJ19-tkt A327S The difference from pXMJ19-tkt is that pXMJ19-tkt A327S A recombinant vector obtained by replacing the gene shown in SEQ ID No. 1 in pXMJ19-tkt with the gene shown in SEQ ID No. 5;

[0042] pXMJ19-tkt A327C The difference from pXMJ19-tkt is that pXMJ19-tkt A327C A recombinant vector obtained by replacing the gene shown in SEQ ID No. 1 in pXMJ19-tkt with the gene shown in SEQ ID No. 7;

[0043] pXMJ19-tkt A327P The difference from pXMJ19-tkt is that pXMJ19-tkt A327PA recombinant vector obtained by replacing the gene shown in SEQ ID No. 1 in pXMJ19-tkt with the gene shown in SEQ ID No. 9;

[0044] pXMJ19-tkt A327N The difference from pXMJ19-tkt is that pXMJ19-tkt A327N A recombinant vector obtained by replacing the gene shown in SEQ ID No. 1 in pXMJ19-tkt with the gene shown in SEQ ID No. 11;

[0045] pXMJ19-tkt A327Q The difference from pXMJ19-tkt is that pXMJ19-tkt A327Q A recombinant vector obtained by replacing the gene shown in SEQ ID No. 1 in pXMJ19-tkt with the gene shown in SEQ ID No. 13;

[0046] pK18-tkt A327T The recombinant vector is obtained by replacing the fragment (small fragment) between the Xbal I and BamH I recognition sites of the pK18mobsacB vector with the DNA fragment shown in SEQ ID No. 6 in the sequence listing, while keeping the other sequences of the pK18mobsacB vector unchanged.

[0047] In the above-mentioned biological material, the microorganism can be yeast, bacteria, algae or fungi. Among them, the bacteria can be Escherichia coli, Corynebacterium glutamicum, Brevibacterium lactofermentum, Corynebacterium pekinense, Brevibacterium ammoniaphagous, Corynebacterium blunt-toothed, Pantoea, Pantoea ananatis, Bacillus brevis, Brevibacterium lactis or Brevibacterium flavum. The yeast can be Saccharomyces cerevisiae or Pichia pastoris.

[0048] In one embodiment of the present invention, the Corynebacterium glutamicum is Corynebacterium glutamicum YP097158 or Corynebacterium glutamicum ATCC13032.

[0049] The recombinant microorganism B4) may be a recombinant microorganism obtained by replacing the tkt gene in a microorganism containing the tkt gene shown in SEQ ID No. 1 with SEQ ID No. 3, SEQ ID No. 5, SEQ ID No. 7, SEQ ID No. 9, SEQ ID No. 11 or SEQ ID No. 13, or a recombinant microorganism obtained by introducing the nucleic acid molecule described in B1) into a microorganism and expressing it.

[0050] In an embodiment of the present invention, the recombinant microorganism is the recombinant bacteria ATCC13032-pXMJ19-tkt A327T 、ATCC13032-pXMJ19-tkt A327S 、ATCC13032-pXMJ19-tkt A327C 、ATCC13032-pXMJ19-tkt A327P 、ATCC13032-pXMJ19-tkt A327N 、ATCC13032-pXMJ19-tkt A327Q , YPL-tkt-1, tkt-1, YPL-tkt-2, YPL-tkt-3, tkt-2, tkt-3, YPL-tkt-4, tkt-4, YPL-tkt-5 or tkt-5.

[0051] ATCC13032-pXMJ19-tkt A327T To convert pXMJ19-tkt A327T Recombinant bacteria obtained by introducing Corynebacterium glutamicum ATCC13032;

[0052] ATCC13032-pXMJ19-tkt A327S To convert pXMJ19-tkt A327S Recombinant bacteria obtained by introducing Corynebacterium glutamicum ATCC13032;

[0053] ATCC13032-pXMJ19-tkt A327C To convert pXMJ19-tkt A327C Recombinant bacteria obtained by introducing Corynebacterium glutamicum ATCC13032;

[0054] ATCC13032-pXMJ19-tkt A327P To convert pXMJ19-tkt A327PRecombinant bacteria obtained by introducing Corynebacterium glutamicum ATCC13032;

[0055] ATCC13032-pXMJ19-tkt A327N To convert pXMJ19-tkt A327N Recombinant bacteria obtained by introducing Corynebacterium glutamicum ATCC13032;

[0056] ATCC13032-pXMJ19-tkt A327Q To convert pXMJ19-tkt A327Q Recombinant bacteria obtained by introducing Corynebacterium glutamicum ATCC13032;

[0057] The only difference between YPL-tkt-1 and Corynebacterium glutamicum YP097158 is that YPL-tkt-1 is a strain obtained by replacing the gene represented by SEQ ID No. 1 of Corynebacterium glutamicum YP097158 with the gene represented by SEQ ID No. 3, while keeping the other sequences unchanged.

[0058] The only difference between tkt-1 and Corynebacterium glutamicum ATCC13032 is that tkt-1 is a strain obtained by replacing the gene shown in SEQ ID No. 1 of Corynebacterium glutamicum ATCC13032 with the gene shown in SEQ ID No. 3, while keeping other sequences unchanged.

[0059] YPL-tkt-2 is a recombinant bacterium obtained by replacing the spacer region of the upper homology arm NCgl1741 and the lower homology arm NCgl1742 in the genome of Corynebacterium glutamicum YP097158 with the DNA fragment shown in SEQ ID No. 16 in the sequence listing, while keeping the other nucleotides unchanged;

[0060] YPL-tkt-3 is a recombinant bacterium obtained by replacing the spacer region of the upper homology arm NCgl1741 and the lower homology arm NCgl1742 in the genome of Corynebacterium glutamicum YP097158 with the DNA fragment shown in SEQ ID No. 17 in the sequence listing, while keeping the other nucleotides unchanged;

[0061] tkt-2 is a recombinant bacterium obtained by replacing the spacer region of the upper homology arm NCgl1741 and the lower homology arm NCgl1742 in the genome of Corynebacterium glutamicum ATCC13032 with the DNA fragment shown in SEQ ID No. 16 in the sequence listing, while keeping the other nucleotides unchanged;

[0062] tkt-3 is a recombinant bacterium obtained by replacing the spacer region of the upper homology arm NCgl1741 and the lower homology arm NCgl1742 in the genome of Corynebacterium glutamicum ATCC13032 with the DNA fragment represented by SEQ ID No. 17 in the sequence listing, while keeping the other nucleotides in the genome of Corynebacterium glutamicum ATCC13032 unchanged;

[0063] YPL-tkt-4 is a recombinant bacterium obtained by introducing pXMJ19-tkt into Corynebacterium glutamicum YP097158;

[0064] YPL-tkt-5 is the pXMJ19-tkt A327T Recombinant bacteria obtained by introducing Corynebacterium glutamicum YP097158;

[0065] tkt-4 is a recombinant bacterium obtained by introducing pXMJ19-tkt into Corynebacterium glutamicum ATCC13032;

[0066] tkt-5 is pXMJ19-tkt A327T The recombinant bacteria were obtained by introducing Corynebacterium glutamicum ATCC13032.

[0067] The present invention also provides a method for preparing L-lysine, comprising: expressing tkt protein in a recipient biological cell, or increasing the content or activity of tkt protein in the recipient biological cell, or increasing the content or activity of a protein represented by SEQ ID No. 4, SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10, SEQ ID No. 12, SEQ ID No. 14, or SEQ ID No. 2 in the recipient biological cell to obtain a recombinant biological cell; and culturing the recombinant biological cell to obtain L-lysine.

[0068] In the above method, the biological cell can be a yeast, bacterium, algae, fungus, plant cell or animal cell that can synthesize L-lysine.

[0069] The biological cell is any biological cell that can synthesize the target amino acid.

[0070] In the above method, the bacterium may be Corynebacterium glutamicum.

[0071] Bacteria of the present invention include but are not limited to Corynebacterium glutamicum, any tkt gene containing SEQ ID No.1 in the sequence table and capable of synthesizing L-lysine can utilize SEQ ID No.2, 4, 6, 8, 10, 12 or 14 of the present invention as tkt mutant protein and related biological materials thereof to produce L-lysine, Escherichia coli, Corynebacterium glutamicum, Brevibacterium lactofermentum, Corynebacterium pekinense, Brevibacterium ammoniaphagoides, Corynebacterium dentata, Pantoea, Pantoea ananatis, Bacillus brevis, Brevibacterium lactis or Brevibacterium flavum. The yeast can be Saccharomyces cerevisiae or Pichia pastoris.

[0072] In one embodiment of the present invention, the Corynebacterium glutamicum is Corynebacterium glutamicum YP097158 or Corynebacterium glutamicum ATCC13032.

[0073] The above method can be achieved by introducing a gene encoding a tkt protein into the cells of the recipient organism and allowing it to be expressed, or by introducing a gene encoding a protein represented by SEQ ID No. 4 or SEQ ID No. 6 or SEQ ID No. 8 or SEQ ID No. 10 or SEQ ID No. 12 or SEQ ID No. 14 or SEQ ID No. 2 into the cells of the recipient organism and allowing it to be expressed;

[0074] Alternatively, the recipient biological cell contains the DNA molecule shown in SEQ ID No. 1, and the method is achieved by replacing the DNA molecule shown in SEQ ID No. 1 in the recipient biological cell with a DNA molecule shown in SEQ ID No. 3 or SEQ ID No. 5 or SEQ ID No. 7 or SEQ ID No. 9 or SEQ ID No. 11 or SEQ ID No. 13.

[0075] In the above method, culturing the recombinant biological cell can be carried out using a culture medium capable of growing the recombinant biological cell;

[0076] And / or, culturing the recombinant biological cell is performed using conditions that enable the recombinant biological cell to grow.

[0077] The recombinant biological cell may be the recombinant microorganism described above.

[0078] The present invention also provides a product for preparing L-lysine, wherein the product contains (or its active ingredient is) tkt or the biological material.

[0079] The use of tkt or the biomaterial in producing L-lysine, or in preparing a product for producing L-lysine, also falls within the scope of protection of the present invention.

[0080] The use of tkt or the biomaterial or the method for preparing L-lysine or the product for preparing L-lysine in preparing food, feed or medicine containing L-lysine also falls within the scope of protection of the present invention.

[0081] The TKT and its biomaterials of the present invention can be used to produce a variety of products, including but not limited to lysine in the examples, and the products produced can also be glutamic acid, threonine, tryptophan, arginine, valine, glycine, alanine, leucine, isoleucine, methionine, proline, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, aspartic acid, histidine, shikimic acid, protocatechuic acid, succinic acid, α-ketoglutaric acid, citric acid, ornithine, citrulline, etc.

[0082] Experiments have shown that the protein of the present invention and related biomaterials can increase the yield of L-lysine, can be used to produce L-lysine, and have good application prospects.

[0083] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0084] Description of biological material deposit

[0085] Classification name: Corynebacterium glutamicum

[0086] Strain ID: YP097158

[0087] Name of depository institution: General Microbiology Center of China Culture Collection Administration of Microorganisms

[0088] Abbreviation of depository unit: CGMCC

[0089] Address of the depository: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Postal Code: 100101

[0090] Deposit date: August 16, 2016

[0091] CGMCC registration number: CGMCC No.12856 DETAILED DESCRIPTION

[0092] The experimental methods in the following examples, unless otherwise specified, are all conventional methods and are carried out in accordance with the techniques or conditions described in the literature in this field or in accordance with the product instructions. The materials, reagents, instruments, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels. The quantitative tests in the following examples were all repeated three times, and the results were averaged. In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence table is the 5' terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA / RNA.

[0093] Example 1: Construction of ATCC13032 strain containing tkt gene mutant

[0094] 1. Construction of tkt gene mutant plasmid

[0095] First, the wild-type tkt gene (sequence shown in SEQ ID No. 1) and its promoter were cloned into the expression vector pXMJ19. Using the NCBI-published genome sequence of Corynebacterium glutamicum ATCC13032 as a template, PCR amplification with primers tkt-F / tkt-R yielded the wild-type tkt promoter and a 2689-bp coding region (sequence shown in SEQ ID No. 15). After the fragment was recovered, it was ligated with the expression vector pXMJ19 (TaKaRa, containing chloramphenicol resistance) recovered by digestion with Xbal I and BamHI using NEBuilder enzyme (NEB) at 50°C for 30 minutes. The ligation product was transformed into DH5α competent cells, spread on 2-YT agar plates containing chloramphenicol (34 mg / L), and cultured at 37°C for 12 hours. The single clones grown in the culture were identified by PCR using primers tkt-F / tkt-R. PCR amplified a 2689 bp fragment, which was the positive transformant pXMJ19-tkt containing the tkt promoter and coding region sequence.

[0096] To obtain mutants encoding the tkt gene, a tkt mutant plasmid was prepared using a random mutagenesis kit (Agilent Technologies, USA). Using the constructed plasmid pXMJ19-tkt as a template and primers tkt-F / tkt-R, PCR amplification was performed to obtain a fragment of the tkt gene coding region and promoter region containing random point mutations (sequence as SEQ ID No. 15, but with random point mutations in the tkt coding region).

[0097] The recovered DNA fragment was ligated with the expression vector pXMJ19 (TaKaRa, containing chloramphenicol resistance) recovered by digestion with Xbal I and Bam HI using NEBuilder enzyme (NEB) at 50°C for 30 minutes. The ligation product was transformed into DH5α and plated onto 2-YT agar plates containing 34 mg / L chloramphenicol and incubated at 37°C for 12 hours. Single colonies that emerged from the culture were identified by PCR using primers tkt-F / tkt-R. Positive transformants containing pXMJ19-tkt-MT and containing the random mutation in the tkt gene were identified by PCR.

[0098] Among them, positions 35-437 of SEQ ID No. 15 represent the tkt gene promoter.

[0099] The primers were designed as follows (synthesized by Shanghai Invitrogen):

[0100] tkt-F:5'- CAGAATAATTAAGCTTTGCATGCCTGCAGGTCGAC TTCACAGCGGACGATTTC-3' (the underlined nucleotide sequence is the pXMJ19 homologous sequence),

[0101] tkt-R:5'- CCAAAACAGCCAAGCTGAATTCGAGCTCGGTACC AGGCAAGTAAGGGATGTGC-3' (the underlined nucleotide sequence is the pXMJ19 homologous sequence).

[0102] 2. Construction of strains containing mutant tkt gene plasmids

[0103] In order to identify the production performance of the mutant vector pXMJ19-tkt-MT constructed in step one in L-amino acids, specifically, the different tkt random mutant plasmids constructed in step one were transformed into the wild-type Corynebacterium glutamicum ATCC13032 strain by electroporation (for specific transformation methods, see WO2014121669A1), and PCR identification was performed using primers tkt-F / tkt-R. PCR amplified a positive transformant of 2689 bp. The positive transformant was cultured three times on a chloramphenicol (34 mg / L) culture plate (see Table 1 for culture medium components and culture conditions) and inoculated into a 500 mL triangular flask containing 30 mL of rich culture medium and shaken at 30°C for 48 h. After the fermentation culture was completed, the concentration of L-amino acids was detected by high performance liquid chromatography (HPLC). As shown in Table 2, a strain with superior L-amino acid production capacity compared to the wild-type Corynebacterium glutamicum ATCC13032 control was selected, namely the ATCC13032-pXMJ19-tkt mutant.

[0104] Rich medium: the solvent is water, the solutes and their concentrations are glucose 30 g / L, (NH4)2SO4 2 g / L, H3PO4 0.5 g / L, KCl 0.8 g / L, MgSO4·7H2O 0.8 g / L, FeSO4·7H2O 0.05 g / L, MnSO4·H2O 0.05 g / L, FM902 yeast powder 1.5 g / L, corn steep liquor 5 g / L, molasses 17 g / L, betaine 0.5 g / L, citric acid 2 g / L, VH 20 mg / L, VB1 1.5 mg / L, VB3 1.5 mg / L VB 12 1.5g / L, sodium hydroxide to adjust pH to 7.0.

[0105] Table 1. Composition of culture medium and culture conditions

[0106]

[0107]

[0108] Table 2. Results of HPLC L-amino acid analysis of ATCC13032-pXMJ19-tkt mutants

[0109]

[0110] As shown in Table 2, the mutant strains of Corynebacterium glutamicum ATCC13032-pXMJ19-tkt have the ability to produce some L-lysine, among which ATCC13032-pXMJ19-tkt mutant 3 has a better ability to produce L-lysine, indicating that tkt gene mutant 3 has the activity of synthesizing L-lysine.

[0111] Plasmids were extracted from ATCC13032-pXMJ19-tkt mutant strain 3, and the tkt gene was sequenced. The results showed that the 979th guanine (G) in the nucleotide sequence of the tkt gene coding region was mutated to adenine (A) (the sequence is shown in SEQ ID No. 3, and the gene containing this mutation is designated as tkt A327T gene), the 327th alanine (A) in the corresponding amino acid sequence was mutated to threonine (T) (the sequence is shown in SEQ ID No. 4, and the protein containing this mutation is denoted as tkt A327T protein), and the plasmid was designated as pXMJ19-tkt A327T The mutant strain containing this plasmid was renamed ATCC13032-pXMJ19-tkt A327T .

[0112] pXMJ19-tkt A327T The difference from pXMJ19-tkt is that pXMJ19-tkt A327T To replace the wild-type tkt gene in pXMJ19-tkt with the mutant tkt A327T The recombinant vector obtained by gene sequence, pXMJ19-tkt A327T Can express tkt A327T Mutant protein; wild-type tkt gene and mutant tkt A327T The only difference between the genes is that the 979-981 positions of the wild-type tkt gene are GCT, while the mutant tkt A327T The 979-981th position of the gene is ACT; the wild-type tkt protein is similar to tkt A327T The only difference between the mutant proteins is that the wild-type tkt protein has an alanine residue A at position 327. A327T The 327th position of the mutant protein is a threonine residue T.

[0113] 3. Construction of tkt gene mutants and recombinant vectors

[0114] The mutant strain ATCC13032-pXMJ19-tkt was obtained by random mutation of wild-type Corynebacterium glutamicum ATCC13032. A327T In order to obtain more tkt mutants to improve their L-lysine production capacity, mutants with the same mutation position as the above tkt but different amino acids were constructed. Specifically, the plasmid pXMJ19-tkt sequenced in step 2 was used. A327T Using tkt as a template, five mutants were constructed in which the amino acid at position 327 of tkt was substituted with different amino acids. The substituted amino acids were all hydrophilic amino acids. The substituted amino acids of the mutants and the names of the primers used in each mutant are shown in Table 3.

[0115] Table 3. Amino acids substituted by tkt mutants and primer names used in each mutant

[0116]

[0117] The primers were designed as follows (synthesized by Shanghai Invitrogen):

[0118] S-PR-1:5'-CCATGCAGCCTTCTTCTGTGCAGAGCGCTCTG-3',

[0119] S-PR-2:5'-CAGAGCGCTCTGCACAGAAGAAGGCTGCATGG-3',

[0120] C-PR-1:5'-CCATGCAGCCTTCTTCTGTGCACAGCGCTCTG-3',

[0121] C-PR-2:5'-CAGAGCGCTGTGCACAGAAGAAGGCTGCATGG-3',

[0122] P-PR-1:5'-CCATGCAGCCTTCTTCTGTGCAGGGCGCTCTG-3',

[0123] P-PR-2:5'-CAGAGCGCCCTGCACAGAAGAAGGCTGCATGG-3',

[0124] N-PR-1:5'-CCATGCAGCCTTTCTTCTGTGCATTGCGCTCTG-3',

[0125] N-PR-2:5'-CAGAGCGCAATGCACAGAAGAAGGCTGCATGG-3',

[0126] Q-PR-1:5'-CCATGCAGCCTTCTTCTGTGCCTGGCGCTCTG-3',

[0127] Q-PR-2:5'-CAGAGCCGCCAGGCACAGAAGAAGGCTGCATGG-3'.

[0128] Using the wild-type Corynebacterium glutamicum ATCC13032 genome as a template, PCR amplification was performed using primers tkt-F / S-PR-1 and KAPA HiFi HotStart (Table 2). A 1405-bp Up DNA fragment containing the tkt mutation was obtained. PCR amplification was performed using primers S-PR-2 / tkt-R and KAPA HiFi HotStart, resulting in a 1248-bp Down DNA fragment containing the tkt mutation. After the PCR reaction, the DNA fragments were recovered by agarose gel electrophoresis using a column-based DNA gel recovery kit. The recovered DNA fragments were ligated with the expression vector pXMJ19, which had been digested with Xbal I and Bam HI, using NEBuilder enzyme (NEB) at 50°C for 30 min. The ligation product was transformed into DH5α and plated onto 2-YT agar plates containing chloramphenicol (34 mg / L) and incubated at 37°C for 12 h. The single clone grown in culture was identified by PCR using primers tkt-F / tkt-R. A positive transformant ATCC13032-pXMJ19-tkt was found, which contained a 2689 bp fragment encoding the protein encoded by the tkt gene and in which the 327th alanine was mutated to tryptophan. A327S The other four strains were constructed in the same manner, wherein the alanine at position 327 was replaced with the amino acids listed in Table 3. The five pXMJ19-tkt mutant vectors and strains were named as listed in Table 3 to obtain the mutant strain ATCC13032-pXMJ19-tkt A327C 、ATCC13032-pXMJ19-tkt A327P 、ATCC13032-pXMJ19-tkt A327N 、ATCC13032-pXMJ19-tkt A327Q .

[0129] ATCC13032-pXMJ19-tkt A327S Contains the recombinant vector pXMJ19-tkt A327S , pXMJ19-tkt A327S The difference from pXMJ19-tkt is that pXMJ19-tkt A327S To replace the wild-type tkt gene in pXMJ19-tkt with the mutant tkt A327SThe recombinant vector obtained by the gene sequence (as shown in SEQ ID No.5) is pXMJ19-tkt A327S Can express tkt A327S mutant protein (as shown in SEQ ID No.6); wild-type tkt gene and mutant tkt A327S The only difference between the genes is that the 979-981 positions of the wild-type tkt gene are GCT, while the mutant tkt A327S The 979-981 positions of the gene are TCT; the wild-type tkt protein is similar to tkt A327S The only difference between the mutant proteins is that the wild-type tkt protein has an alanine residue A at position 327. A327S The 327th position of the mutant protein is a serine residue S.

[0130] ATCC13032-pXMJ19-tkt A327C Contains the recombinant vector pXMJ19-tkt A327C , pXMJ19-tkt A327C The difference from pXMJ19-tkt is that pXMJ19-tkt A327C To replace the wild-type tkt gene in pXMJ19-tkt with the mutant tkt A327C The recombinant vector obtained by the gene sequence (as shown in SEQ ID No.7) is pXMJ19-tkt A327C Can express tkt A327C mutant protein (as shown in SEQ ID No.8); wild-type tkt gene and mutant tkt A327C The only difference between the genes is that the 979-981 positions of the wild-type tkt gene are GCT, while the mutant tkt A327C The 979-981th position of the gene is TGT; the wild-type tkt protein is similar to tkt A327C The only difference between the mutant proteins is that the wild-type tkt protein has an alanine residue A at position 327. A327C The 327th position of the mutant protein is a cysteine ​​residue C.

[0131] ATCC13032-pXMJ19-tkt A327P Contains the recombinant vector pXMJ19-tkt A327P , pXMJ19-tkt A327P The difference from pXMJ19-tkt is that pXMJ19-tkt A327P To replace the wild-type tkt gene in pXMJ19-tkt with the mutant tkt A327P The recombinant vector obtained by the gene sequence (as shown in SEQ ID No.9) is pXMJ19-tktA327P Can express tkt A327P Mutant protein (as shown in SEQ ID No.10); wild-type tkt gene and mutant tkt A327P The only difference between the genes is that the 979-981 positions of the wild-type tkt gene are GCT, while the mutant tkt A327P The 979-981 positions of the gene are CCT; the wild-type tkt protein is similar to tkt A327P The only difference between the mutant proteins is that the wild-type tkt protein has an alanine residue A at position 327. A327P The 327th position of the mutant protein is a proline residue P.

[0132] ATCC13032-pXMJ19-tkt A327N Contains the recombinant vector pXMJ19-tkt A327N , pXMJ19-tkt A327N The difference from pXMJ19-tkt is that pXMJ19-tkt A327N To replace the wild-type tkt gene in pXMJ19-tkt with the mutant tkt A327N The recombinant vector obtained by the gene sequence (as shown in SEQ ID No.11) is pXMJ19-tkt A327N Can express tkt A327N Mutant protein (as shown in SEQ ID No.12); wild-type tkt gene and mutant tkt A327N The only difference between the genes is that the 979-981 positions of the wild-type tkt gene are GCT, while the mutant tkt A327N The 979-981 positions of the gene are AAT; the wild-type tkt protein is similar to tkt A327N The only difference between the mutant proteins is that the wild-type tkt protein has an alanine residue A at position 327. A327N The mutant protein has an asparagine residue N at position 327.

[0133] ATCC13032-pXMJ19-tkt A327Q Contains the recombinant vector pXMJ19-tkt A327Q , pXMJ19-tkt A327Q The difference from pXMJ19-tkt is that pXMJ19-tkt A327Q To replace the wild-type tkt gene in pXMJ19-tkt with the mutant tkt A327Q The recombinant vector obtained by the gene sequence (as shown in SEQ ID No.13) is pXMJ19-tkt A327Q Can express tkt A327QMutant protein (as shown in SEQ ID No.14); wild-type tkt gene and mutant tkt A327Q The only difference between the genes is that the 979-981 positions of the wild-type tkt gene are GCT, while the mutant tkt A327Q The 979-981 positions of the gene are CAG; the wild-type tkt protein is similar to tkt A327Q The only difference between the mutant proteins is that the wild-type tkt protein has an alanine residue A at position 327. A327Q The 327th position of the mutant protein is a glutamine residue Q.

[0134] 4. Detection of L-lysine Production Ability of tkt Mutant Strain

[0135] In order to identify the L-lysine production performance of the mutant vector constructed in step 3, specifically, the five recombinant bacteria constructed in step 3 and the ATCC13032-pXMJ19-tkt A327T After three consecutive passages on chloramphenicol (34 mg / L) culture plates, the cells were inoculated into 500 mL Erlenmeyer flasks containing 30 mL of rich culture medium and shake-fermented at 37°C for 48 h. After the fermentation, the concentration of L-lysine was analyzed by high performance liquid chromatography (HPLC), and the wild-type Corynebacterium glutamicum ATCC13032 was used as a control.

[0136] The results are shown in Table 4. The L-lysine production of each mutant strain was significantly higher than that of the wild-type Corynebacterium glutamicum ATCC13032, while the mutant strain ATCC13032-pXMJ19-tkt A327T The ability to produce L-lysine was higher than that of ATCC13032-pXMJ19-tkt A327S 、ATCC13032-pXMJ19-tkt A327C 、ATCC13032-pXMJ19-tkt A327P 、ATCC13032-pXMJ19-tkt A327N and ATCC13032-pXMJ19-tkt A327Q It is more superior, indicating that the mutation of alanine (A) at position 327 of tkt protein to threonine (T) is more conducive to the accumulation of lysine.

[0137] Table 4. Results of HPLC detection of L-lysine in the W3110-tkt mutant

[0138] strain L-lysine (g / 100mL) ATCC13032 0.002 <![CDATA[ATCC13032-pXMJ19-tkt A327T ]]> 0.585 <![CDATA[ATCC13032-pXMJ19-tkt A327S ]]> 0.138 <![CDATA[ATCC13032-pXMJ19-tkt A327C ]]> 0.076 <![CDATA[ATCC13032-pXMJ19-tkt A327P ]]> 0.084 <![CDATA[ATCC13032-pXMJ19-tkt A327N ]]> 0.113 <![CDATA[ATCC13032-pXMJ19-tkt A327Q ]]> 0.071

[0139] Example 2: Construction of a recombinant vector containing a point mutation in the tkt gene coding region

[0140] Based on the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of primers for amplifying the tkt gene coding region were designed and synthesized. A point mutation was introduced into the tkt gene coding region (SEQ ID No. 1) of Corynebacterium glutamicum YP097158 (deposit number: CGMCC No. 12856, deposit date: August 16, 2016, deposited at: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Tel: 010-64807355) by allelic replacement. The point mutation was to mutate guanine (G) at position 979 in the nucleotide sequence of the tkt gene (SEQ ID No. 1) to adenine (A), thereby obtaining a DNA molecule shown in SEQ ID No. 3 (the mutated tkt gene, named tkt). A327T Gene).

[0141] The DNA molecule shown in SEQ ID No. 1 encodes the protein with the amino acid sequence of SEQ ID No. 2. The DNA molecule shown in SEQ ID No. 3 (tkt A327T Gene) encodes a mutant protein with an amino acid sequence of SEQ ID No. 4 (the mutant protein is named tkt A327T protein). Mutant protein tkt A327T The threonine (T) at position 327 in the amino acid sequence (SEQ ID No. 4) was mutated from alanine (A).

[0142] The recombinant vector was constructed using NEBuilder assembly. The primers were designed as follows (synthesized by Shanghai Invitrogen). The bases in bold indicate the mutation positions:

[0143] P1:5'- CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG CGTCATTGCTTCTGATGG-3' (the underlined nucleotide sequence is the sequence on pK18),

[0144] P2:

[0145] P3:

[0146] P4:5'- CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC CGGAGAAGATGAGGAAGGTTC-3′ (the underlined nucleotide sequence is the sequence on pK18).

[0147] Construction method: Using Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed with primers P1 and P2, and P3 and P4, respectively, to obtain two DNA fragments (tktUp and tktDown) of the tkt gene coding region with mutant bases, each with a size of 514 bp and 482 bp.

[0148] The two DNA fragments (tktUp and tktDown) were separated and purified by agarose gel electrophoresis, and then ligated with the pK18mobsacB plasmid (Addgene) purified after enzyme digestion (Xbal I / Bam HI) using NEBuilder enzyme (NEB) at 50°C for 30 min. The single clones grown after the ligation product transformation were identified by PCR using primers P1 / P4. The one that could amplify a 964 bp fragment was a positive recombinant vector pK18-tkt A327T The recombinant vector contains a kanamycin resistance marker. A327T The recombinant vector pK18-tkt containing the correct point mutation (G979A) was sent to a sequencing company for sequencing identification. A327T Save for later use.

[0149] This recombinant vector pK18-tkt A327T Contains a mutation site (G979A), which will cause the 979th guanine (G) in the coding region of the tkt gene (SEQ ID No. 1) in the strain Corynebacterium glutamicum YP097158 to mutate to adenine (A), and ultimately cause the 327th alanine (A) of the encoded protein to become threonine (T).

[0150] The recombinant vector pK18-tkt A327T The recombinant vector pK18-tkt is obtained by replacing the fragment (small fragment) between the Xbal I and / BamH I recognition sites of the pK18mobsacB vector with the DNA fragment shown in SEQ ID No. 6 in the sequence list, while keeping the other sequences of the pK18mobsacB vector unchanged. A327T Contains the mutant gene tkt shown in SEQ ID No.3 A327T mutation site (G979A).

[0151] Example 3: Construction of a tkt gene A327T Engineered strains

[0152] The allelic replacement plasmid (pK18-tkt A327T) were transformed by electroporation into Corynebacterium glutamicum strain YP097158 (sequencing confirmed that this strain retained the wild-type tkt gene coding region on its chromosome) and wild-type Corynebacterium glutamicum strain ATCC13032, and cultured on solid culture plates containing kanamycin (50 mg / L) for 40 hours. Single colonies resulting from the culture were identified using primers P1 / P4 described in Example 2, respectively; strains that amplified a 964 bp band were identified as positive. Positive strains were streaked on a medium containing 15% sucrose (the medium was obtained by increasing the sucrose concentration in the medium in Table 1 to 150 g / L). Single colonies produced by the culture were cultured on a medium containing kanamycin and a medium not containing kanamycin, respectively. Strains that grew on the medium not containing kanamycin but did not grow on the medium containing kanamycin were selected for further PCR amplification using primers P1 / P4. The resulting multiple DNA fragments (964 bp) were sequenced. By sequence alignment, strains with a base sequence mutation (G979A) were identified as positive strains with successful allelic substitution. The positive strains obtained from Corynebacterium glutamicum YP097158 and wild-type Corynebacterium glutamicum strain ATCC13032 were designated YPL-tkt-1 and tkt-1, respectively.

[0153] The recombinant bacteria YPL-tkt-1 and tkt-1 both contain the mutated gene tkt shown in SEQ ID No.3. A327T , and can express tkt shown in SEQ ID No.4 A327T The difference between the recombinant strain YPL-tkt-1 and Corynebacterium glutamicum YP097158 is that the tkt gene of Corynebacterium glutamicum YP097158 is replaced by tkt A327T The strain obtained by removing the gene and keeping other sequences unchanged; the difference between the recombinant bacterium tkt-1 and the wild-type Corynebacterium glutamicum ATCC13032 is that the tkt gene of the wild-type Corynebacterium glutamicum ATCC13032 is replaced by tkt A327T The strain containing the mutant tkt A327T The recombinant bacteria of the gene can significantly and stably improve the tkt A327T Gene expression level.

[0154] Example 4: Construction of a genome overexpressing tkt gene or tkt A327T Genetically engineered strains

[0155] Based on the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, three pairs of upstream and downstream homology arm fragments and tkt or tkt were designed and synthesized. A327TThe primers of the gene coding region and promoter region were used to insert tkt or tkt into Corynebacterium glutamicum YP097158 and wild type Corynebacterium glutamicum ATCC13032 by homologous recombination. A327T Gene copies.

[0156] The primers were designed as follows (synthesized by Shanghai Invitrogen):

[0157] P5:5' CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG AATGCGTTCTGGACTGAGG3' (the underlined nucleotide sequence is the sequence on pK18),

[0158] P6:5'GAAATCGTCCGCTGTGAAGTGCACCGAGAACAGATG3',

[0159] P7:5'CATCTGTTCTCGGTGCACTTCACAGCGGACGATTTC3',

[0160] P8:5'GATTTAATTGCGCCATCTGAGGCAAGTAAGGGATGTGC3',

[0161] P9:5'GCACATCCCTTACTTGCCTCAGATGGCGCAATTAAATC3',

[0162] P10:5' CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC GCTATGACACCTTCAACGGATC3′ (the underlined nucleotide sequence is the sequence on pK18).

[0163] Construction method: Using the genome of Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed using primers P5 / P6, P7 / P8, and P9 / P10, respectively, to obtain a 763-bp upstream homology arm fragment (corresponding to the partial coding region of the NCgl1740 gene and the NCgl1741 gene and its promoter region of Corynebacterium glutamicum ATCC13032), a 2621-bp fragment of the tkt gene and its promoter (sequence shown in SEQ ID No. 16), and a 596-bp downstream homology arm fragment (corresponding to the partial coding region of the NCgl1742 gene of Corynebacterium glutamicum ATCC13032). After completion of the PCR reaction, the three fragments amplified from each template were recovered by electrophoresis using a column-based DNA gel recovery kit. The three recovered fragments were ligated with the pK18mobsacB plasmid (Addgene) purified after digestion with Xbal I and BamH I using NEBuilder enzyme (NEB) at 50°C for 30 minutes. The resulting clones were identified by PCR using primers M13F / M13R to obtain a positive integration plasmid (recombinant vector). The resulting recombinant vector, pK18-tktOE, contains a kanamycin resistance marker, allowing for kanamycin screening to obtain recombinants with the plasmid integrated into the genome. In SEQ ID No. 16, positions 1-403 represent the promoter of the tkt gene, and positions 404-2506 represent the tkt gene.

[0164] M13F: 5′-TGTAAAACGACGGCCAGT-3′,

[0165] M13R: 5′-CAGGAAACAGCTATGACC-3′.

[0166] Using Corynebacterium glutamicum YPL-tkt-1 as template, PCR amplification was performed with primers P5 / P6, P7 / P8, and P9 / P10, respectively, to obtain a 763 bp upstream homology arm fragment (corresponding to the partial coding region of Corynebacterium glutamicum ATCC13032 NCgl1740 and the NCgl1741 gene and its promoter region), tkt A327TThe gene and its promoter fragment of 2621bp (sequence shown in SEQ ID No. 17) and the downstream homology arm fragment of 596bp (corresponding to the partial coding region of the NCgl1742 gene of Corynebacterium glutamicum ATCC13032). After the PCR reaction was completed, the three fragments obtained by each template amplification were electrophoretically recovered using a column DNA gel recovery kit. The three recovered fragments were connected with the pK18mobsacB plasmid (Addgene) purified after digestion with Xbal I and BamH I using NEBuilder enzyme (NEB) at 50°C for 30 minutes. The single clone grown after the ligation product was transformed and identified by PCR using primers M13F / M13R to obtain a positive integration plasmid (recombinant vector). The resulting recombinant vector is pK18-tkt A327T OE, the positive integration plasmid contains a kanamycin resistance marker, and recombinants with the plasmid integrated into the genome can be obtained by kanamycin screening. In SEQ ID No. 17, positions 1-403 are tkt A327T The promoter of the gene, positions 404-2506 are tkt A327T Gene.

[0167] The correctly sequenced integration plasmids (pK18-tktOE, pK18-tkt A327T OE) were electroporated into Corynebacterium glutamicum strain YP097158 and wild-type Corynebacterium glutamicum ATCC13032, respectively, and cultured in culture medium for 30 hours. Single colonies produced by the culture were identified by PCR using primers P11 / P12. Strains that amplified a fragment of 1559 bp by PCR were identified as positive strains, while those that did not amplify the fragment were identified as original strains. Positive strains were streaked and cultured on solid culture plates containing 15% sucrose for 30 hours. Single colonies produced by the culture were further identified by PCR using primers P13 / P14. Strains that amplified a fragment of 1559 bp by PCR were identified as tkt or tkt A327T Positive strains were generated in which the gene and its promoter were integrated into the spacer region of the upper homology arm NCgl1741 and the lower homology arm NCgl1742 of the Corynebacterium glutamicum genome. The strains obtained using Corynebacterium glutamicum YP097158 as the starting strain were named YPL-tkt-2 (without the mutation point) and YPL-tkt-3 (with the mutation point), respectively; the strains obtained using Corynebacterium glutamicum ATCC13032 as the starting strain were named tkt-2 (without the mutation point) and tkt-3 (with the mutation point), respectively.

[0168] The recombinant strain YPL-tkt-2 contains two copies of the tkt gene shown in SEQ ID No. 1. Specifically, the recombinant strain YPL-tkt-2 is obtained by replacing the spacer region between the upper homology arm NCgl1741 and the lower homology arm NCgl1742 in the genome of Corynebacterium glutamicum YP097158 with the DNA fragment shown in SEQ ID No. 16 (positions 1-403 of SEQ ID No. 16 represent the promoter, and positions 404-2506 represent the tkt gene), while maintaining the other nucleotides in the genome of Corynebacterium glutamicum YP097158 unchanged. Recombinant strains containing two copies of the tkt gene can significantly and stably increase the expression level of the tkt gene.

[0169] The recombinant bacterium tkt-2 contains two copies of the tkt gene set forth in SEQ ID No. 1. Specifically, the recombinant bacterium tkt-2 was obtained by replacing the spacer region between the upper homology arm NCgl1741 and the lower homology arm NCgl1742 in the genome of Corynebacterium glutamicum ATCC13032 with the DNA fragment set forth in SEQ ID No. 16, while maintaining the remaining nucleotide sequences in the genome of Corynebacterium glutamicum ATCC13032 unchanged. Recombinant bacteria containing two copies of the tkt gene can significantly and stably increase tkt gene expression.

[0170] The recombinant strain YPL-tkt-3 contains the mutant tkt shown in SEQ ID No.3 A327T Gene; Specifically, the recombinant bacterium YPL-tkt-3 is a recombinant bacterium in which the spacer region of the upper homology arm NCgl1741 and the lower homology arm NCgl1742 in the genome of Corynebacterium glutamicum YP097158 is replaced with a DNA fragment shown in SEQ ID No.17 (positions 1-403 of SEQ ID No.17 represent the promoter, and positions 404-2506 represent the tkt A327T gene), while keeping the other nucleotides in the genome of Corynebacterium glutamicum YP097158 unchanged to obtain a recombinant bacterium.

[0171] The recombinant bacterium tkt-3 contains the mutant tkt shown in SEQ ID No.3 A327T gene; specifically, the recombinant bacterium tkt-3 is a recombinant bacterium obtained by replacing the spacer region of the upper homologous arm NCgl1741 and the lower homologous arm NCgl1742 in the genome of Corynebacterium glutamicum ATCC13032 with the DNA fragment shown in SEQ ID No.17, while keeping the other nucleotides in the genome of Corynebacterium glutamicum ATCC13032 unchanged.

[0172] PCR identification primers are as follows:

[0173] P11: 5'TCCAAGGAAGATACACGCC 3' (corresponding to the outer side of the upper homology arm NCgl1740),

[0174] P12: 5'GCCACAAGAAAGAACGAAG 3' (corresponding to the inside of the tkt gene),

[0175] P13: 5'CATCCTCAACGGCATTTC 3' (corresponding to the inside of the tkt gene),

[0176] P14: 5'TGGTCGTTGGAATCTTGC 3' (corresponding to the outside of the lower homology arm NCgl1742).

[0177] Example 5: Construction of plasmids for overexpression of tkt gene or tkt A327T Genetically engineered strains

[0178] The pXMJ19-tkt and pXMJ19-tkt successfully constructed in Example 1 were A327T The plasmids were electrotransformed into Corynebacterium glutamicum YP097158 and wild-type Corynebacterium glutamicum ATCC13032, respectively, and cultured in a culture medium (see Table 1 for culture medium ingredients) for 30 h. The single colonies produced by the culture were identified by PCR using primers tkt-F / tkt-R, and the PCR amplified fragment containing a size of 2689 bp (sequence shown in SEQ ID No.15) was a positive strain. The strains obtained using Corynebacterium glutamicum YP097158 as the starting bacteria were named YPL-tkt-4 (containing plasmid pXMJ19-tkt) and YPL-tkt-5 (containing plasmid pXMJ19-tkt). A327T ); The strains obtained using Corynebacterium glutamicum ATCC13032 as the starting bacteria were named tkt-4 (containing plasmid pXMJ19-tkt) and tkt-5 (containing plasmid pXMJ19-tkt A327T ).

[0179] The recombinant bacteria YPL-tkt-4 and tkt-4 contain a plasmid of the tkt gene shown in SEQ ID No. 1, and can significantly and stably increase the expression level of the tkt gene.

[0180] The recombinant strain YPL-tkt-5 and tkt-5 contain the mutant tkt shown in SEQ ID No.3 A327T The plasmid of the gene can significantly and stably increase the expression level of the tkt gene.

[0181] Example 6: Construction of an engineered strain with a tkt gene deleted from its genome

[0182] Based on the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of primers were synthesized to amplify the fragments at both ends of the tkt gene coding region as upstream and downstream homology arm fragments. The primers were designed as follows (synthesized by Shanghai Invitrogen):

[0183] P15:5' CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG GGAAATAGATGGGTGTAGACG 3' (the underlined nucleotide sequence is the sequence on pK18),

[0184] P16:5'GCAAGGAACGGAAACAACGCCTCAGGTCATCCATCTC3',

[0185] P17:5'GAGATGGATGACCTGAAGGCGTTGTTTCCGTTCCTTGC3',

[0186] P18:5' CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC ATCAACCTTTGCCCACAG 3' (the underlined nucleotide sequence is the sequence on pK18).

[0187] Construction method: Using the genome of Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed with primers P15 / P16 and P17 / P18, respectively, to obtain a 772-bp upstream homology arm fragment and an 824-bp downstream homology arm fragment for knocking out tkt. The amplified products were subjected to electrophoresis and purified using a column-based DNA gel recovery kit. The recovered DNA fragments were ligated with the pK18mobsacB plasmid (Addgene) purified after digestion with Xbal I / BamH I using NEBuilder enzyme (NEB) at 50°C for 30 minutes. The resulting clones were identified by PCR using primers M13F / M13R to obtain the positive knockout vector pK18-Δtkt. This plasmid contains kanamycin resistance as a selection marker and was sequenced.

[0188] The knockout plasmid pK18-Δtkt, which had been sequenced correctly, was electroporated into Corynebacterium glutamicum YP097158 and wild-type Corynebacterium glutamicum ATCC13032 and cultured in a culture medium for 30 hours. The resulting single colonies were identified by PCR using primers P15 / P18: strains that simultaneously amplified bands of 1596 bp and 3106 bp were considered positive strains, while strains that only amplified the 3106 bp band were considered the original strain. Positive strains were screened on a 15% sucrose solid medium and then cultured for 30 hours on a medium containing kanamycin and one without. Strains that grew on the medium without kanamycin but did not grow on the medium containing kanamycin were further identified by PCR using primers P15 / P18. Strains that amplified a band of 1596 bp were positive strains in which the coding region of the tkt gene had been partially deleted. The tkt fragment of the positive strain was amplified by PCR with P15 / P18 primers and sequenced again. The correctly sequenced strains were named YPL-tkt-6 (the tkt gene on the genome of Corynebacterium glutamicum YP097158 was knocked out) and tkt-6 (the tkt gene on the genome of wild-type Corynebacterium glutamicum ATCC13032 was knocked out).

[0189] Example 7, L-lysine fermentation experiment

[0190] The strains constructed in Examples 2-6, the original strain of Corynebacterium glutamicum YP097158, and the wild-type Corynebacterium glutamicum ATCC13032 were fermented in a BLBIO-5GC-4-H fermentor (Shanghai Bailun Biotechnology Co., Ltd.) using the culture medium shown in Table 5 and the control process shown in Table 6. After the fermentation, the L-lysine production was detected by the ninhydrin colorimetric method. Each strain was repeated three times, and the results are shown in Table 7.

[0191] Table 5. Fermentation medium formula

[0192]

[0193]

[0194] Table 6. Fermentation control process

[0195]

[0196] Table 7. L-lysine production and significance analysis of tkt engineered strains

[0197]

[0198] The results are shown in Table 7. The tkt gene coding region was subjected to point mutation (G979A) and tkt or tkt was overexpressed in Corynebacterium glutamicum. A327T genes, all contribute to the improvement of L-lysine production; while weakening or knocking out the tkt gene is not conducive to the accumulation of L-lysine.

[0199] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

[0200] The sequences involved in the present invention are as follows:

[0201] SEQ ID No. 1: tkt gene wild-type ORF (CDS) sequence (nucleotide sequence 2103 bp)

[0202]

[0203] SEQ ID No.2: tkt protein sequence (i.e., the amino acid sequence of 700aa encoded by SEQ ID No.1)

[0204] MTTLTLSPELQALTVRNYPSDWSDVDTKAVDTVRVLAADAVENCGSGHPGTAMSLAPLAYTLYQRVMNVDPQDTNWAGRDRFVLSCGHSSLTQYIQLYLGGFGLEMDDLKALRTWDSLTPGHPEYRHTKGVEITTGPLGQGLASAVGMAMAARRERGLFDPTAAEGESPFDHHIYVIASDGDLQEGVTSEASSIAGTQQLGNLIVFWDDNRISIEDNTEIAFNEDVVARYKAYGWQTIEVEAGEDVAAIEAAVAEAKKDTKRPTFIRVRTIIGFPAPTMMNTGAVHGAALGAAEVAATKTELGFDPEAHFAIDDEVIAHTRSLAERAAQKKAAWQVKFDEWAAANPENKALFDRLNSRELPAGYADELPTWDADEKGVATRKASEAALQALGKTLPELWGGSADLAGSNNTVIKGSPSFGPESISTETWSAEPYGRNLHFGIREHAMGSILNGISLHGGTRPYGGTFLIFSDYMRPAVRLAALMETDAYYVWTHDSIGLGEDGPTHQPVETLAALRAIPGLSVLRPADANETAQAWAAALEYKEGPKGLALTRQNVPVLEGTKEKAAEGVRRGGYVLVEGSKETPDVILMGSGSEVQLAVNAAKALEAEGVAARVVSVPCMDWFQEQDAEYIESVLPAAVTARVSVEAGIAMPWYRFLGTQGRAVSLEHFGASADYQTLFEKFGITTDAVVAAAKDSING

[0205] SEQ ID No.3: Mutated tkt A327T ORF (CDS) sequence (nucleotide sequence of 2103bp)

[0206]

[0207] SEQ ID No.4: Mutated tkt A327T Protein sequence (i.e., the amino acid sequence of 700aa encoded by SEQ ID No.3)

[0208] MTTLTLSPELQALTVRNYPSDWSDVDTKAVDTVRVLAADAVENCGSGHPGTAMSLAPLAYTLYQRVMNVDPQDTNWAGRDRFVLSCGHSSLTQYIQLYLGGFGLEMDDLKALRTWDSLTPGHPEYRHTKGVEITTGPLGQGLASAVGMAMAARRERGLFDPTAAEGESPFDHHIYVIASDGDLQEGVTSEASSIAGTQQLGNLIVFWDDNRISIEDNTEIAFNEDVVARYKAYGWQTIEVEAGEDVAAIEAAVAEAKKDTKRPTFIRVRTIIGFPAPTMMNTGAVHGAALGAAEVAATKTELGFDPEAHFAIDDEVIAHTRSLAERTAQKKAAWQVKFDEWAAANPENKALFDRLNSRELPAGYADELPTWDADEKGVATRKASEAALQALGKTLPELWGGSADLAGSNNTVIKGSPSFGPESISTETWSAEPYGRNLHFGIREHAMGSILNGISLHGGTRPYGGTFLIFSDYMRPAVRLAALMETDAYYVWTHDSIGLGEDGPTHQPVETLAALRAIPGLSVLRPADANETAQAWAAALEYKEGPKGLALTRQNVPVLEGTKEKAAEGVRRGGYVLVEGSKETPDVILMGSGSEVQLAVNAAKALEAEGVAARVVSVPCMDWFQEQDAEYIESVLPAAVTARVSVEAGIAMPWYRFLGTQGRAVSLEHFGASADYQTLFEKFGITTDAVVAAAKDSING

[0209] SEQ ID No.5: Mutated tkt A327S ORF (CDS) sequence (nucleotide sequence of 2103bp)

[0210]

[0211] SEQ ID No.6: Mutant tkt A327S Protein sequence (i.e., the amino acid sequence of 700aa encoded by SEQ ID No.5)

[0212] MTTLTLSPELQALTVRNYPSDWSDVDTKAVDTVRVLAADAVENCGSGHPGTAMSLAPLAYTLYQRVMNVDPQDTNWAGRDRFVLSCGHSSLTQYIQLYLGGFGLEMDDLKALRTWDSLTPGHPEYRHTKGVEITTGPLGQGLASAVGMAMAARRERGLFDPTAAEGESPFDHHIYVIASDGDLQEGVTSEASSIAGTQQLGNLIVFWDDNRISIEDNTEIAFNEDVVARYKAYGWQTIEVEAGEDVAAIEAAVAEAKKDTKRPTFIRVRTIIGFPAPTMMNTGAVHGAALGAAEVAATKTELGFDPEAHFAIDDEVIAHTRSLAERSAQKKAAWQVKFDEWAAANPENKALFDRLNSRELPAGYADELPTWDADEKGVATRKASEAALQALGKTLPELWGGSADLAGSNNTVIKGSPSFGPESISTETWSAEPYGRNLHFGIREHAMGSILNGISLHGGTRPYGGTFLIFSDYMRPAVRLAALMETDAYYVWTHDSIGLGEDGPTHQPVETLAALRAIPGLSVLRPADANETAQAWAAALEYKEGPKGLALTRQNVPVLEGTKEKAAEGVRRGGYVLVEGSKETPDVILMGSGSEVQLAVNAAKALEAEGVAARVVSVPCMDWFQEQDAEYIESVLPAAVTARVSVEAGIAMPWYRFLGTQGRAVSLEHFGASADYQTLFEKFGITTDAVVAAAKDSING

[0213] SEQ ID No.7: Mutant tkt A327C ORF (CDS) sequence (nucleotide sequence of 2103bp)

[0214]

[0215] SEQ ID No.8: Mutated tkt A327C Protein sequence (i.e., the amino acid sequence of 700aa encoded by SEQ ID No.7)

[0216] MTTLTLSPELQALTVRNYPSDWSDVDTKAVDTVRVLAADAVENCGSGHPGTAMSLAPLAYTLYQRVMNVDPQDTNWAGRDRFVLSCGHSSLTQYIQLYLGGFGLEMDDLKALRTWDSLTPGHPEYRHTKGVEITTGPLGQGLASAVGMAMAARRERGLFDPTAAEGESPFDHHIYVIASDGDLQEGVTSEASSIAGTQQLGNLIVFWDDNRISIEDNTEIAFNEDVVARYKAYGWQTIEVEAGEDVAAIEAAVAEAKKDTKRPTFIRVRTIIGFPAPTMMNTGAVHGAALGAAEVAATKTELGFDPEAHFAIDDEVIAHTRSLAERCAQKKAAWQVKFDEWAAANPENKALFDRLNSRELPAGYADELPTWDADEKGVATRKASEAALQALGKTLPELWGGSADLAGSNNTVIKGSPSFGPESISTETWSAEPYGRNLHFGIREHAMGSILNGISLHGGTRPYGGTFLIFSDYMRPAVRLAALMETDAYYVWTHDSIGLGEDGPTHQPVETLAALRAIPGLSVLRPADANETAQAWAAALEYKEGPKGLALTRQNVPVLEGTKEKAAEGVRRGGYVLVEGSKETPDVILMGSGSEVQLAVNAAKALEAEGVAARVVSVPCMDWFQEQDAEYIESVLPAAVTARVSVEAGIAMPWYRFLGTQGRAVSLEHFGASADYQTLFEKFGITTDAVVAAAKDSING

[0217] SEQ ID No.9: Mutated tkt A327P ORF (CDS) sequence (nucleotide sequence of 2103bp)

[0218]

[0219] SEQ ID No.10: Mutant tkt A327P Protein sequence (i.e., the amino acid sequence of 700aa encoded by SEQ ID No.9)

[0220] MTTLTLSPELQALTVRNYPSDWSDVDTKAVDTVRVLAADAVENCGSGHPGTAMSLAPLAYTLYQRVMNVDPQDTNWAGRDRFVLSCGHSSLTQYIQLYLGGFGLEMDDLKALRTWDSLTPGHPEYRHTKGVEITTGPLGQGLASAVGMAMAARRERGLFDPTAAEGESPFDHHIYVIASDGDLQEGVTSEASSIAGTQQLGNLIVFWDDNRISIEDNTEIAFNEDVVARYKAYGWQTIEVEAGEDVAAIEAAVAEAKKDTKRPTFIRVRTIIGFPAPTMMNTGAVHGAALGAAEVAATKTELGFDPEAHFAIDDEVIAHTRSLAERPAQKKAAWQVKFDEWAAANPENKALFDRLNSRELPAGYADELPTWDADEKGVATRKASEAALQALGKTLPELWGGSADLAGSNNTVIKGSPSFGPESISTETWSAEPYGRNLHFGIREHAMGSILNGISLHGGTRPYGGTFLIFSDYMRPAVRLAALMETDAYYVWTHDSIGLGEDGPTHQPVETLAALRAIPGLSVLRPADANETAQAWAAALEYKEGPKGLALTRQNVPVLEGTKEKAAEGVRRGGYVLVEGSKETPDVILMGSGSEVQLAVNAAKALEAEGVAARVVSVPCMDWFQEQDAEYIESVLPAAVTARVSVEAGIAMPWYRFLGTQGRAVSLEHFGASADYQTLFEKFGITTDAVVAAAKDSING

[0221] SEQ ID No.11: Mutant tkt A327N ORF (CDS) sequence (nucleotide sequence of 2103bp)

[0222]

[0223] SEQ ID No.12: Mutant tkt A327N Protein sequence (i.e., the amino acid sequence of 700 aa encoded by SEQ ID No.11)

[0224] MTTLTLSPELQALTVRNYPSDWSDVDTKAVDTVRVLAADAVENCGSGHPGTAMSLAPLAYTLYQRVMNVDPQDTNWAGRDRFVLSCGHSSLTQYIQLYLGGFGLEMDDLKALRTWDSLTPGHPEYRHTKGVEITTGPLGQGLASAVGMAMAARRERGLFDPTAAEGESPFDHHIYVIASDGDLQEGVTSEASSIAGTQQLGNLIVFWDDNRISIEDNTEIAFNEDVVARYKAYGWQTIEVEAGEDVAAIEAAVAEAKKDTKRPTFIRVRTIIGFPAPTMMNTGAVHGAALGAAEVAATKTELGFDPEAHFAIDDEVIAHTRSLAERNAQKKAAWQVKFDEWAAANPENKALFDRLNSRELPAGYADELPTWDADEKGVATRKASEAALQALGKTLPELWGGSADLAGSNNTVIKGSPSFGPESISTETWSAEPYGRNLHFGIREHAMGSILNGISLHGGTRPYGGTFLIFSDYMRPAVRLAALMETDAYYVWTHDSIGLGEDGPTHQPVETLAALRAIPGLSVLRPADANETAQAWAAALEYKEGPKGLALTRQNVPVLEGTKEKAAEGVRRGGYVLVEGSKETPDVILMGSGSEVQLAVNAAKALEAEGVAARVVSVPCMDWFQEQDAEYIESVLPAAVTARVSVEAGIAMPWYRFLGTQGRAVSLEHFGASADYQTLFEKFGITTDAVVAAAKDSING

[0225] SEQ ID No.13: Mutant tkt A327Q ORF (CDS) sequence (nucleotide sequence of 2103 bp)

[0226]

[0227] SEQ ID No.14: Mutated tkt gene A327Q Protein sequence (amino acid sequence encoded by SEQ ID No.13, 700aa)

[0228] MTTLTLSPELQALTVRNYPSDWSDVDTKAVDTVRVLAADAVENCGSGHPGTAMSLAPLAYTLYQRVMNVDPQDTNWAGRDRFVLSCGHSSLTQYIQLYLGGFGLEMDDLKALRTWDSLTPGHPEYRHTKGVEITTGPLGQGLASAVGMAMAARRERGLFDPTAAEGESPFDHHIYVIASDGDLQEGVTSEASSIAGTQQLGNLIVFWDDNRISIEDNTEIAFNEDVVARYKAYGWQTIEVEAGEDVAAIEAAVAEAKKDTKRPTFIRVRTIIGFPAPTMMNTGAVHGAALGAAEVAATKTELGFDPEAHFAIDDEVIAHTRSLAERQAQKKAAWQVKFDEWAAANPENKALFDRLNSRELPAGYADELPTWDADEKGVATRKASEAALQALGKTLPELWGGSADLAGSNNTVIKGSPSFGPESISTETWSAEPYGRNLHFGIREHAMGSILNGISLHGGTRPYGGTFLIFSDYMRPAVRLAALMETDAYYVWTHDSIGLGEDGPTHQPVETLAALRAIPGLSVLRPADANETAQAWAAALEYKEGPKGLALTRQNVPVLEGTKEKAAEGVRRGGYVLVEGSKETPDVILMGSGSEVQLAVNAAKALEAEGVAARVVSVPCMDWFQEQDAEYIESVLPAAVTARVSVEAGIAMPWYRFLGTQGRAVSLEHFGASADYQTLFEKFGITTDAVVAAAKDSING

[0229] SEQ ID No.15: Amplification sequence of primer tkt-F / tkt-R (size 2689bp)<[

[0230]

[0231] SEQ ID No. 16: Genome-integrated P7 / P8tkt and its promoter sequence (2621 bp)

[0232]

[0233] SEQ ID No. 17: Genome-integrated P7 / P8 tkt A327T and its promoter sequence (2621 bp)

[0234]

Claims

1. Protein, which is A1) or A2) as follows: A1) a mutant protein obtained by mutating the alanine residue at position 327 of SEQ ID No. 2 to a threonine residue, a serine residue, a cysteine ​​residue, a proline residue, an asparagine residue, or a glutamine residue; A2) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of A1).

2. The biological material related to the protein according to claim 1, which is any one of the following B1) to B4): B1) a nucleic acid molecule encoding the protein according to claim 1; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) A recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3).

3. The biomaterial according to claim 2, characterized in that: B1) The nucleic acid molecule is any one of the following b11) to b16): b11) the DNA molecule shown in SEQ ID No. 3 in the sequence listing; b12) the DNA molecule shown in SEQ ID No. 5 in the sequence listing; b13) the DNA molecule shown in SEQ ID No. 7 in the sequence listing; b14) the DNA molecule shown in SEQ ID No. 9 in the sequence listing; b15) the DNA molecule shown in SEQ ID No. 11 in the sequence listing; b16) The DNA molecule shown in SEQ ID No. 13 in the sequence listing.

4. The biomaterial according to claim 2, wherein: B2) the promoter in the expression cassette is the DNA molecule shown at positions 35-437 of SEQ ID No. 15; The recombinant microorganism B4) is a recombinant microorganism obtained by replacing the tkt gene in a microorganism containing the tkt gene shown in SEQ ID No. 1 with SEQ ID No. 3, SEQ ID No. 5, SEQ ID No. 7, SEQ ID No. 9, SEQ ID No. 11 or SEQ ID No. 13, or a recombinant microorganism obtained by introducing the nucleic acid molecule described in B1) into a microorganism and expressing it.

5. A method for preparing L-lysine, comprising: The method comprises expressing the protein according to claim 1 in a recipient biological cell, or increasing the content of the protein shown in SEQ ID No. 4, SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10, SEQ ID No. 12, or SEQ ID No. 14 in the recipient biological cell to obtain a recombinant biological cell; culturing the recombinant biological cell to obtain L-lysine; the biological cell is a bacterium, and the bacterium is Corynebacterium glutamicum.

6. A product for preparing L-lysine, comprising the protein according to claim 1 or the biomaterial according to any one of claims 2 to 4.

7. Use of the protein according to claim 1 in producing L-lysine or in preparing a product for producing L-lysine.

8. Use of the biomaterial according to any one of claims 2 to 4 in producing L-lysine or in preparing a product for producing L-lysine.

Images