Application of paglbd16.2 gene in regulating poplar plant type development

Abstract

The application belongs to the technical field of genetic engineering, and provides application of a PagLBD16.2 gene in regulating development of a poplar plant type, wherein a nucleotide sequence of the PagLBD16.2 gene is shown as SEQ ID NO. 3. The regulation is achieved by overexpressing the PagLBD16.2 gene, so that the plant height of a transgenic poplar is lower than that of a wild type 84K, the internode diameter is lower than that of the wild type 84K, and the number of internodes is more than that of the wild type 84K. The application has important significance for promoting genetic improvement and breeding of the poplar by overexpressing the poplar gene PagLBD16.2 to regulate development of the poplar plant type.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, and in particular relates to the application of the PagLBD16.2 gene in regulating the development of poplar tree architecture. Background Technology

[0002] Poplar is a general term for deciduous trees belonging to the genus *Populus* in the family Salicaceae. There are over 100 varieties, mainly distributed in temperate and cold-temperate regions of the Northern Hemisphere. Poplars play an important role in various aspects of ecology, economy, and society. They grow rapidly, forming dense forests in a short time, and have a strong ability to conserve soil and prevent water erosion. Furthermore, poplar wood has a clear grain, making it suitable for furniture, building materials, and pulp, giving it high economic value. 84K poplar is the latest generation of white poplar variety. It is a hybrid of silver poplar (*Populus alba*) and glandular poplar (*Populus glandulosa*), possessing excellent characteristics such as easy rooting, rapid growth in seedlings and saplings, good wood quality, strong wind resistance, and wide adaptability. More importantly, 84K poplar is a male-sexual clone, producing no pollutants, making it an excellent afforestation and landscaping species.

[0003] The LBD16 gene belongs to the LBD (Later alorganboundaries domain) gene family, a family of transcription factors unique to higher plants that plays a crucial role in physiological processes such as lateral organ development, stress response, secondary growth, regeneration, and secondary metabolite synthesis. LBD16 primarily regulates lateral root formation and plant regeneration; however, there are currently no reports on its effects on stem segment development in woody plants. Summary of the Invention

[0004] The purpose of this invention is to provide the application of the PagLBD16.2 gene in regulating poplar tree development, thereby addressing the problems mentioned in the background section.

[0005] The present invention is implemented as follows: the application of the PagLBD16.2 gene in regulating the development of poplar tree architecture, and the nucleotide sequence of the PagLBD16.2 gene is shown in SEQ ID NO.3.

[0006] Preferably, the regulation is achieved by overexpressing the PagLBD16.2 gene, which results in the transgenic poplar having a lower plant height, lower internode diameter, and more internodes than the wild-type 84K, and overexpression of the PagLBD16.2 gene causes the transgenic poplar to branch earlier.

[0007] Preferably, it includes the following steps:

[0008] (1) Gene cloning: Amplification primers were designed, and the PagLBD16.2 gene coding sequence was obtained by PCR amplification using 84K Yang genomic cDNA as a template.

[0009] (2) Construct a plant expression vector for the PagLBD16.2 gene;

[0010] (3) Transgenic transformation: The overexpression vector containing the PagLBD16.2 gene was transformed into 84K poplar using Agrobacterium-mediated transformation. After pre-culture, infection, dark culture, induction of adventitious buds, induction of bud rooting, propagation, hardening, and transplanting to greenhouse.

[0011] (4) Identification, propagation and screening.

[0012] Preferably, in step (2), the plant expression vector is pCAMBIA1300-35S-GFP.

[0013] Preferably, in step (3), the method of infecting with Agrobacterium is the immersion method.

[0014] This invention proposes that overexpression of the poplar gene PagLBD16.2 can regulate poplar tree development, which is of great significance for promoting poplar genetic improvement and breeding. Attached Figure Description

[0015] Figure 1 The backbone map of the expression vector pCAMBIA1300-35S-GFP containing a strong 35S promoter, which was cloned into the coding sequence of the PagLBD16.2 gene using homologous recombination in an embodiment of the present invention;

[0016] Figure 2 The results of the detection of transcriptional expression level of 35Spro::PagLBD16.2-GFP transgenic poplar provided in the embodiments of the present invention;

[0017] Figure 3 The overexpression of PagLBD16.2 in this embodiment of the invention reduces poplar tree height;

[0018] Figure 4 The overexpression of PagLBD16.2 provided in this embodiment of the invention reduces the internode diameter of poplar trees, increases the number of internodes, and the overexpression of the PagLBD16.2 gene causes the transgenic poplar trees to branch earlier. Detailed Implementation

[0019] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0020] The specific implementation of the present invention will be described in detail below with reference to specific embodiments.

[0021] Example 1: Application of the PagLBD16.2 gene in regulating poplar tree architecture development, including the following steps:

[0022] (1) Gene cloning: The protein sequence of the Arabidopsis thaliana AtLBD16 gene was found on the Tair website. Through sequence alignment, the gene PagLBD16.2, which is the closest homologous to it in the genome of 84K Populus albax Populus glandulosa, was obtained. Amplification primers were designed using SnapGene software, and the protein coding sequence of PagLBD16.2 was obtained by PCR amplification using 84K Populus genomic cDNA as a template. The specific process is as follows:

[0023] 1. Extract total RNA from 84K poplar leaves:

[0024] Prepare 0.2g of poplar leaf fragments, grind them into powder under liquid nitrogen, and extract RNA using the kit from Tiangen Biotech Co., Ltd. (RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit);

[0025] 2. Reverse transcription of RNA into cDNA:

[0026] 84K Yang cDNA was obtained using the All-Gold EasyScript One-Step gDNA Removal and cDNA Synthesis Kit;

[0027] 3. PCR amplification of the target gene PagLBD16.2:

[0028] 3.1 Analysis and design of homologous amplification primers for the PagLBD16.2 coding region:

[0029] PagLBD16.2-F:

[0030] GAGCTCGGTACCATGGCATCATCTGTGACTGGCAC (as shown in SEQ ID NO.1);

[0031] PagLBD16.2-R:

[0032] GACTCTAGAGGATCCGTTCCTCATCATTCTAAGTGCC (as shown in SEQ ID NO.2);

[0033] 3.2 The PCR reaction system is shown in Table 1:

[0034] Table 1

[0035] Components volume cDNA 1μl ForwardPrimmer 1μl ReversPrimmer 1μl 2×PhantaMaxMasterMix 25μl <![CDATA[ddH2O]]> 22μl Total 50μl

[0036] 3.3 PCR reaction conditions are shown in Table 2:

[0037] Table 2

[0038]

[0039] 3.4 Identification by 1% agarose gel electrophoresis:

[0040] Weigh 0.5g of agarose, add 50ml of 1×TAE, heat to melt, cool to room temperature, add 5μl of nucleic acid dye, and after the agarose gel cools, add the PCR product to the sample wells and electrophoresis for 15min; cut the target band with a scalpel, put it into a 1.5ml centrifuge tube and weigh it; recover the 648bp target gene fragment according to the instructions of the DNA gel recovery kit of Beijing TransGen Biotech Co., Ltd., and its nucleotide sequence is shown in SEQ ID NO.3.

[0041] (2) Construction of the PagLBD16.2 gene plant expression vector: The coding sequence of the PagLBD16.2 gene was cloned into the expression vector pCAMBIA1300-35S-GFP containing a strong 35S promoter using homologous recombination. Figure 1 As shown, the specific process is as follows:

[0042] 1. Double digestion of pCAMBIA1300-35S-GFP vector: KpnⅠ and BamHI were selected as the restriction sites. The reaction mixture was added according to Table 3, and the digestion was carried out at 37℃ for 20 min.

[0043] Table 3

[0044]

[0045]

[0046] 2. Using a homologous recombination kit purchased from Tiangen Biotech (Beijing) Co., Ltd., the target gene and vector were ligated;

[0047] 3. The ligation product was transferred into *E. coli* competent cells TOP 10, incubated on ice for 30 min, heat-shocked for 45 s, and then incubated on ice again for 2 min. 600 μl of LB liquid culture medium was added, and the cells were placed in a constant temperature shaker at 37°C and 220 rpm for 1 h to recover. 100 μl of activated *E. coli* was evenly spread onto LB solid medium containing Kana antibiotic. The cells were incubated upside down at 37°C for 12-16 h. After colony growth, single colonies were picked and grown in 700 μl of LB liquid medium containing Kana antibiotic at 37°C for 6 h. After adding the reaction mixture according to Table 4, colony PCR was performed, and the colonies were identified by agarose gel electrophoresis. Colonies showing the target band were sent to the company for sequencing to screen for positive clones. The vector was named 35Spro::PagLBD16.2-GFP.

[0048] Table 4

[0049] Components volume bacterial solution 1μl ForwardPrimmer 1μl ReversPrimmer 1μl 2×TaqMasterMix 10μl <![CDATA[ddH2O]]> 7μl Total 20ul

[0050] (3) Transgenic transformation: The overexpression vector containing the coding sequence of the PagLBD16.2 gene was transformed into 84K poplar using Agrobacterium-mediated transformation. After pre-culture, infection, dark culture, induction of adventitious shoots, induction of shoot rooting, propagation, hardening, and transplanting to the greenhouse, the specific details are as follows:

[0051] 1. Leaf pre-culture: Take leaves from wild-type 84K tissue culture seedlings that are 4-5 weeks old and in good growth condition. In a clean bench, use sterile sterilization equipment to make cuts on the leaves along the direction perpendicular to the veins. Lay the leaves flat on the antibiotic-free pre-culture medium with the upper surface facing up and incubate at 25℃ for 2 days.

[0052] 2. Preparation of Agrobacterium infection solution: Pick a sample containing Agrobacterium from the plate.

[0053] A single colony of Agrobacterium (GV3101 Agrobacterium competent cells) with the 35Spro::PagLBD16.2-GFP vector was inoculated into 100 mL of liquid LB medium containing Kana and Rif antibiotics and cultured at 28°C and 180 rpm until OD = 0.6-0.8.

[0054] 3. Infection and co-culture: In a clean bench, immerse the pre-cultured leaves in Agrobacterium bacterial solution for 15 minutes, gently shaking them 2-3 times during the process to ensure that the injured parts of the leaves are fully in contact with the bacterial solution. After infection, remove the leaves with sterile forceps and place them on pre-sterilized filter paper to absorb excess bacterial solution. Finally, inoculate the infected leaves onto a co-culture medium without antibiotics and incubate them in the dark at 25°C for 3 days.

[0055] 4. Resistance culture: In a clean bench, leaves that have been dark-treated for 3 days are placed on pre-sterilized filter paper to remove excess bacteria, and then transferred to differentiation and selection medium. Under the conditions of 25℃, 16h light / 8h dark, adventitious buds resistant to hygromycin are induced and screened.

[0056] 5. After 10 days of selective culture, in a clean bench, use sterile forceps to place the light green, dense callus tissue or leaves with adventitious buds onto a new selective culture medium so that the callus tissue or adventitious buds can have more sufficient nutrition to induce differentiation.

[0057] 6. Continue to culture for about 2 weeks. When the adventitious buds grow to 3-4 cm or more, use a sterile scalpel in a clean bench to cut off the adventitious buds individually and place them on a rooting medium containing selection medium (50 mg / L hygromycin) and sterilization medium (200 mg / L termethin) for rooting culture. Two weeks later, the adventitious buds will grow adventitious roots. After rooting, subculture for propagation (the first subculture medium contains termethin and hygromycin, and subsequent subcultures only contain termethin).

[0058] 7. The culture medium formulations used for the above genetic transformations are shown in Table 5, 1L (adjusted to pH 5.8-6.0 with NaOH):

[0059] Table 5

[0060]

[0061] (4) Identification of transgenic plants: A total of 18 resistant plants were obtained through the above transformation method. Leaves of the resistant plants were cut off, and their genomic DNA was extracted. Identification primers were designed, and positive transgenic plants were identified by PCR, as follows:

[0062] 1. Steps for rapid extraction of genomic DNA:

[0063] Take 0.2g of poplar leaves and place them in a 2ml centrifuge tube containing small steel balls. After quick-freezing with liquid nitrogen, grind them into powder using a grinder. Add 400μl of Edwards extract, shake and grind for 15s, then centrifuge at 12000rpm for 3min. Take the supernatant into a 1.5ml centrifuge tube, add an equal volume of isopropanol (400μl), and mix by pipetting. After incubating on ice for 30min, centrifuge at 12000rpm for 5min and discard the supernatant. Add 400μl of 70% ethanol to the precipitate, centrifuge at 12000rpm for 2min, discard the supernatant, and dry overnight at 28℃. Add 15μl of lddH2O to the precipitate and store at 4℃.

[0064] 2. PCR identification of transgenic poplar:

[0065] Forward primers were designed based on the PagLBD16.2 genome sequence, and reverse primers were designed based on the vector pCAMBIA1300-35S-GFP. After PCR amplification, electrophoresis was performed. The plasmid 35Spro::PagLBD16.2-GFP was used as a positive control, and the wild-type 84K poplar was used as a negative control. Agarose gel electrophoresis was used to verify the positive transgenic plants.

[0066] 2.1 Identification primers:

[0067] PagLBD16.2-F: ATGGCATCATCTGTGACTGGCAC (as shown in SEQ ID NO.4);

[0068] GFP-R: CTACCTGTTCCATGGCCAACAC (as shown in SEQ ID NO.5);

[0069] 2.2 The PCR reaction system is shown in Table 6:

[0070] Table 6

[0071] Components volume DNA 1μl ForwardPrimmer 1μl ReversPrimmer 1μl 2×PhantaMaxMasterMix 10μl <![CDATA[ddH2O]]> 7μl Total 20μl

[0072] 2.3 PCR reaction conditions are shown in Table 7:

[0073] Table 7

[0074]

[0075]

[0076] 2.4. 10 μl of PCR product was taken and detected by 1% agarose gel electrophoresis. Four positive plants that were successfully transformed with 35Spro::PagLBD16.2-GFP were identified.

[0077] (5) Identification of expression levels in transgenic plants: Total RNA was extracted from the 35Spro::PagLBD16.2-GFP transgenic poplar line, and the expression level of the PagLBD16.2 gene was detected using real-time quantitative PCR; the results of real-time quantitative PCR are as follows: Figure 2 As shown, the highest expression levels were observed in lines #1 and #2. Therefore, lines #1 and #2 were selected as the subsequent experimental materials. The specific steps are as follows:

[0078] 1. Total RNA was extracted from poplar trees using a kit from Tiangen Biotech Co., Ltd.

[0079] (RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit);

[0080] 2. Poplar RNA reverse transcription was performed using the EasyScript one-step gDNA removal and cDNA synthesis kit.

[0081] 3. Detection of PagLBD16.2 expression level using real-time quantitative PCR:

[0082] The cDNA obtained from reverse transcription was processed using TransGen Biotech Co., Ltd. Gene expression quantification was performed using GreenqPCR SuperMix fluorescent quantitative enzyme, as detailed below:

[0083] 3.1 The Real-time PCR reaction system is shown in Table 8:

[0084] Table 8

[0085]

[0086] 3.2 The amplification conditions for real-time quantitative PCR are shown in Table 9:

[0087] Table 9

[0088]

[0089] Repeat the amplification step 40 times, and collect fluorescence signals after each cycle; at 65-95℃, increase the temperature by 0.5℃ every 5 seconds, and plot the melting curve.

[0090] (6) Transgenic phenotypic analysis: Overexpression transgenic lines #1 and #2 with high expression levels and wild-type 84K were selected. More than 20 plants were propagated from each line. Fifteen tissue culture seedlings with uniform growth were selected for soil culture at 24℃ with 16h light / 8h darkness for 2 months. The growth indicators such as plant height, number of branches, and number of internodes of the two-month-old wild-type 84K and overexpression lines were measured and statistically analyzed. Fifteen plants from each line were measured to explore the effect of overexpression of the PagLBD16.2 gene on the growth and development of poplar.

[0091] Through the determination and analysis of growth phenotypes, such as Figure 3 As shown, the height of transgenic poplar 35Spro::PagLBD16.2-GFP (OE#1, OE#2) was significantly reduced compared to the wild-type 84K, approximately 0.3 and 0.78 times that of the control lines, respectively; Figure 4As shown, the internode diameter of the overexpressing transgenic lines (OE#1, OE#2) was significantly lower than that of the wild-type 84K. In terms of internode number, the number of internodes in the overexpressing plants (OE#1, OE#2) was significantly higher than that in the control lines, approximately 1.24 and 1.47 times that of the control lines, respectively. According to the analysis of the results of various physiological indicators, PagLBD16.2 plays an important role in the growth of poplar trees and participates in the development of poplar tree type.

[0092] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. PagLBD16.2 The application of genes in regulating poplar tree architecture development is characterized by, The PagLBD16.2 The nucleotide sequence of the gene is shown in SEQ ID NO.3; The regulation method is through overexpression. PagLBD16.2 The gene resulted in transgenic poplar trees that were shorter, had smaller internode diameters, and more internodes than the wild-type 84K, and were overexpressed. PagLBD16.2 Genes cause genetically modified poplar trees to branch earlier.

2. The application according to claim 1, characterized in that, Includes the following steps: (1) Gene cloning: Amplification primers were designed, and 84K poplar genomic cDNA was used as a template for PCR amplification to obtain PagLBD16.2 Gene coding sequence; (2) Construction PagLBD16.2 Gene expression vectors for plants; (3) Transgenic transformation: converting materials containing genetically modified organisms (GMOs) into genetically modified organisms (GMOs). PagLBD16.2 The gene overexpression vector was transferred into Populus tomentosa 84K using Agrobacterium-mediated transformation. After pre-culture, infection, dark culture, induction of adventitious shoots, induction of shoot rooting, propagation, hardening, and transplanting to greenhouse, the seedlings were transplanted. (4) Identification, propagation and screening.

3. The application according to claim 2, characterized in that, In step (2), the plant expression vector is pCAMBIA1300-35S-GFP.

4. The application according to claim 2, characterized in that, In step (3), the method of infection is immersion.

Images