Bacillus subtilis and application thereof in disease control of nanguo pear

By applying Bacillus subtilis SNBS-3 and its preparations, the problem of diseases in Nanguo pear was solved, achieving significant control effects and improving fruit quality and yield.

CN116286472BActive Publication Date: 2026-04-10SHENYANG AGRI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202310050863.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-02-02
Publication Date
2026-04-10
Estimated Expiration
2043-02-02

AI Technical Summary

Technical Problem

Nanguo pears are susceptible to microbial diseases during their growth, especially black spot and red spot, which lead to a decline in fruit yield and quality. Existing control methods have limited effectiveness.

Method used

Bacillus subtilis SNBS-3 and its preparations, which contain a variety of Bacillus species and fungi, are used in the form of biofertilizers and biocontrol agents. By utilizing its high production of chitinase, protease and acid production capabilities, it inhibits pathogenic microorganisms and improves the healthy growth of plants.

Benefits of technology

It significantly reduced the incidence of black spot and red spot diseases in Nanguo pear, improved fruit quality and yield, with control efficiencies of 88.28% and 71.36% respectively, and significantly increased the yield of healthy and disease-free fruit.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116286472B_ABST
    Figure CN116286472B_ABST
Patent Text Reader

Abstract

The present application relates to the field of functional microorganism screening and application technology, and particularly relates to a Bacillus subtilis and application thereof in disease control of Pyrus ussuriensis. The Bacillus subtilis is Bacillus subtilis SNBS-3, which has been preserved in the China General Microbiological Culture Collection Center (CGMCC) on June 9, 2022, and the address of the CGMCC is No. 1, Yihuangyijin 3hao, Beichenxilu, Chaoyang District, Beijing, and the Institute of Microbiology, Chinese Academy of Sciences, and the preservation number is CGMCC No. 25040. The Bacillus subtilis can produce protease and chitinase in a high yield, and has a good control effect on common diseases of Pyrus ussuriensis such as black spot and brown spot, and has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of functional microorganism screening and application technology, and particularly relates to a bacillus subtilis and application thereof in disease prevention of south pear BACKGROUND

[0002] With the improvement of people's quality of life, the proportion of fruit and vegetable food in daily diet gradually increases. In the planting and growth of fruits and vegetables, diseases and insect pests are easily caused due to planting conditions and insect pests, thereby causing the quality of fruits and vegetables to decrease. South pear is a special fruit in Anshan, Liaoning Province, which has bright color, delicate flesh, refreshing and juicy, and has high use value and nutritional value. However, the growth of south pear is often affected by microbial diseases and insect pests, which significantly reduces the quality and yield of south pear. Therefore, in order to protect the income of fruit farmers, it is urgent to find a method for preventing and treating south pear diseases.

[0003] The main diseases of south pear include black star disease and red star disease. Black star disease, also known as scab disease, is a very common and very harmful disease, which has a very adverse effect on the healthy growth of south pear. The occurrence of black star disease will cause the number of fruits that can be set by south pear trees to gradually decrease, which will greatly affect the yield of south pear. South pear red star disease, also known as pear rust disease, is one of the common diseases of south pear, which generally does not cause serious harm. However, in recent years, due to the advancement and rapid expansion of urbanization, a large number of cypress trees are planted in urban scenic areas and green areas, which has caused the occurrence of south pear rust disease to increase year by year, affecting economic benefits. The young fruits of south pear rust are damaged, and orange yellow spots appear on the fruit surface, followed by small black spots, causing the young fruits to be deformed and easy to fall off, which damages the quality of south pear.

[0004] In nature, plants are closely related to microorganisms in the growth environment. The physiological activities of plants affect the distribution of microorganisms in and around the plants, and these microorganisms can also affect the growth and development of plants through life activities. At the same time, there are symbiotic, parasitic, competitive and partial relationships between microorganisms. The use of biocontrol bacteria to prevent and control plant diseases takes advantage of the relationship between plants and microorganisms and the relationship between microorganisms. One or more beneficial microorganisms, i.e. biocontrol bacteria, are used to reduce the number or pathogenic activity of pathogenic microorganisms, so as to reduce the occurrence of plant diseases and promote the healthy growth of plants. Biocontrol bacteria for preventing and controlling plant diseases have become the focus of people's research due to their greenness, safety, non-resistance, strong selectivity and other advantages. SUMMARY

[0005] The application provides Bacillus subtilis and application of the Bacillus subtilis in disease control of Pyrus ussuriensis, and has a good control effect on common diseases such as black star disease and red star disease of Pyrus ussuriensis, and has a wide application prospect.

[0006] In one aspect, the application provides Bacillus subtilis SNBS-3, which has been preserved in the China General Microbiological Culture Collection Center (CGMCC) on June 9, 2022, and is located at No. 1, Xiliujia, Beichen West Road, Chaoyang District, Beijing, China, and the Institute of Microbiology, Chinese Academy of Sciences, and has a preservation number of CGMCC No. 25040.

[0007] The application also provides application of the Bacillus subtilis in preparation of a biological fertilizer.

[0008] The application also provides application of the Bacillus subtilis in plant disease control.

[0009] The plant disease is black star disease or red star disease of Pyrus ussuriensis.

[0010] The application also provides a microbial preparation containing the above-mentioned Bacillus subtilis SNBS-3.

[0011] The microbial preparation also contains one or more of Bacillus amyloliquefaciens, Bacillus licheniformis, Bacillus laterosporus, Bacillus polymyxa, Bacillus coagulans, Bacillus marinus, Bacillus endophyticus, Bacillus megaterium, Bacillus thuringiensis, Trichoderma harzianum, Paecilomyces lilacinus and Rhodopseudomonas palustris.

[0012] The viable bacterial amount of the Bacillus subtilis SNBS-3 in the microbial preparation is at least 10 9 CFU / g.

[0013] The application also provides application of the above-mentioned microbial preparation in a biological fertilizer.

[0014] The application also provides application of the above-mentioned microbial preparation in plant disease control.

[0015] The plant disease is black star disease or red star disease of Pyrus ussuriensis.

[0016] Beneficial effects

[0017] The bacillus subtilis SNBS-3 screened from fermented soybean paste has a significant inhibitory effect on the black star disease bacteria, and the inhibition rate reaches 99.93%, close to 100%. The strain has obvious prevention and treatment effects on the black star disease and the red star disease of Nanguo pear, and can significantly improve the fruit quality and yield; compared with the control group, the incidence of the black star disease and the red star disease of Nanguo pear in the treatment group applying the bacillus subtilis SNBS-3 powder is significantly reduced, and the prevention and treatment efficiencies are as high as 88.28% and 71.36% respectively, and the Nanguo pear fruits in the treatment group are larger and fuller, and the yield of healthy and disease-free fruits is increased by 32.6% compared with the control group.

[0018] The bacillus subtilis SNBS-3 can produce chitinase and protease in large amounts; after fermentation for 24 hours, the chitinase and protease enzyme activities in the fermentation supernatant are as high as 3.96 U / mL and 135.25 U / mL respectively, and unexpected technical effects are achieved.

[0019] In addition, the bacillus subtilis SNBS-3 has strong acid-producing capacity; after fermentation for 4 hours, a large amount of acid is produced, and the pH value of the fermentation liquor rapidly decreases; after 14 hours, the fermentation enters a stable period, and the pH value of the fermentation liquor is stably kept at about 3.6.

[0020] The bacillus subtilis SNBS-3 provided by the application can be used as a biological fertilizer, a biocontrol agent and the like, and is widely applied in the field of agricultural production, has significant effects and wide application prospects. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 It is a colony diagram of the bacillus subtilis SNBS-3;

[0022] Figure 2 It is a microscope examination diagram of the bacillus subtilis SNBS-3;

[0023] Figure 3 It is a product detection electrophoresis diagram of the bacillus subtilis SNBS-3;

[0024] Figure 4 It is a molecular biology identification diagram of the bacillus subtilis SNBS-3;

[0025] Figure 5 It is a NAG standard curve;

[0026] Figure 6 It is a protease hydrolysis circle of the bacillus subtilis SNBS-3;

[0027] Figure 7 It is an acid production curve diagram of the bacillus subtilis SNBS-3;

[0028] Figure 8 It is an inhibitory effect diagram of the bacillus subtilis SNBS-3 on the black star disease bacteria;

[0029] Figure 9 The figure of the bacteriostatic tendency of Bacillus subtilis SNBS-3 to the black spot of Nanguo pear is shown. DETAILED DESCRIPTION

[0030] The screening method described in the present application is not limited to the description in the examples, and any known method capable of achieving the screening purpose can be used. The screening description in the examples is only for the description of the present application, and is not a limitation on the protection scope of the present application. Any modification or replacement of the method, step or condition of the present application without departing from the spirit and essence of the present application shall fall within the scope of the present application.

[0031] The culture medium used in the examples of the present application and its formula are as follows:

[0032] LB culture medium: 10 g of sodium chloride, 10 g of tryptone, 5 g of yeast extract powder, 1000 mL of distilled water, pH 7.2; 20 g of agar (solid culture medium).

[0033] PDA culture medium: 200 g of peeled potatoes, 20 g of glucose (Shanghai Chemical Reagent Co., Ltd. of China Pharmaceutical Group, AR), 20 g of agar, and distilled water to 1 L.

[0034] Protease differential medium: 115 g of skimmed milk powder, 20 g of agar, and distilled water to 1 L.

[0035] The present application will be further described in conjunction with the specific embodiments.

[0036] Example 1: Isolation and identification of strains

[0037] 1. Sample source

[0038] Traditional fermented soybean paste collected in Shenyang, Liaoning Province.

[0039] 2. Preliminary screening of Bacillus

[0040] Accurately weigh 1 g of naturally fermented soybean paste sample, add 9 mL of sterilized 0.9% saline, mix well, heat in a water bath at 80℃ for 20 min to kill non-sporulated microorganisms, and then add the original solution to 100 mL of LB liquid medium and culture at 37℃ for 24 h.

[0041] Take the bacterial liquid after enrichment culture, dilute it by 10 times gradient, take 10 -6 g / mL dilution sample for plate coating, culture at 37℃ for 18-24 h, pick single colonies for streaking and purification until single colony pure strains are obtained. After preliminary screening, 11 strains of Bacillus are obtained, which are named SNBS-1, SNBS-2, …, SNBS-10, and SNBS-11.

[0042] 3. Bacillus inhibition experiment

[0043] The 11 strains of bacillus obtained by the preliminary screening were inoculated into 100 mL of LB liquid medium, and cultured at 37°C with a shaking speed of 180 r / min for 24 h. The bacterial liquid after the culture was centrifuged at 10,000 r / min for 10 min, and the supernatant was filtered through a 0.22 μm needle filter, thereby obtaining the sterile body fermentation supernatant.

[0044] The sterile body fermentation supernatant was added into PDA solid medium according to a volume ratio of 10% by using an agar column method, and a 6 mm puncher was used to take the Venturia inaequalis bacterial block and place it in the center of the PDA medium. The bacterial block was cultured at 28°C, and the diameter of the bacterial block was measured every 12 h by using a cross intersection method until the bacterial block in the blank control culture dish was full. The inhibition rate of the bacillus on the Venturia inaequalis was calculated.

[0045] The inhibition rate calculation formula is as follows:

[0046] Inhibition rate (%) = (blank group bacterial cake area - sample group bacterial cake area) / blank group bacterial cake area x 100%.

[0047] The results show that, among the 11 strains of bacillus obtained by the preliminary screening, the SNBS-3 strain has the most significant inhibition effect on the Venturia inaequalis, and the inhibition rate reaches 99.93%, which is close to 100%, thereby achieving an unexpected technical effect.

[0048] Example 2: SNBS-3 strain identification

[0049] 1. Colony morphology identification

[0050] The SNBS-3 strain was inoculated into LB flat plate medium and cultured at 37°C for 24 h, and the colony morphology is shown in Figure 1 It is observed that the colony color is light yellow, opaque, dry on the surface, flat, irregular edge, and wrinkle and protrusion are formed on the surface.

[0051] A small amount of suitable age bacterial moss was picked for Gram staining, and the microscopic examination result is shown in Figure 2 It is observed that the bacterial body is blue-violet short rod-shaped or rod-shaped, and is distributed alone or in a chain, and some bacterial bodies produce approximately circular spores.

[0052] 2. Physiological and biochemical identification

[0053] Table 1: Physiological and biochemical identification results of the SNBS-3 strain

[0054]

[0055]

[0056] Note: "+" means positive reaction or growth, "-" means negative reaction or no growth.

[0057] 3. Molecular biological identification

[0058] 100 μL of SNBS-3 strain bacterial suspension was taken into sterilized PDA liquid medium and cultured in a 37 °C incubator for 24 h. The genome of the strain was extracted according to the operation steps on the bacterial genome kit (Solarbio D1600). The PCR upstream primer 27F and the downstream primer 1492R were designed, and the specific sequences were as follows:

[0059] 27F: AGAGTTTGATCCTGGCTCAG (5'---3');

[0060] 1492R: GGTTACCTTGTTACGACTT (5'---3').

[0061] The PCR reaction conditions were as follows: 95 °C pre-denaturation for 4 min, 30 cycles of 95 °C for 30 s, 55 °C for 30 s, 72 °C for 45 s, and 72 °C for 10 min. The PCR product was recovered by AxyPrep DNA gel recovery kit (Boyao, ASJ0013), and the specific operation was carried out according to the kit instructions.

[0062] The gel electrophoresis detection result of the PCR amplification product is shown in Figure 3 The positive PCR product was sent to Shanghai Pisenol Biotech Co., Ltd. for sequencing, and the 16s rDNA sequence SEQ ID NO: 1 of the SNBS-3 strain was obtained. The specific sequence is as follows:

[0063]

[0064] The 16s rDNA sequence SEQ ID NO: 1 of the SNBS-3 strain was subjected to BLAST comparison with the existing sequences in the GenBank database in the NCBI database using the BLAST tool. The results showed that the SNBS-3 strain had the highest similarity with Bacillus subtilis. Further, a phylogenetic tree was constructed using MEGA7.0, and the results, as shown in Figure 4

[0065] In summary, in combination with the colony morphology, physiological and biochemical characteristics, and molecular biology identification results of the SNBS-3 strain, it can be concluded that the SNBS-3 strain is a new type of Bacillus subtilis, which is named Bacillus subtilis SNBS-3 (Bacillus subtilis SNBS-3).

[0066] 4. Preservation information of Bacillus subtilis SNBS-3

[0067] Bacillus subtilis SNBS-3 was preserved in the China General Microbiological Culture Collection Center (CGMCC) on June 9, 2022, and the address is No. 1, Beichen West Road, Yard 3, Beijing Chaoyang District, Institute of Microbiology of Chinese Academy of Sciences, and the preservation number is CGMCC No. 25040.

[0068] Example 3 Determination of chitinase activity of Bacillus subtilis SNBS-3

[0069] 1. Isolation and purification of chitinase:

[0070] ​The activated Bacillus subtilis SNBS-3 was inoculated into LB liquid medium, and cultured at 37℃ and 180r / min for 24h to obtain a fermentation broth. The broth was centrifuged at 4℃ and 8000r / min for 15min to remove the bacterial cells, and the supernatant was obtained. The supernatant was added with ammonium sulfate with a saturation of 70% under magnetic stirring at 4℃ overnight. The precipitate was obtained by centrifugation at 4℃ and 8000r / min for 20min. The precipitate was dialyzed with distilled water, and then subjected to chitin affinity chromatography. The eluate was concentrated and subjected to Sephadex G-100 chromatography with a phosphate buffer with a pH of 7.2. The fractions with enzyme activity were combined, concentrated, and subjected to Sephacryl S-200 chromatography with a phosphate buffer with a pH of 7.2 to obtain a chitinase liquid.

[0071] 2. Determination of chitinase activity:

[0072] (1) Establishment of N-acetyl-β-D-glucosaminidase (NAG) standard curve

[0073] 100mg of NAG standard was accurately weighed, dissolved with deionized water, and then diluted to 50mL in a volumetric flask. 0, 0.2, 0.4, 0.6, 0.8, and 1.0mL of the solution were respectively transferred into glass test tubes, supplemented with deionized water to 2mL, added with 3mL of DNS solution, and then boiled in a water bath for 10min. After cooling to room temperature, the solution was diluted to 25mL in a volumetric flask. The absorbance at 550nm was determined by a UV spectrophotometer, and OD 550 was taken as the abscissa, and the NAG concentration was taken as the ordinate to draw a standard curve, as shown in Figure 5 .

[0074] (2) Determination of chitinase activity

[0075] 0.5mL of the centrifuged and diluted enzyme solution was taken, supplemented with 2mL of phosphate buffer (PBS), and then added with 1mL of 1% colloidal chitin solution. After mixing, the solution was immediately incubated at 37℃ in a constant temperature water bath for 1h, and then centrifuged at 10000r / min at 4℃ for 10min. 2mL of the supernatant was taken into a test tube, added with 3mL of DNS reagent, and then boiled in a water bath for 10min. After cooling to room temperature with cold water, the solution was diluted to 25mL in a volumetric flask. The absorbance at 550nm was determined by a UV spectrophotometer. OD 550 was taken as the abscissa, and the NAG concentration was taken as the ordinate to draw a standard curve. The inactivated chitinase crude enzyme solution was used as a control, and each treatment was repeated for 3 times. The OD 550The chitinase activity was calculated by comparing the values ​​with the standard curve.

[0076] One unit of enzyme activity is defined as the amount of enzyme required to generate 1 μmol of NAG in 1 minute under the above conditions.

[0077] The results showed that after 24 hours of fermentation, the chitinase activity in the supernatant of Bacillus subtilis SNBS-3 provided by this invention reached 3.96 U / mL, indicating that the strain can produce high levels of chitinase.

[0078] Example 4: Determination of protease activity of Bacillus subtilis SNBS-3

[0079] The activated Bacillus subtilis SNBS-3 was inoculated into LB culture medium and cultured on a shaker at 37°C and 180 r / min for 24 h. Then, it was centrifuged at 10000 r / min and 4°C for 15 min, and the supernatant was collected.

[0080] The protease activity of the obtained fermentation supernatant was determined according to Appendix B, "Determination of Protease Activity," of the national standard GB / T 23527—2009, "Protein Preparations."

[0081] Use a punch to make evenly distributed holes in a sterilized protease identification medium plate. Inject 100 μL of the supernatant into each hole and incubate at 37°C for 24 h.

[0082] The results showed that the protease activity in the fermentation supernatant of Bacillus subtilis SNBS-3 reached 135.25 U / mL. The average diameter of the protein hydrolysis zone on the protease identification medium plate reached 18.56 mm. Figure 6 As shown, this demonstrates that the strain can produce high levels of protease.

[0083] Example 5: Determination of acid production curve of Bacillus subtilis SNBS-3

[0084] The activated Bacillus subtilis SNBS-3 was inoculated at a rate of 2% into 100 mL of LB liquid medium and cultured at 37 °C and 180 r / min in a shaker for 24 h. The pH of the fermentation broth was measured every 2 h to plot the acid production curve.

[0085] from Figure 7 It can be seen that after 4 hours of cultivation, Bacillus subtilis SNBS-3 enters the logarithmic growth phase and begins to produce a large amount of acid, and the pH value of its fermentation broth drops rapidly; after 14 hours, it enters the stationary phase, and the pH value of its fermentation broth stabilizes at around 3.6, indicating that Bacillus subtilis SNBS-3 has a strong acid-producing ability.

[0086] Example 6: Preparation of Bacillus subtilis SNBS-3 bacterial powder

[0087] Vacuum freeze-drying method is used to prepare the bacterial powder.

[0088] 1000 mL of Bacillus subtilis SNBS-3 bacterial solution was prepared, and after low-speed refrigerated centrifugation at 5000 r / min for 20 min, the supernatant was removed, the precipitate was washed with sterile normal saline, and after viable bacterial counting, 50% glycerol was added as a protective agent, and the concentrated bacterial solution was mixed in a ratio of 1:1. Then 2 g of corn starch was added, mixed, and then spread on a solid culture medium for vacuum freeze-drying. First, pre-freeze at -40℃ for 2 h, then freeze-dry at -80℃ under a vacuum of 10 Pa for 24 h, and then determine the viable bacterial count after powdering by viable bacterial counting method.

[0089] Results: The viable bacterial count of the Bacillus subtilis SNBS-3 bacterial powder prepared by vacuum freeze-drying method was 1.23±0.65×109 cfu / g.

[0090] Example 7: Prevention and treatment effect of Bacillus subtilis SNBS-3 on Venturia pyricola

[0091] Twenty Venturia pyricola with uniform appearance, uniform size and no disease and insect damage were selected, and 10 Venturia pyricola in the experimental group and the control group were first surface-disinfected with 70% alcohol, and then treated in the room as follows:

[0092] (1) Experimental group: 20 μL of Bacillus subtilis SNBS-3 bacterial solution (10 8 cfu / mL) was inoculated first, and 20 μL of Venturia pyricola suspension (10 5 cfu / mL) was inoculated after 4 h;

[0093] (2) Control group: only 20 μL of Venturia pyricola suspension (10 5 cfu / mL) was inoculated.

[0094] The Venturia pyricola in the experimental group and the control group were placed in a constant temperature incubator at 25℃ for 7 days, and the diameter of the bacterial plaque on each Venturia pyricola was measured every day, and the average diameter was calculated.

[0095] The results are shown in Figure 9 After 7 days of culture, the average diameter of the Venturia pyricola bacterial plaque in the control group reached 21.65 mm, while the average diameter of the bacterial plaque of the Venturia pyricola inoculated with Bacillus subtilis SNBS-3 in the experimental group was only 5.24 mm. Therefore, the Bacillus subtilis SNBS-3 provided by the present application can effectively prevent and treat Venturia pyricola, with a prevention and treatment efficiency of 75.8%, and the effect is significant. It can be developed into a biological pesticide with higher safety, which is conducive to improving the quality of Venturia pyricola.

[0096] Example 8: Prevention and treatment effect of Bacillus subtilis SNBS-3 on Venturia pyricola and Venturia pyricola

[0097] The soil properties, uniformity of fertility, and uniformity of disease incidence of Venturia pyricola and Physalospora piricola in previous years were consistent in the orchard in Dongfangshenguoyuan, Haicheng City, Anshan City, Liaoning Province. The experiment of control effect of Venturia pyricola and Physalospora piricola was carried out, and the area of each treatment was 4 mu.

[0098] The Bacillus subtilis SNBS-3 powder was diluted with water to a final concentration of 10 8 cfu / mL, and was sprayed on the tree body of the pear tree at bud break stage (April 1), flowering stage (May 1), young fruit stage (June 1), and fruit enlargement stage (July 1) for four times, respectively. The drip was degree. At the same time, the pear trees without spraying any bacteria were used as a control.

[0099] After the pear was picked, five-point sampling method was used in each treatment area, and the fruit trees with consistent tree vigor and fruit amount were selected according to the five directions of east, west, south, north, and center. One fruit tree was selected at each point, and the disease-free fruits were mixed together in a box (the fruits were picked on September 1). The box was marked with the number of the picked tree. The fruits were placed in the room for one month to induce disease, and the incidence of different types of diseases was observed and recorded. The control effect was calculated, and the weight and yield of disease-free single fruits were also calculated. The specific results are shown in Tables 4 and 5.

[0100] Incidence rate (%) = number of diseased fruits / total number of fruits investigated × 100%.

[0101] Control effect (%) = (incidence rate of control area - incidence rate of treatment area) / incidence rate of control area × 100%.

[0102] Table 4 Control effect of Bacillus subtilis SNBS-3 on Venturia pyricola and Physalospora piricola of South Fruit Pear

[0103]

[0104]

[0105] Table 5 Influence of Bacillus subtilis SNBS-3 on quality and yield of South Fruit Pear

[0106]

[0107] From the data of Table 4 and Table 5, it can be known that the incidence of Venturia pyrola and Venturia pyrola of the treatment group applying Bacillus subtilis SNBS-3 bacterial powder is obviously lower than that of the control group, the control efficiency is as high as 88.28% and 71.36% respectively, the effect is very significant. Compared with the control group, the Nanguo pear fruit applying Bacillus subtilis SNBS-3 bacterial powder is larger and full, the yield of healthy and disease-free fruit is increased by 32.6% compared with the control group. Therefore, it is proved that the Bacillus subtilis SNBS-3 provided by the application has obvious control effect on Venturia pyrola and Venturia pyrola of Nanguo pear, and significantly improves the fruit quality and yield, and unexpected technical effects are achieved.

Claims

1. A Bacillus subtilis (B. subtilis) strain, characterized in that, Bacillus subtilis The preservation number of the Bacillus subtilis is CGMCC No. 25040. ​ 2. The Bacillus subtilis of claim 1 is applied in the preparation of bio-fertilizer.

3. The use of Bacillus subtilis according to claim 1 for the control of plant diseases, characterized in that The plant disease is Venturia pyricola or Venturia inaequalis.

4. A microbial preparation, characterized in that, The microbial preparation comprises the Bacillus subtilis of claim 1.

5. The microbial preparation of claim 4, wherein The microbial preparation also comprises one or more of Bacillus amyloliquefaciens (Bacillus amyloliquefaciens) Bacillus amyloliquefaciens ), Bacillus licheniformis (Bacillus licheniformis) Bacillus licheniformis ), Bacillus laterosporus (Bacillus laterosporus) Brevibacillus laterosporus ), Bacillus polymyxa (Bacillus polymyxa) Paenibacillus polymyxa ), Bacillus coagulans (Bacillus coagulans) Bacillus coagulans ), Bacillus marinus (Bacillus marinus) Bacillus marinus ), Bacillus endophyticus (Bacillus endophyticus) Bacillus ), Bacillus megaterium (Bacillus megaterium) Bacillus megaterium ), Bacillus thuringiensis (Bacillus thuringiensis) Bacillus thuringiensis ), Trichoderma harzianum (Trichoderma harzianum) Trichoderma harzianum ), Paecilomyces lilacinus (Paecilomyces lilacinus) Purpureocillium lilacinum ), Rhodopseudomonas palustris (Rhodopseudomonas palustris) Rhodopseudomona palustris ).

6. The microbial preparation according to claim 4 or 5, characterized in that The viable cell count of Bacillus subtilis in the microbial preparation is at least 10 9 CFU / g.

7. The microbial preparation of any one of claims 4-6 is applied in the preparation of bio-fertilizer.

8. Use of the microbial preparation according to any one of claims 4 to 6 for the control of plant diseases, characterized in that, The plant disease is Venturia pyricola or Venturia inaequalis.

Citation Information

Patent Citations

  • Bacillus subtilis protease and preparation method thereof

    CN116622682A