Monoclonal antibody against guinea pig IFN-γ and its use

Abstract

The present invention relates to the technical field of drug and animal disease detection, and in particular, to a monoclonal antibody against guinea pig IFN-γ, which has strong binding specificity with IFN-γ, provides a good basis for using it to measure IFN-γ, and further provides a good basis for tuberculin titer calibration. Correspondingly, the present invention also discloses a hybridoma cell line GIFN-1A2 that secretes the monoclonal antibody. The present invention also discloses a drug and a kit comprising the monoclonal antibody.

Description

Technical Field

[0001] This invention relates to the fields of pharmaceutical and animal disease detection technology, and in particular to a monoclonal antibody against guinea pig IFN-γ and its uses. Background Technology

[0002] Bovine tuberculosis is a chronic zoonotic infectious disease primarily caused by infection with *Mycobacterium bovis*, a member of the Mycobacterium tuberculosis complex (MTBC). Avian tuberculosis is mainly caused by infection with serotypes 1, 2, 3, and 6 of *Mycobacterium avium* and *Mycobacterium genavens*. *Mycobacterium avium* primarily infects poultry, ornamental birds, wildfowl such as owls and vultures, pigs, and pet dogs. It can also infect humans, especially children, the elderly, and HIV-infected individuals with weakened immune systems, causing tuberculous nodules in multiple organs. Both bovine and avian tuberculosis not only harm the healthy development of the livestock industry but also pose serious public health and safety risks, threatening human health and lives. Their effective prevention and control are directly related to human health.

[0003] The bovine tuberculin skin test (TST) was the earliest method used to diagnose bovine tuberculosis. The interferon gamma release assay (IGRA) can be used as an alternative to the TST and is recommended by the World Organisation for the Study of Animal Health (WOAH) for the auxiliary diagnosis of bovine tuberculosis. Avian tuberculosis is primarily detected using the avian tuberculin skin test. Both the TST and the IFN-γ release assay require bovine tuberculin (PPD-B) and avian tuberculin (PPD-A) as detection / stimulation antigens; therefore, accurately quantified tuberculin products are a prerequisite for accurate diagnosis of bovine and avian tuberculosis.

[0004] PPD-B and PPD-A, as diagnostic antigens for bovine and avian tuberculosis, are highly correlated with their diagnostic accuracy and potency. The purification of tuberculin is affected by various factors during preparation. Traditional tuberculin potency determination methods involve skin tests on guinea pigs sensitized with the tuberculin and calculating the potency based on the swelling area. Potency determination results are influenced by factors such as guinea pig strain, individual differences, sensitization status, and swelling measurement errors, leading to significant fluctuations between tuberculin protein content and potency determination, resulting in poor repeatability. In practice, to overcome these difficulties, multiple protein and potency measurements are required, and averages must be calculated. This process is time-consuming, labor-intensive, and costly. Therefore, there is an urgent need to develop new methods for tuberculin potency determination to achieve accurate and rapid determination of PPD-B and PPD-A potency. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a monoclonal antibody against guinea pig IFN-γ and its uses.

[0006] To address the aforementioned problems, as a first aspect of this invention, the present invention provides a hybridoma cell line GIFN-1A2, which was deposited on January 5, 2023, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 45344. The address of the CGMCC is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. Specifically, the inventors of this invention, through in-depth research, constructed a hybridoma cell line using guinea pig IFN-γ as an immunogen. The monoclonal antibody secreted by this cell line exhibits strong binding specificity to IFN-γ, providing a good foundation for IFN-γ determination. This also provides a good foundation for tuberculin titer calibration.

[0007] As a second aspect of the present invention, the present invention provides a monoclonal antibody against guinea pig IFN-γ, which is secreted by the hybridoma cell line GIFN-1A2 described above.

[0008] As a third aspect of the invention, the invention provides the use of the above-described monoclonal antibody in the preparation of pharmaceutical compositions.

[0009] As a fourth aspect of the present invention, the present invention provides a pharmaceutical composition comprising the monoclonal antibody described above.

[0010] As a fifth aspect of the present invention, the present invention provides the use of the above-described monoclonal antibody in the preparation of a kit for detecting guinea pig IFN-γ.

[0011] As a sixth aspect of the present invention, the present invention provides the use of the above-described monoclonal antibody in the preparation of a kit for tuberculin titer determination.

[0012] As an improvement to the above technical solution, the tuberculin is bovine tuberculin and / or avian tuberculin.

[0013] As an improvement to the above technical solution, the ELISA method is used for detection.

[0014] As a sixth aspect of the present invention, the present invention provides a kit for detecting guinea pig IFN-γ, comprising the above-described monoclonal antibody.

[0015] As a seventh aspect of the present invention, the present invention provides a kit for tuberculin titer determination, comprising the above-described monoclonal antibody.

[0016] Implementing this invention has the following beneficial effects:

[0017] This invention utilizes guinea pig IFN-γ as an immunogen to construct a hybridoma cell line, GIFN-1A2. The monoclonal antibody secreted by this cell line exhibits strong binding specificity to IFN-γ, enabling high-precision quantitative detection of guinea pig IFN-γ. Furthermore, studies have shown a positive correlation between the concentration of IFN-γ in the blood of guinea pigs sensitized with tuberculin and the titer of tuberculin. This also demonstrates that the monoclonal antibody in this invention can be used to calibrate tuberculin titer. Attached Figure Description

[0018] Figure 1 Image showing purified recombinant guinea pig IFN-γ protein as detected by SDS-PAGE. Lane M: protein molecular weight standard; Lane 1: purified guinea pig IFN-γ.

[0019] Figure 2 Image of purified mouse anti-guinea pig IFN-γ monoclonal antibody protein as detected by SDS-PAGE. Lane M: Protein molecular weight standard; Lane 1: Purified 1A2; Lane 2: Purified 3B5; Lane 3: Purified 3B7; Lane 4: Purified 5G2; Lane 5: Purified 4F7.

[0020] Figure 3 This is a graph showing the detection sensitivity of recombinant guinea pig IFN-γ using 1A2 monoclonal antibody as the capture antibody. The horizontal axis represents recombinant guinea pig IFN-γ (ng / mL), and the vertical axis represents the OD450 value.

[0021] Figure 4 This is a curve of guinea pig IFN-γ standard. The vertical axis represents recombinant guinea pig IFN-γ (ng / mL), and the horizontal axis represents OD450 value.

[0022] Figure 5 After stimulating guinea pig peripheral blood lymphocytes with BSA, PBS, and ConA respectively, the concentration of IFN-γ in peripheral blood was detected using 1A2 as the coating antibody and 5G2-HRP as the detection antibody.

[0023] Figure 6 After sensitizing and irritating mycobacteria-treated and unsensitized guinea pigs with BSA, PBS, ConA, and PPD-B, respectively, the concentration of IFN-γ in peripheral blood was detected using 1A2 as the coating antibody and 5G2-HRP as the detection antibody.

[0024] Figure 7 To detect the concentration of IFN-γ in peripheral blood of guinea pigs sensitized and unsensitized with mycobacterium tumefaciens at different concentrations of PPD-B, 1A2 was used as the coating antibody and 5G2-HRP was used as the detection antibody. Detailed Implementation

[0025] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be described in further detail below.

[0026] Example 1: Expression and purification of recombinant guinea pig IFN-γ

[0027] 1. Construction and identification of recombinant plasmids

[0028] The nucleotide sequence of guinea pig IFN-γ (AY151287) in GenBank was analyzed online using Signal IP 5.0. After removing the signal peptide sequence of amino acids 1-25, an IFN-γ gene fragment (426 bp) was artificially synthesized. Its sequence (SEQ ID NO: 1) is as follows:

[0029] agatttacaaatgaaatacgcattctaaagaactactttaatgcagataactcagatgtaggagacaatgggacgctctttgtaggcattttgaagaattgccaag aggagagtgaaagaaaaatatttcagagccaaatcgtctccttctacttcaaactctttgaaaaacattttacagacaatcagactgtccaaaatagcatgaacacc atcaaggaacaaattattactaagttcttcaaagacaacagcagcaacaaggtgcaggctttcaaaaacctgattcaaatttcggtcaatgacgagcatgtccagc gccaagcgatcattgaactcaaaaaagtgatagatgacctgtcaccgaaccagaggaaacgaagaaggactcagatgctgtttcagagccggagagcatccaaataa

[0030] Using the synthesized sequence as a template, PCR amplification was performed using IFN-F / R primers to amplify the guinea pig IFN-γ gene fragment. Specifically, the PCR reaction system was as follows:

[0031]

[0032] The PCR reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 30 s, 30 cycles; 72℃ extension for 5 min, and storage at 4℃. The PCR products were mixed with 10× loading buffer and subjected to agarose gel electrophoresis at 115V for 30 min. The bands were observed under a UV gel imaging system, the gel strips were cut, and the target bands were recovered using a gel extraction kit (Tiangen Biotech).

[0033] Table 1. Primers for guinea pig IFN-γ gene sequence

[0034]

[0035] Note: Lowercase letters indicate restriction sites, and italics indicate Kozack sequences.

[0036] The pFastBacTM-HTA plasmid (purchased from Thermofisher and preserved by the Beijing Institute of Animal Husbandry and Veterinary Medicine, Chinese Academy of Agricultural Sciences) and the recovered PCR products were digested with BamHI and XbaI. The enzyme digestion system is as follows:

[0037] 1) Enzyme digestion reaction I:

[0038]

[0039] After thorough mixing, place the mixture on a metal thermostat and incubate at 37°C for 2 hours. After the reaction, use a gel recovery kit (Tiangen Biotech) to recover the enzyme digestion products.

[0040] 2) Enzyme digestion reaction II:

[0041]

[0042] After thorough mixing, place the mixture on a metal thermostat and incubate at 37°C for 2 hours. After the reaction, use a gel recovery kit (Tiangen Biotech) to recover the enzyme digestion product according to the instructions.

[0043] The concentrations of the enzyme digestion products of the vector and the target gene fragment were determined using Nanodrop. Ligation was performed at a molar ratio of 4-6:1, and the ligation product was electroporated into DH5α competent E. coli cells. Five colonies were randomly selected from LB agar plates for PCR identification using IFN-F / R primers. Positive colonies were inoculated into LB medium containing Amp+ and cultured overnight at 37°C with shaking at 200 rpm. The recombinant plasmid PFastBac-IFN-γ was extracted using a plasmid extraction kit. Take one DH10Bac competent cell (purchased from Beyotime Biotechnology Co., Ltd., preserved by the Beijing Institute of Animal Husbandry and Veterinary Medicine, Chinese Academy of Agricultural Sciences), gently add 1 μL of recombinant plasmid pFastBac-IFN-γ, and incubate on ice for 30 minutes; heat shock at 42℃ for 90 seconds, then quickly place on ice and let stand for 5 minutes; add 800 μL of LB liquid medium, and incubate at 37℃ and 160 rpm for 4 hours; take 100 μL of bacterial culture and spread it evenly on an LB plate containing 1‰ kanamycin, tetracycline, gentamicin, X-gal, and IPTG; incubate at 37℃ for 48 hours, pick white colonies, and streak them on the same LB plate; incubate at 37℃ for about 48 hours, pick white colonies, and inoculate them into LB liquid medium containing 1‰ kanamycin, tetracycline, and gentamicin, and incubate at 37℃ and 200 rpm for 16 hours.

[0044] The recombinant transposon Bacmid-IFN-γ was extracted using a baculovirus shuttle vector mini-extraction kit (Beyotime). The transposon was dissolved in 50 μL of 1×TE buffer and stored at 2–8°C for later use. Using the extracted Bacmid-IFN-γ as a template, PCR identification was performed using upstream and downstream primers for IFN-γ and M13. Positive plasmids were sent to Shanghai Sangon Biotech for sequencing and compared with the guinea pig IFN-γ sequence (AY151287) published in GenBank. The correctly sequenced plasmids were transfected into sf21 insect cells.

[0045] 2. Transfection

[0046] SF21 insect cells in the logarithmic growth phase (purchased from Thermofisher and preserved by the Beijing Institute of Animal Husbandry and Veterinary Medicine, Chinese Academy of Agricultural Sciences) were counted at a ratio of 2 × 10⁻⁶ cells / cells. 6 Cells were seeded at a density of cells / well in six-well plates, and 2 mL of SF 900 II SFM medium was added to each well. The plates were then placed in an insect cell culture incubator at 28°C for 2 hours. After the cells adhered to the plate, they were transfected.

[0047] Solution I: Add 2 μg Bacmid-IFN-γ to 100 μL of SF 900 II SFM medium and mix well. Bacmid is set up as a control.

[0048] Solution II: Add 8 μL of Lipofectamin TM Add 2000 transfection reagent to 100 μL of SF 900 II SFM medium, mix well, and let stand for no more than 30 minutes;

[0049] Mix Solution I and Solution II thoroughly and incubate at room temperature for 30 minutes. Discard the culture medium in the six-well plate, wash the cells with 2 mL of SF 900 II SFM medium, and add 1 mL of SF-900 II medium to each well. Add 800 μL of SF900 II SFM medium to the liposome mixture and mix gently. Add dropwise to the cultured sf21 cells. After culturing at 28°C for 5 hours, discard the transfection mixture and add 2 mL of SF 900 II SFM medium to each well. Incubate at 28°C for 48-72 hours and collect the recombinant baculovirus in the supernatant, which is the F1 substitute.

[0050] The sf21 insect cells in suspension culture were adjusted to the logarithmic growth phase, and the cell density was diluted to 2 × 10⁻⁶. 6 Cells / mL; inoculate F1 generation virus at MOI = 5 (V = (MOI × total number of cells) / virus titer), incubate at 28℃, 120 r / min for 48 hours; centrifuge at 4℃, 4000 r / min for 15 minutes, and collect the supernatant as F2 generation virus; inoculate F2 generation virus in the same way, and collect F3 generation virus.

[0051] 3. Protein expression

[0052] SF21 insect cells cultured in suspension were adjusted to the logarithmic growth phase and then used for the expression of recombinant baculovirus; the cell density was diluted to 2 × 10⁻⁶. 6Cells / mL were introduced into the P3 cell line at an MOI of 5, with a negative control included. The cells were incubated at 28°C in a shaker at 120 rpm for 48-72 h. After centrifugation at 5000 rpm for 10 min at 4°C, the cell pellet was collected, cell lysis buffer was added, and the cells were incubated at 4°C for 30 min. The cells were then sonicated for 5 min, centrifuged at 12000 rpm for 10 min, and the supernatant was collected. The supernatant was then filtered through a 0.45 μm filter for protein purification.

[0053] 4. Protein purification

[0054] The cell lysate supernatant was purified using a HisTrap FF (5 mL) affinity chromatography column on an AKTA protein purifier. The resulting target protein was desalted using a Hisprep 26 / 10 Desulting column, then transferred to a PBS (pH 7.4) buffer system. After sterilization via filtration through a 0.22 μm filter, the purified IFN-γ concentration was determined by BCA protein quantification. The purified IFN-γ concentration reached 0.8 mg / mL, and SDS-PAGE showed that the purity of the recombinant IFN-γ protein could reach over 90%. Figure 1 The protein was then aliquoted and frozen at -80°C.

[0055] 5. Activity Assay

[0056] The antiviral activity of recombinant guinea pig IFN-γ was determined using the microcytopathic effect inhibition assay. MDBK cells were cultured at 2 × 10⁶ cells per well. 4 Cells were seeded in 96-well cell culture plates and incubated at 37°C and 5% CO2 for 4-6 hours. After cell attachment, recombinant IFN-γ and empty vector expressed protein, serially diluted with assay medium (DMEM containing 7% FBS) were added as negative controls and blank controls, respectively. Three replicates were performed. After incubation at 37°C and 5% CO2 for 18-24 hours, the supernatant was discarded, and the cells were washed three times with PBS and inoculated with 100 TCID45 solution. 50 MDBK cells were infected with a VSV challenge dose using 100 μL of challenge medium (DMEM containing 3% FBS) per well. A positive control (VSV only) and a protein control (recombinant IFN-γ only) were also included. After 1 hour, the medium was replaced with complete medium (DMEM containing 10% FBS), and the cells were incubated at 37°C and 5% CO2 for 24 hours. The half-life of cytopathic effects was observed, and the highest dilution showing 50% cytopathic effect was defined as one interferon unit (IU). The activity (IU / mg) of the recombinant interferon was calculated using the Reed-Muench method. The results showed that the activity of recombinant guinea pig IFN-γ could reach 4 × 10⁻⁶. 7.25 IU / mg.

[0057] Example 2: Preparation of mouse anti-guinea pig IFN-γ monoclonal antibody

[0058] 1. Method for detecting the titer of anti-guinea pig IFN-γ antibodies

[0059] The purified recombinant protein IFN-γ was used as the coating antigen and diluted to 1 μg / mL with carbonate buffer (pH 9.6). 100 μL was added to each well and the mixture was coated overnight at 4°C. After washing 3 times with PBST, 200 μL of PBS blocking buffer containing 5% skim milk was added to each well and the mixture was blocked overnight at 4°C. After washing 5 times with PBST, the mixture was gently patted dry on absorbent paper and stored at -20°C for later use. Remove the ELISA plate from the -20℃ freezer and allow it to reach room temperature. Add 100 μL of hybridoma cell culture supernatant to each well, along with a positive control (1:2000 dilution of fusion mouse serum) and a negative control (1:2000 dilution of negative mouse serum). Incubate at 37℃ for 1 h, discard the culture supernatant, and wash 5 times with PBST. Add 100 μL of HRP-goat anti-mouse IgG secondary antibody (SIGMA) at an optimal dilution of 1:6000 to each well, incubate at 37℃ for 1 h, and wash 5 times with PBST. Add 100 μL of single-component TMB chromogenic solution (KPL) to each well, incubate at 37℃ for 15 min, and terminate the reaction by adding 50 μL of 2M sulfuric acid solution to each well. Measure the OD450nm value using an ELISA reader. Judgment criteria: The system is considered valid when the OD450nm value of positive serum is approximately 1.0 and the OD450nm value of negative serum is approximately ≤0.1. A P / N value >2.1 is considered positive for detection.

[0060] 2. Monoclonal antibody preparation

[0061] The purified recombinant IFN-γ was emulsified with an equal volume of Freund's complete adjuvant at a dose of 30 μg / mouse and injected subcutaneously into 6-week-old female BALB / c mice at multiple sites in the abdomen. Subsequently, the mice were immunized four times every 3 weeks with the same dose of antigen emulsified with an equal volume of Freund's incomplete adjuvant. Three days before cell fusion, a booster immunization was administered via intraperitoneal injection.

[0062] BALB / c mice were euthanized by enucleation and bloodletting after booster immunization. Serum was collected as a positive control for hybridoma cell screening. The serum was immediately immersed in 75% medical alcohol and left to stand for 10 minutes. The mice were then transferred to a laminar flow hood and placed supine in a sterile culture dish. The abdominal skin of the mice was aseptically opened to fully expose the abdominal wall. A separate set of sterile scissors and forceps was used to open the left abdominal wall of the mice to fully expose the spleen. The spleen was separated and placed in a petri dish pre-filled with DMEM medium containing 10% FBS. One end of the spleen was held with sterile forceps, and the culture medium in the petri dish was drawn into the spleen from the other end with a 5 mL sterile syringe. The spleen was repeatedly rinsed until it turned pale white. The separated spleen cells were injected into a 50 mL sterile centrifuge tube, thoroughly mixed, and a small amount was taken for cell counting.

[0063] Separated spleen cells were mixed with logarithmic growth phase SP2 / 0 myeloma cells at a ratio of 3:1 to 5:1 using PEG4000 as a fusion agent. The fused cells were added to 96-well cell culture plates pre-coated with feeder cells. Hybridoma cells were cultured in HAT-containing selective medium for 3-4 days, followed by half-volume replenishment of medium (avoid moving the cell plate as much as possible for the first 3 days after fusion). At days 7-9, the medium was completely replaced with HT-containing medium for continued culture. When the cell clones reached 1 / 4-1 / 3 of the well bottom area, the cell supernatant was collected. The antibody level against IFN-γ in the cell supernatant was detected by indirect ELISA, and cell lines with high P / N ratios were screened.

[0064] 3. Subcloning and fixation of monoclonal antibody cell lines

[0065] The selected positive hybridoma cell lines were subcloned using a limiting dilution method. When the cell clones reached 1 / 4-1 / 3 of the well bottom area, the cell supernatant was collected, and the antibody level against IFN-γ in the supernatant was detected by indirect ELISA. Cell lines with high P / N ratios were selected. After three subcloning processes, stable antibody-secreting cell lines were monocloned, resulting in five monoclonal cell lines: 1A2, 3B5, 3B7, 4F7, and 5G2. The titers of the hybridoma cell culture supernatant, ascites fluid, and purified monoclonal antibodies were measured using indirect ELISA. The highest antibody titer in the cell supernatant reached over 3200, and the antibody titer in the ascites fluid reached 10. 6 The purified monoclonal antibody titer can reach 10. 5 .

[0066] Table 2. Determination of antibody titer in hybridoma cell culture supernatant.

[0067]

[0068]

[0069] Monoclonal antibody subclass identification kit (Sigma) was used to detect the monoclonal antibody subclass. 1A2, 3B5 and 3B7 were IgG1 type, and 4F7 and 5G2 were IgG2a type.

[0070] The additive index method was used to detect the five monoclonal antibodies against two different antigenic epitopes (see Table 3).

[0071] The hybridoma cell line GIFN-1A2, which produces the high-titer monoclonal antibody 1A2, was deposited on January 5, 2023, at the China General Microbiological Culture Collection Center (CGMCC), No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with accession number CGMCC No. 45344. Its taxonomic name is guinea pig IFN-γ monoclonal antibody hybridoma cell line.

[0072] Table 3. Results of AI analysis of antigenic epitopes recognized by clonal antibodies.

[0073]

[0074] Note: According to the formula AI = (A (1+2) -A1) / A2×100% calculates the overlap rate after the two monoclonal antibodies are superimposed. Where A1 represents the OD of the first monoclonal antibody. 450nm Value; A2 represents the OD value of the second monoclonal antibody. 450nm Value; A (1+2) This indicates the OD after the superposition of two monoclonal antibodies. 450nm The AI ​​value is determined by the superposition of the two antibodies. If the AI ​​value is greater than 30%, the two monoclonal antibodies are considered to recognize different sites.

[0075] Example 3: Detection of IFN-γ in guinea pigs using ELISA

[0076] 1. Preparation of ELISA plates coated with 1A2 monoclonal antibody

[0077] Dilute guinea pig IFN-γ monoclonal antibody 1A2 to 1 μg / mL with 0.1 M carbonate buffer (pH 9.6), add 100 μL / well, and coat the plate at 2-8℃ for 16 hours. The next day, discard the coating solution, blot dry, and wash the plate three times with PBST buffer, 250 μL / well. Discard the washing buffer, add blocking buffer (PBS containing 5% skim milk, pH 7.2-7.4), 200 μL / well, and block overnight at 2-8℃. The next day, discard the blocking buffer, blot dry, and wash the plate three times with PBST buffer, 200 μL / well. Discard the washing buffer, blot dry, and store at -20℃ for later use.

[0078] 2. Preparation of HRP-labeled mouse anti-guinea pig IFN-γ monoclonal antibody

[0079] The 5G2 monoclonal antibody was dialyzed in 50 mM carbonate buffer (0.015 M Na2CO3, 0.035 M NaHCO3, pH 9.6), with two buffer changes. The concentration of the monoclonal antibody was determined by BCA protein quantification. The concentration of 5G2 antibody was adjusted to 2 mg / mL with carbonate buffer. 2 mg of HRP powder was weighed and dissolved in 100 μL of ultrapure water. 21 mg of NaIO4 was weighed and dissolved in 1 mL of ultrapure water. 100 μL of NaIO4 solution was slowly mixed with 100 μL of HRP solution and allowed to stand at 4 °C for 30 min, at which point the solution was green. 2 μL of ethylene glycol was slowly added to the oxidized HRP solution and allowed to stand at room temperature in the dark for 30 min, at which point the solution was brown. The oxidized HRP solution was then directly added to the dialyzed 5G2 clonal antibody solution and reacted at room temperature for 2 h. Weigh 0.4 mg of NaBH4 and dissolve it in 20 μL of ultrapure water. Add the entire solution to the reaction mixture from the previous step and incubate at 4°C for 2 hours, shaking every 30 minutes. Transfer 5G2-HRP to a 30 kDa dialysis bag and dialyze against PBS buffer for 24 hours, changing the buffer three times during this period. Collect the 5G2-HRP from the dialysis bag and filter it through a 0.2 μm sterile filter for sterilization. Store at -80°C in the dark for long-term storage. Dilute the labeled monoclonal antibody with PBS and determine its optimal dilution using a sandwich ELISA method. Add enzyme-labeled antibody stabilizer to prepare a 100× enzyme-labeled antibody stock solution, aseptically aliquot, and store at 2–8°C in the dark.

[0080] 3. Determination of ELISA method detection sensitivity

[0081] Take 10 ng / mL of recombinant guinea pig IFN-γ and serially dilute it seven times (10, 5, 2.5, 1.25, 0.625, 0.3125, 0.15625 ng / mL) with sample dilution buffer (1% BSA in PBS, pH 7.2-7.4). Prepare the solution 15 min before detection. Add 50 μL of sample dilution buffer (1% BSA in PBS, pH 7.2-7.4) and 50 μL of sample to each well, mix gently, and react at room temperature (22-26℃) for 60 min. Discard the reaction solution, add 300 μL of PBST washing buffer to each well, wash five times, and gently pat dry after the last wash. Dilute 100× HRP-anti-guinea pig IFN-γ monoclonal antibody 100-fold with enzyme-labeled antibody dilution buffer (1% BSA in PBST, pH 7.2-7.4), 100 μL / well, and incubate at room temperature (22-26℃) in the dark for 60 minutes. Remove the reaction plate, discard the reaction solution, add 300 μL of 1× washing buffer to each well, wash 5 times, and gently pat dry the last well. When the OD of the blank control... 450nmA p / N ratio < 0.15 indicates a valid result, and a p / N ratio ≥ 2.1 indicates a positive result. Results showed that when 1A2 monoclonal antibody was used as the coating antibody and 5G2-HRP as the detection antibody, the detection sensitivity for guinea pig IFN-γ reached 0.3125 ng / mL, and within the range of 0.3125 and 10 ng / mL, the IFN-γ content showed a good linear relationship with the OD value (Table 4). Figure 3 This indicates that 1A2 can be used as a capture antibody for the quantitative detection of IFN-γ in guinea pigs.

[0082] Table 4. Sensitivity of 1A2 as a capture antibody for detecting guinea pig IFN-γ

[0083]

[0084]

[0085] 4. Detection of natural guinea pig IFN-γ using ELISA method

[0086] Three Hartley guinea pigs weighing approximately 350g were selected, and 10mL of blood was collected from their hearts and placed in heparin anticoagulant tubes. The blood was transported back to the laboratory at room temperature within 20 hours for analysis. The anticoagulated blood was aseptically aliquoted into 48-well cell culture plates (0.5mL / well). Serially diluted ConA, BSA, and PBS were added to each well (50μL per well). The plates were gently mixed and incubated at 37℃ with 5% CO2 for 16-24 hours. The supernatant was collected by centrifugation for analysis. For monoclonal antibody-coated plates, 50μL of sample dilution buffer (PBS containing 1% BSA) was added to each well. Serially diluted recombinant guinea pig IFN-γ (10, 5, 2.5, 1.25, 0.625, 0.3125, 0.15625, 0 ng / mL) was added to the first and second columns. Each sample was tested in duplicate. From the third column onwards, 50μL of plasma sample was added. The plates were gently mixed, sealed, and incubated at room temperature (22-26℃) for 60 minutes. Discard the reaction solution. Add 300 μL of PBST washing buffer to each well and wash 5 times, gently patting dry after the last wash. Dilute 100×HRP-anti-guinea pig IFN-γ monoclonal antibody 100-fold with enzyme-labeled antibody dilution buffer (1% BSA in PBST, pH 7.2-7.4), 100 μL / well. Incubate at room temperature (22-26℃) in the dark for 60 minutes. Remove the reaction plate, discard the reaction solution, add 300 μL of 1× washing buffer to each well, and wash 5 times, gently patting dry after the last wash. When the OD of the blank control... 450 nm The result is valid when <0.15. The protein concentration of recombinant guinea pig IFN-γ is plotted on the ordinate, and its OD... 450 Using the average mean as the x-axis, plot the standard curve. When R... 2 When the value is ≥0.99, the obtained formula can be used to quantify IFN-γ ( Figure 4 The concentrations of IFN-γ in the peripheral blood of guinea pigs stimulated with BSA (10 μg / mL), PBS, and ConA (5 μg / mL) were compared using Graphpad 9.1 software. The results showed that the average IFN-γ concentrations in the peripheral blood of guinea pigs stimulated with BSA and PBS were 0.1073±0.0332 ng / mL and 0.0964±0.0338 ng / mL, respectively, while the average IFN-γ concentration in the peripheral blood of guinea pigs stimulated with ConA was 12.34±0.695 ng / mL. The IFN-γ produced after ConA stimulation was significantly higher than that produced after BSA and PBS stimulation (…). Figure 5 Therefore, when 1A2 monoclonal antibody is used as the coating monoclonal antibody and 5G2-HRP is used as the detection antibody, it can effectively detect guinea pig natural IFN-γ.

[0087] Example 4: Determination of tuberculin titer

[0088] 1. Guinea pig sensitization

[0089] Twelve Hartley guinea pigs weighing approximately 400g were selected. Ten of them were injected intramuscularly with 0.5mg of bovine tuberculosis sensitizer into the deep inner thigh, while the other two served as a blank control. Five weeks later, a small patch of fur (approximately 3cm) was plucked from the rump of each guinea pig. 2 (Avoid the side where the allergen was injected). On the second day, dilute the international reference standard of PPD-B to 100 IU / mL and inject 0.1 mL intradermally into the hair removal site. Observe for 24 hours after injection; the area of ​​redness and swelling at the injection site should not be less than 1 cm². 2 This indicates that the guinea pigs have undergone good sensitization and the titer can be determined. 8 out of 10 guinea pigs showed good sensitization.

[0090] 2. Whole blood stimulation

[0091] Six well-sensitized guinea pigs and two blank controls were selected. Whole blood was aseptically collected and placed in heparin anticoagulant tubes. The tubes were transported back to the laboratory at room temperature within 20 hours for testing. The anticoagulated blood was aseptically aliquoted into 48-well cell culture plates at 0.5 mL / well. International reference standards PPD-B (final concentrations of 300, 150, 100, 50, 25, 10, 5, 2.5, and 1 IU / mL), BSA (final concentration of 10 μg / mL), ConA (final concentration of 5 μg / mL), and PBS were added to each well. The mixture was gently mixed and incubated in a 37°C, 5% CO2 incubator for 16–24 hours. The supernatant was collected by centrifugation.

[0092] 3. ELISA testing

[0093] The IFN-γ levels of each sample were detected according to Example 3, with 10 μg / mL recombinant guinea pig IFN-γ as a positive control and PBS as a negative control. Results were considered valid when the positive control OD ≥ 1.0 and the negative control OD < 0.15. The results showed that BSA and PBS could not stimulate IFN-γ production in guinea pig peripheral blood lymphocytes, while ConA and PPD-B could stimulate IFN-γ production in sensitized guinea pig peripheral blood lymphocytes, and PPD-B could not stimulate IFN-γ production in non-sensitized guinea pigs. Figure 6 Based on the standard curve, the IFN-γ level after the action of PPD-B was calculated. A positive correlation was found between the amount of PPD-B and the concentration of IFN-γ, which can be used to calibrate the potency of PPD-B. Figure 7 ).

[0094] The monoclonal antibody 1A2 used in this invention can specifically capture guinea pig IFN-γ and can be used for quantitative detection of natural guinea pig IFN-γ. It has good affinity, specificity and sensitivity. Furthermore, it is the first time that it can be used to calibrate PPD titer, which improves the efficiency of tuberculin titer calibration, effectively reduces detection costs, and reduces the error of manually measuring the area of ​​skin swelling, making the detection results more reliable.

[0095] The above description is a preferred embodiment of the invention. It should be noted that, for those skilled in the art, several improvements and modifications can be made without departing from the principle of the invention, and these improvements and modifications are also considered to be within the scope of protection of the invention.

Claims

1. A hybridoma cell line GIFN-1A2, which was deposited in the General Microbiology Center of the China Culture Collection of Microorganisms on January 5, 2023, with the deposit number CGMCC No.45344. The address of the General Microbiology Center of the China Culture Collection of Microorganisms is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

2. A monoclonal antibody against guinea pig IFN-γ, characterized in that: The protein is secreted by the hybridoma cell line GIFN-1A2 as claimed in claim 1.

3. Use of the monoclonal antibody according to claim 2 in the preparation of a kit for detecting guinea pig IFN-γ.

4. Use of the monoclonal antibody according to claim 2 in the preparation of a kit for tuberculin titer calibration.

5. The use according to claim 4, characterized in that The tuberculin is bovine tuberculin and / or avian tuberculin.

6. The use according to claim 3 or 4, characterized in that Detection was performed using ELISA method.

7. A kit for detecting guinea pig IFN-γ, characterized in that: Comprising the monoclonal antibody as claimed in claim 2.

8. A kit for tuberculin titer calibration, characterized in that: Comprising the monoclonal antibody as claimed in claim 2.

Images