Tobacco transcription factor Ntbhlh68 and application of coded protein in nicotine synthesis metabolism
By silencing the NtbHLH68 gene in tobacco and utilizing the tobacco transcription factor NtbHLH68 and its encoded protein, the insufficient molecular regulation of nicotine biosynthesis was addressed, resulting in a reduction of nicotine content in tobacco leaves and providing a new molecular breeding pathway.
Patent Information
- Application Number
- CN202310477217.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-04-28
- Publication Date
- 2026-04-21
- Estimated Expiration
- 2043-04-28
AI Technical Summary
There has been a lack of breakthroughs in the molecular regulation of nicotine biosynthesis in tobacco, and existing research has not fully understood the sites in tobacco that regulate nicotine synthesis.
The tobacco transcription factor NtbHLH68 and its encoded protein were provided. By constructing the PBWA(V)HS-NtbHLH68-RNAi vector, the NtbHLH68 gene was silenced using Agrobacterium-mediated leaf disc transformation, thereby reducing the nicotine content in tobacco leaves.
This study effectively reduced the nicotine content in tobacco seedling leaves, providing a new molecular breeding strategy for regulating nicotine content in tobacco and other plants.
Smart Images

Figure CN116410285B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bioengineering technology, specifically relating to the application of a tobacco transcription factor NtbHLH68 and its encoded protein in nicotine synthesis and metabolism. Background Technology
[0002] Alkaloids are the most widespread secondary metabolites in plants besides terpenes, and are generally alkaline. In nature, nicotine is found in major Solanaceae plants, and its main biological function is insect resistance. In tobacco, four main alkaloids are present: nicotine, nornicotine, neonicotine, and pseudoequisetine. Nicotine is the most abundant tobacco alkaloid, accounting for 90%–95% of the total alkaloid content in cultivated tobacco. Therefore, research on nicotine biosynthesis and regulation has long been a focus of research in the field of secondary metabolism. The biosynthetic pathway of nicotine is now relatively well understood: ornithine decarboxylase (ODC) catalyzes the formation of putrescine from ornithine, or arginine decarboxylase (ADC) catalyzes the formation of putrescine from arginine. Putrescine is then catalyzed by putrescine N-methyltransferase (PMT) to form N-methylputrescine. N-methylputrescine is further catalyzed by N-methylputrescine oxidase (MPO) to form 4-methylbutyraldehyde. Nicotinic acid or its derivatives formed via the aspartic acid pathway can form a pyridine ring. The pyridine ring and 4-methylbutyraldehyde spontaneously cyclize to form a pyrrolidine ring, which then condenses to synthesize nicotine. However, there has been no breakthrough in the molecular regulation of nicotine biosynthesis. Besides plant hormones, the role of sites within tobacco itself that regulate nicotine synthesis requires further investigation.
[0003] This invention is proposed to further investigate the sites in tobacco that regulate nicotine synthesis. Summary of the Invention
[0004] The purpose of this invention is to provide a gene NtbHLH68 related to nicotine synthesis and metabolism in tobacco, thereby providing a new strategy and pathway for molecular breeding to regulate nicotine content in tobacco and other plants.
[0005] The technical solution adopted in this application is described in detail below:
[0006] The first aspect of the present invention provides a tobacco transcription factor NtbHLH68, the nucleotide sequence of which is shown in SEQ ID NO: 1.
[0007] The second aspect of the present invention provides a protein encoded by the transcription factor NtbHLH66 described in the first aspect, the amino acid sequence of which is shown in SEQ ID NO: 2.
[0008] The third aspect of this invention provides an application of the tobacco transcription factor NtbHLH68 described in the first aspect in tobacco. The tobacco transcription factor NtbHLH68 is related to the synthesis and metabolism of nicotine in tobacco. Silencing this gene reduces the nicotine content in tobacco leaves during the seedling stage.
[0009] Preferably, the method for constructing the PBWA(V)HS-NtbHLH68-RNAi vector for silencing NtbHLH68 is as follows: using nucleotides 200-399 of NtbHLH68 as the guide sequence for RNAi, this nucleic acid fragment is inserted into the empty PBWA(V)HS vector in both directions to construct the PBWA(V)HS-NtbHLH68-RNAi vector.
[0010] Preferably, the specific method for silencing is as follows: using Agrobacterium-mediated leaf disc transformation, the RNAi vector pBWA(V)HS-NtbHLH68-RNAi is transformed into cultivated tobacco K326, and NtbHLH68 gene-silenced plants are obtained through screening and identification. The phenotype of the NtbHLH68 gene-silenced plants is that the nicotine content of the gene-silenced transgenic plants is significantly reduced in the seedling stage.
[0011] Preferably, the tobacco nicotine synthesis metabolism-related gene NtbHLH68 provided by the present invention is derived from tobacco (Nicotiana tabacum L.).
[0012] Preferably, the tobacco nicotine synthesis metabolism-related gene NtbHLH68 provided by the present invention is derived from tobacco (Nicotiana tabacum L.) and encodes the following protein (i) or (ii):
[0013] (i) A protein with the amino acid sequence shown in SEQ ID NO: 2 of the sequence listing;
[0014] (ii) A protein derived from the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing by substitution, deletion or addition of one to ten amino acid residues, and the derived protein has the same function as the protein described in (i).
[0015] Preferably, the tobacco NtbHLH68 gene of the present invention can be a cDNA sequence, a genomic DNA sequence, or a DNA sequence that has more than 90% homology with these sequences and encodes the same functional protein. Attached Figure Description
[0016] Figure 1 Electrophoresis diagram of PCR products of NtbHLH68 gene;
[0017] M, marker; 1, forward sequence PCR product; 2, reverse sequence PCR product;
[0018] Figure 2 RNAi interference vector pBWA(V)HS-RNAi map;
[0019] Figure 3 pBWA(V)HS-NtbHLH68-RNAi restriction map;
[0020] M, marker; 1, enzyme digestion band;
[0021] Figure 4 Gene expression analysis of NtbHLH68-RNAi transgenic lines;
[0022] Figure 5 Analysis of alkaloid content in NtbHLH68-RNAi transgenic lines and control K326. Detailed Implementation
[0023] The present invention will be further described below with reference to the accompanying drawings, but this is not intended to limit the present invention in any way. Any modifications or substitutions made based on the teachings of the present invention shall fall within the protection scope of the present invention.
[0024] The nucleotide sequence of the tobacco transcription factor NtbHLH68 described in this invention is as shown in SEQ ID No: 1. Alternatively, it may be a nucleotide sequence that can hybridize with the DNA sequence defined in SEQ ID No: 1 under highly stringent conditions; or a DNA sequence that has more than 90% homology with the DNA sequence defined in SEQ ID No: 1 and encodes a protein with the same function.
[0025] The tobacco transcription factor NtbHLH68 of this invention encodes a protein related to nicotine synthesis and metabolism, the amino acid sequence of which is shown in SEQ ID NO: 2. The protein may also be a derivative polypeptide formed by substitution and / or deletion and / or addition of one or more amino acid residues from the amino acid sequence shown in SEQ ID NO: 2, and possesses a phenotype affecting tobacco heavy metal transport. The substitution and / or deletion and / or addition of one or more amino acid residues refers to the substitution and / or deletion and / or addition of no more than 10 amino acid residues.
[0026] The application of the tobacco transcription factor NtbHLH68 described in this invention involves inhibiting the expression of the NtbHLH68 gene in tobacco plants, which can alter the nicotine content in tobacco leaves during the seedling stage. The expression of the NtbHLH68 gene can be inhibited through various RNA-mediated methods, such as: gene silencing mediated by plant virus vectors, transformation of RNAi interference vectors mediated by Agrobacterium-mediated transformation, optimization of gene coding frames, and optimization of gene promoters. The methods for inhibiting gene expression described in this invention are not limited to the above-mentioned methods; any method that can inhibit NtbHLH68 expression is acceptable.
[0027] When the NtbHLH68 gene of this invention is constructed into a plant expression vector, any enhancing or inducible promoter can be added before its transcription initiation nucleotide. To facilitate the identification and screening of transgenic plant cells or plants, the vector used can be processed, such as by adding plant-selective markers (GUS gene, luciferase gene, etc.) or antibiotic resistance markers (gentamicin, kanamycin, etc.). The transformed plant host can be either a monocotyledonous or dicotyledonous plant, such as tobacco, rice, wheat, corn, cucumber, tomato, poplar, turfgrass, or alfalfa. The expression vector carrying the NtbHLH68 gene of this invention can be used to transform plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, microinjection, electrocoagulation, and Agrobacterium-mediated transformation, and the transformed plants can be cultured into plants.
[0028] The tobacco nicotine synthesis metabolism-related genes and their encoded proteins of this invention provide genetic and technical support for molecular breeding of plants, especially tobacco nicotine content regulation.
[0029] The present invention will be further described below with reference to specific embodiments.
[0030] All plant tissue materials used in this embodiment were derived from the flue-cured tobacco (Nicotiania tabacum L.) variety K326 and the K326 transgenic plant with RNAi interference NtbHLH68. The tobacco materials were grown in an artificial climate chamber at 25°C with a photoperiod of 12 hours light / 12 hours dark. Leaf samples from seedlings were collected, flash-frozen in liquid nitrogen for subsequent molecular experiments; other leaf samples were freeze-dried for subsequent metabolic assays.
[0031] Example 1: Cloning of the NtbHLH68 gene fragment
[0032] Tobacco RNA Extraction and cDNA Synthesis
[0033] RNA extraction: Young leaves of cultivated tobacco K326 seedlings were used as samples. After thorough grinding into powder using liquid nitrogen, approximately 100 mg of the powder was placed in a 1.5 ml centrifuge tube containing 1.0 ml of TRIZOL reagent. 200 μl of chloroform was added, and the mixture was vortexed and centrifuged. The supernatant was carefully removed and transferred to another centrifuge tube. 500 μl of isopropanol was added, and the RNA was precipitated, centrifuged, and separated. The RNA was then washed with 75% ethanol, allowed to dry slightly at room temperature, and dissolved thoroughly in an appropriate volume of RNase-free water. The extracted total RNA was then treated with DNase I. The digestion reaction system was as follows:
[0034]
[0035] Place in a 37°C water bath for 30 minutes.
[0036] cDNA first-strand synthesis: Prepare the following template RNA / primer mixture in a sterile 0.2 ml centrifuge tube, incubate at 70°C for 10 min, then rapidly cool on ice for at least 2 min, and centrifuge for a few seconds to allow the denatured template RNA / primer solution to accumulate at the bottom of the centrifuge tube.
[0037]
[0038] After preparing the following reverse transcription reaction solution in the centrifuge tubes, incubate at 42°C for 1 hour; incubate at 70°C for 15 minutes and then cool on ice. The resulting cDNA is used for PCR amplification.
[0039]
[0040]
[0041] Using K326 cDNA as a template, primers were designed based on information from the tobacco genome database to perform PCR amplification of the NtbHLH68 gene, and the PCR amplification product was obtained.
[0042] Primers for amplifying the forward NtbHLH68 gene fragment:
[0043] NtbHLH68-F: 5'cagtggtctcacaacatgaatagaggtgctatgca3' (SEQ ID NO: 3);
[0044] NtbHLH68-R: 5'cgatggtctcacctgcaggtggttattattccatg3' (SEQ ID NO: 4).
[0045] LOOP primer:
[0046] F:5'cgatggtctcacaggtctagtttttctcctt3' (SEQ ID NO: 5);
[0047] R: 5'cgatggtctcagcccgggctctgtaactatc3' (SEQ ID NO: 6).
[0048] Primers for amplifying the reverse NtbHLH68 gene fragment:
[0049] NtbHLH68-F: 5'cagtggtctcagggctggttattattccatggagg3' (SEQ ID NO: 7);
[0050] NtbHLH68-R: 5'cagtggtctcatacaatgaatagaggtgctatgca3' (SEQ ID NO: 8).
[0051] The PCR amplification system is as follows:
[0052]
[0053] The PCR reaction procedure is shown in the table below:
[0054]
[0055]
[0056] The amplified PCR products were subjected to 1% agarose gel electrophoresis. The gel electrophoresis results are as follows: Figure 1 As shown. After electrophoresis, the PCR products were purified using the Takara PCR product purification kit according to the product instructions and sent to Shanghai Sangon Biotech for sequencing to verify the sequence results.
[0057] Example 2: Construction of plant RNAi vectors
[0058] After purification, the PCR product containing the Infusion adapter sequence from Example 1 was used to ligate the target fragment into the pBWA(V)HS-RNAi vector using Infusion ligase. Figure 2 The Infusion connectivity hierarchy is shown in the table below:
[0059]
[0060] The above-mentioned fragment mixture was reacted at 50°C for 15 minutes, and then placed on ice for 2-3 minutes.
[0061] (1) Transformation of ligation products into competent E. coli cells (heat shock method)
[0062] Under aseptic conditions, add 10 μl of the ligation product to competent cells, mix gently, and incubate on ice for 30 min. Heat shock at 42°C for 90 s, then quickly transfer the centrifuge tube to ice for 2-3 min. Add 800 μl of antibiotic-free LB medium and incubate at 37°C with gentle shaking (100-160 rpm) for approximately 1 h. Spread 200 μl of the culture solution onto LB solid medium containing 50 μg / ml of antibiotics. Before spreading the culture, add X-Gal and IPTG and spread evenly. Incubate upside down at 37°C for 12-16 h.
[0063] (2) Screening and identification of positive clones
[0064] Numerous blue and white bacterial colonies grew in the culture medium. Once the colonies reached a suitable size, several white colonies were picked off with a sterilized pipette tip and cultured with shaking in LB liquid medium containing 50 μg / ml kanamycin for 12-16 hours. Plasmids were extracted, and the vector construction results were identified by enzyme digestion. Figure 3 ).
[0065] Example 3: Agrobacterium-mediated tobacco transformation and identification of transgenic plants
[0066] (1) Freeze-thaw transformation of Agrobacterium tumefaciens
[0067] Add 1 μg pBWA(V)HS-NtbHLH68-RNAi vector to 100 μg EHA105 Agrobacterium L competent cells, mix well, and incubate on ice for 30 min. Then freeze in liquid nitrogen for 5 min, remove from liquid nitrogen, and incubate in a 37°C water bath for 5 min. After incubating on ice for 5 min, add 500 μl LB solution and incubate at 28°C with full shaking for 4 h. Finally, spread the bacterial culture evenly on selective agar plates and incubate at 28°C for 24-48 h.
[0068] (2) Leaf disc method for converting tobacco variety K326
[0069] The specific method is as follows:
[0070] (a) Under sterile conditions, tobacco K326 seeds were placed in EP tubes and rinsed 2-3 times with sterile water; then soaked in 75% alcohol for 30-60 seconds, treated with 0.1% mercuric chloride for 5 minutes, rinsed 5 times with sterile water, and sown on MS medium. The culture bottles were placed in an artificial climate chamber to ensure normal germination and growth of tobacco seedlings.
[0071] (b) When the tobacco seedlings grow to 3-5cm (approximately 20-30 days), take the terminal bud and place it on MS medium with 0.2 mg / L BA (to promote rapid growth) for subculture. After 14 days of subculture (until small leaves appear), take leaves measuring 1cm × 1cm, remove the petiole, and make incisions on the leaf surface and edges. Place the leaves on MS medium with 1.0 mg / L BA at pH 6.0-6.5, with the upper surface facing down and in close contact with the medium, and pre-culture in the dark for 2-3 days.
[0072] (c) Remove the pre-cultured leaves or stem segments and place them in the Agrobacterium infection solution for infection. The night before infection, shake two bottles of Agrobacterium. Fill 2 mL centrifuge tubes with bacterial suspension, centrifuge at 4000 rpm for 5 min, and wash twice with the bacterial suspension. Add 1.5 mL of bacterial cells to the bacterial suspension at a 1:10 ratio (10 mL of bacterial suspension to 1 tube of acetylsuccinyl ethylsuccinate (As) 25 mg / L), and continuously shake the infection solution to ensure full contact with the cut surfaces of the leaves and stem segments. After 15 min, remove the samples and place them on sterilized, dry filter paper to blot dry the bacterial suspension.
[0073] The preparation method of Agrobacterium infection solution is as follows: Take the transformed Agrobacterium stored at -80℃, streak it on a plate, add 50 mg / L Kan and 50 mg / L Rif to the LB solid plate; pick a single colony and put it into 5 mL of LB liquid medium containing 50 mg / L Kan and 50 mg / L Rif, and incubate it overnight (12-16 h) at 28℃ and 200 r / min in a shaker; when the bacterial concentration reaches about OD600 = 1.5, take 2 mL of bacterial solution and add it to a centrifuge tube, centrifuge at 4000 r / min for 5 min; remove the supernatant, aspirate 1 mL of fresh MS liquid medium, resuspend the Agrobacterium, and centrifuge at 4000 r / min for 5 min; repeat step (6) once; after resuspending the bacteria with 1 mL of MS liquid medium, add it to 40 mL of MS liquid medium (containing 40 μL 25 mg / L As), which is the infection solution. Infect after standing for 2 h.
[0074] The preparation of 200mL of bacterial suspension is as follows:
[0075] 20× Macroelements 10mL
[0076] 200× Organic Elements 1ml
[0077] 200× iron salt 1mL
[0078] 200× Trace Elements 1mL
[0079] 5.6g of sucrose
[0080] Add deionized water and bring the volume to 200 mL.
[0081] (d) Place the leaves and stem segments back onto the pre-culture medium and co-culture at 28°C in the dark for 2-3 days until micro-bacterial spots form around the leaf cuts; remove the co-cultured tobacco leaves and stem segments and rinse them 6 times with sterile water containing 500 mg / L Cef. The first rinse is placed on a shaker and shaken for 30 minutes, followed by 5 minutes each time, to wash away Agrobacterium on the surface of the explants.
[0082] (e) Blot dry with filter paper and transfer to tobacco budding medium. The budding medium is MS + BA 1.0 mg / L + Hyg 25 mg / L + Cef 500 mg / L pH 5.8. Observe after 2 weeks. If no bacteria are found, reduce the Cef concentration. If bacteria are found, continue to maintain the Cef concentration.
[0083] (f) Change the culture medium every 2 weeks until adventitious buds appear (usually 2 weeks). Cut off the regenerated seedlings (about 1 cm long) and transfer them to subculture medium MS + BA 0.2-0.1 mg / L + Hyg 25 mg / L + Cef 500 mg / L pH 5.8; when the seedlings grow to 2 cm in length (with small buds), transfer them to rooting medium MS + NAA 0.2-0.1 mg / L, and culture at 25℃ with 12h light for about 3 weeks until robust roots develop.
[0084] (g) When the roots grow to 2-3cm and the seedlings are about 7-10cm tall, remove them from the Erlenmeyer flasks, wash off the culture medium from the roots, and transplant them into flowerpots for greenhouse cultivation.
[0085] (3) Obtaining stable transgenic lines
[0086] Genomic DNA was extracted from transgenic tobacco seedlings using a DNA extraction kit from Takara. Primers for the Kan resistance gene were designed for PCR amplification, and positive plants were screened. Ten positive plants were detected.
[0087] The primers for the Kan resistance gene are:
[0088] Kan-F: tctggacgaagagcatcagg (SEQ ID NO: 9)
[0089] Kan-R: atgaatccagaaaagcggcc (SEQ ID NO: 10)
[0090] RNA was extracted from the K326 control and three NtbHLH68-RNAi transgenic lines as described in Example 1, and cDNA was synthesized. Quantitative PCR was used to detect the expression of NtbHLH68 in different transgenic lines. The detection primers and internal control primers are shown below:
[0091] The qRT-PCR primers are:
[0092] qNtbHLH68-F: 5'gggtggaagccctaactg 3' (SEQ ID NO: 11);
[0093] qNtbHLH68-R: 5'atggaggcgaaggaagtg 3' (SEQ ID NO: 12).
[0094] The primers for the internal reference gene are:
[0095] 26s-F: 5'-gaagaaggtcccaagggttc-3' (SEQ ID NO: 13);
[0096] 26s-R: 5'-tctccctttaacaccaacgg-3' (SEQ ID NO: 14).
[0097] Select the transgenic line with the lowest expression level ( Figure 4 As the research object, the nicotine content of the leaves was detected.
[0098] Example 4: Determination of Alkaloid Content in Tobacco Leaves
[0099] Cultivated tobacco K326 plants and RNAi interference transgenic tobacco seeds were evenly sown in small pots containing nutrient soil and cultured in a light-cured incubator. During the seedling stage, leaves were rapidly frozen in liquid nitrogen and then freeze-dried. 0.3 g of freeze-dried fresh leaf powder was weighed into a 50 mL screw-cap pressure-resistant test tube, 2.5 mL of 5% sodium hydroxide solution was added to moisten the sample, and it was allowed to stand for 15 min. Then, 20 mL of 0.01% triethylamine / methyl tert-butyl ether solution was added, the tube was sealed, and the sample was ultrasonically extracted at room temperature for 15 min. The tube was then centrifuged at 6000 rpm for 5 min. 2 mL of the organic phase was analyzed by GC / MS to determine the nicotine content. 10 mL of the organic phase was accurately transferred and concentrated to 1 mL for GC / MS analysis to determine the content of the other 10 alkaloids. The detection of nicotine and the other 10 alkaloids was performed using two injections, with qualitative analysis using retention time and selected ion (SIM) mode, and quantitative analysis using dual internal standards. After silencing the NtbHLH68 gene, the nicotine content in the leaves of NtbHLH68-RNAi transgenic tobacco plants was significantly reduced. Figure 5 ).
[0100]
[0101]
Claims
1. The application of silencing the tobacco transcription factor NtbHLH68 in reducing nicotine content in tobacco leaves, characterized in that, The tobacco transcription factor NtbHLH68 is related to the synthesis and metabolism of nicotine in tobacco. Silencing the NtbHLH68 gene in tobacco seedlings reduced the nicotine content in tobacco leaves. The nucleotide sequence of the tobacco transcription factor NtbHLH68 is shown in SEQ ID NO:
1.
2. The application according to claim 1, characterized in that, The method for constructing the PBWA(V)HS-NtbHLH68-RNAi vector for silencing NtbHLH68 is as follows: using nucleotides 200-399 of NtbHLH68 as the guide sequence for RNAi, this nucleotide fragment is inserted into the empty PBWA(V)HS vector in reverse order to construct the PBWA(V)HS-NtbHLH68-RNAi vector.
3. The application according to claim 1, characterized in that, The specific method for silencing the gene is as follows: using Agrobacterium-mediated leaf disc transformation, pBWA(V)HS-NtbHLH68-RNAi is used to transform cultivated tobacco K326. Through screening and identification, NtbHLH68 gene-silenced plants are obtained. The phenotype of the NtbHLH68 gene-silenced plants is that the nicotine content of the gene-silenced transgenic plants is significantly reduced during the seedling stage.
Citation Information
Patent Citations
NtWRKY69 gene affecting tobacco pigment content and application of NtWRKY69 gene
CN107177604A
Tobacco transcription factor NtMYB305 and application thereof in regulation and control of tobacco nicotine biosynthesis
CN113151298A