DNA methylation biomarker composition for bladder cancer detection and use thereof

CN116411076BActive Publication Date: 2026-09-08SHANGHAI NINTH PEOPLES HOSPITAL SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310229269.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-03-10
Publication Date
2026-09-08
Estimated Expiration
2043-03-10

AI Technical Summary

Technical Problem

[0004]本发明的目的是解决现有判断膀胱癌发生的检测方法灵敏度低、特异性不高、具有侵入性的问题

Benefits of technology

[0016] (1) Since the degree of DNA methylation of markers is strongly correlated with the occurrence of bladder cancer: the higher the degree of DNA methylation, the greater the likelihood of bladder cancer. This invention determines the occurrence of bladder cancer by simultaneously detecting the degree of DNA methylation of multiple markers, overcoming the problem of low signal from a single DNA methylation marker, and improving the sensitivity and specificity of detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116411076B_ABST
    Figure CN116411076B_ABST
Patent Text Reader

Abstract

The application discloses a DNA methylation biomarker composition for bladder cancer detection and application thereof, and the DNA methylation biomarker composition comprises any two or any two or more combinations of markers OTX2_28, PTPRN2_16, cg05091238_46, cg11536474_41, cg19763461_39 and cg25092838_2nd_55. A kit for detecting bladder cancer can be prepared according to the six markers, the kit can be used for simultaneously detecting DNA methylation levels of the six markers, the kit overcomes the defect of low single DNA methylation signal, the detection result is more accurate, and a non-invasive detection mode can also avoid complications caused by cystoscopy.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to a DNA methylation biomarker composition for bladder cancer detection and its application. Background Technology

[0002] Bladder cancer (BC) is one of the most common malignant tumors of the urinary system. In China, the number of new bladder cancer cases in 2020 was 78,000 per year, and the incidence rate is showing an increasing trend annually. Bladder cancer is characterized by high incidence and a high recurrence rate. Hematuria is a common clinical symptom of bladder cancer, with approximately 17% of patients with hematuria being diagnosed with bladder cancer. Currently, the main diagnostic methods for bladder cancer include cystoscopy, urine cytology, urine FISH testing, and tumor marker testing.

[0003] However, these methods all have various drawbacks: cystoscopy combined with biopsy is the gold standard for cystoscopic diagnosis, but this method is invasive, prone to complications, and has low patient compliance; imaging examinations have limited diagnostic capabilities for small lesions; urine exfoliative cytology has low sensitivity; urine FISH testing is complex to perform and the interpretation of results is subjective; existing tumor marker tests are mainly based on the presence of specific proteins in urine, but due to the low content of proteins in urine, the sensitivity and specificity are still limited. Summary of the Invention

[0004] The purpose of this invention is to solve the problems of low sensitivity, low specificity, and invasiveness in existing methods for detecting bladder cancer.

[0005] To achieve the above objectives, the present invention provides a DNA methylation biomarker composition for bladder cancer detection, wherein the DNA methylation biomarker composition comprises any two or more of the following markers: OTX2_28, PTPRN2_16, cg05091238_46, cg11536474_41, cg19763461_39, and cg25092838_2nd_55.

[0006] Preferably, the DNA methylation biomarker composition comprises a combination of markers OTX2_28, PTPRN2_16, cg05091238_46, cg11536474_41, cg19763461_39, and cg25092838_2nd_55.

[0007] Preferably, the DNA methylation biomarker composition comprises a combination of methylation sites indicated by CG in the following sequences: SEQ ID NO.1 of marker OTX2_28, SEQ ID NO.2 of PTPRN2_16, SEQ ID NO.3 of cg05091238_46, SEQ ID NO.4 of cg11536474_41, SEQ ID NO.5 of cg19763461_39, and SEQ ID NO.6 of cg25092838_2nd_55.

[0008] The present invention also provides the use of the DNA methylation biomarker composition as described in any one of the above claims in the preparation of a kit for detecting bladder cancer.

[0009] The present invention provides a kit for detecting bladder cancer, the kit comprising at least a reagent for detecting the DNA methylation level of the DNA methylation biomarker composition described in any one of the above-mentioned methods.

[0010] Preferably, the kit further comprises primer pairs for each marker, wherein the primer pairs are: a first primer pair for marker OTX2_28; a second primer pair for marker PTPRN2_16; a third primer pair for marker cg05091238_46; a fourth primer pair for marker cg11536474_41; a fifth primer pair for marker cg19763461_39; and a sixth primer pair for marker cg25092838_2nd_55.

[0011] Preferably, the nucleotide sequences of the first primer pair are as shown in SEQ ID NO: 7-8; the nucleotide sequences of the second primer pair are as shown in SEQ ID NO: 9-10; the nucleotide sequences of the third primer pair are as shown in SEQ ID NO: 11-12; the nucleotide sequences of the fourth primer pair are as shown in SEQ ID NO: 13-14; the nucleotide sequences of the fifth primer pair are as shown in SEQ ID NO: 15-16; and the nucleotide sequences of the sixth primer pair are as shown in SEQ ID NO: 17-18.

[0012] Preferably, the kit further comprises at least one of nucleic acid extraction reagent, methylation conversion reagent, PCR reaction reagent, and sequencing reagent.

[0013] Preferably, the kit can be used to detect DNA methylation levels using any one of the following samples: tissue sample, urine sediment sample, urine sample, and urine exfoliated cell sample.

[0014] Preferably, the kit is used for detection on any one or a combination of two or more of the following platforms: PCR amplification, quantitative real-time PCR, methylation chip method, digital PCR, bisulfite sequencing, and methylation-specific microarray method.

[0015] The beneficial effects of this invention are:

[0016] (1) Since the degree of DNA methylation of markers is strongly correlated with the occurrence of bladder cancer: the higher the degree of DNA methylation, the greater the likelihood of bladder cancer. This invention determines the occurrence of bladder cancer by simultaneously detecting the degree of DNA methylation of multiple markers, overcoming the problem of low signal from a single DNA methylation marker, and improving the sensitivity and specificity of detection.

[0017] (2) The DNA methylation detection method of the present invention adopts a statistical approach from judging the degree of methylation to interpreting the diagnostic results. This avoids the subjectivity of human judgment in traditional urine FISH or exfoliative cytology tests. It is simple and easy to implement, the interpretation is objective, the test results are more stable, and the accuracy of the test is improved.

[0018] (3) The DNA methylation detection of the present invention is non-invasive, which can avoid complications caused by cystoscopy and improve patient compliance. Attached Figure Description

[0019] Figure 1 The present invention provides a heatmap analysis of the 58 marker methylation sites in 20 bladder cancer tissue samples.

[0020] Figure 2 This is a ROC curve of methylation sites of 6 markers in 57 urine sediment samples from this invention.

[0021] Figure 3 Box plot showing the differences in 57 urine sediment samples from this invention.

[0022] Figure 4 This is a flowchart of the detection method for the DNA methylation biomarker composition kit for detecting bladder cancer according to the present invention. Detailed Implementation

[0023] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.

[0024] Unless otherwise specified, all experimental materials used in this invention are commercially available, and all experimental methods not mentioned in this invention are conventional experimental methods in the field.

[0025] The development and progression of tumors involve extensive genetic changes and related dysregulations in gene function and activity. Among these, DNA methylation is one of the best-characterized epigenetic modifications, influencing gene expression and genome stability, and playing a significant role in tumor development and progression. Most of these epigenetic changes occur in the early stages of tumors and are prevalent across all tumor types. DNA methylation markers are crucial for early tumor diagnosis, prognosis, and treatment detection. Cancer-related DNA methylation changes can be detected in blood, stool, urine, and other biological samples, providing a non-invasive, rapid, and repeatable alternative to tissue biopsies.

[0026] DNA methylation typically involves a methyl group (-CH3) covalently bound to the fifth carbon atom of a pyrimidine ring containing a cytosine residue (5-methylcytosine, 5mC). DNA methylation in normal human cells plays a crucial role in development, differentiation, and tissue homeostasis. Tumorigenesis involves extensive genetic changes and associated dysregulation of gene function and activity. Tumorigenesis is accompanied by widespread DNA methylation changes, characterized by focal hypermethylation with numerous 5-cytosine-phosphate-guanine-3' (CpG) islands. Some functions of methylation during tumorigenesis include genomic imprinting, X chromosome inactivation (XCI), germline-specific gene silencing, and inactivation of repetitive genomic regions.

[0027] The main mechanisms by which DNA methylation plays a role in tumorigenesis and development are as follows: (1) DNA methylation aberrations in cancer cell proliferation: DNA methylation is mediated by a series of proliferation signals, such as mitogen-activated protein kinase (MAPK) and cyclin-dependent kinase (CDK), leading to malignant proliferation, such as the pathogenesis of melanoma; (2) DNA methylation dysregulation in inhibiting apoptosis: such as the activation of intrinsic pathway p53 and extrinsic pathway tumor necrosis factor (TNF) can inhibit the ability of cells to undergo apoptosis; (3) The role of DNA methylation in metastasis induction: such as the role of DNA methylation in the induction of metastasis in epithelial-mesenchymal transition (EMT). DNA methylation initiated by the Transition (EMT) allows tumors to metastasize from their primary site and invade other tissues; (4) promotes genomic instability: for example, hypermethylation of the CpG promoter, mainly mediated by the Ataxia-Telangiectasia Mutation (ATM) promoter and O6-Methylguanine DNA Methyltransferase (MGMT), turns malignant cells to more variable genomic damage; (5) alters the overall gene expression pattern: recently, the emerging field of "epitranscriptomics" has been found to regulate abnormalities in tumorigenesis, such as glioma and colorectal cancer.

[0028] Currently, most DNA methylation detection methods for bladder cancer involve cystoscopy, urine cytology, and tumor marker testing, which lack sensitivity and specificity. Therefore, this invention aims to conduct experiments on DNA methylation biomarkers for bladder cancer.

[0029] 1. Experimental reagents and instruments

[0030] Experimental reagents: EZ DNA Methylation-Gold Kit (ZYMO, USA), TIANGENGel Extraction Kit (TIANGEN, China), 10×Reaction buffer (Takara, China), HotStart Taq polymerase (Takara, China), Herculase II Fusion DNA Polymerases (Agilent Technologies, USA).

[0031] Experimental instruments: ABI 2720 Thermal Cycler (Applied Biosystems, USA), Eppendorf 5810R Centrifuge (Eppendorf, Germany), XiangYi H1650-W (XiangYi, China), EP600 Gelelectrophoresis (Shanghai Yubai Industrial Co., Ltd.), NanoDrop 2000 (NanoDrop technologies, USA), Invitrogen Qubit 3.0 Spectrophotometer (Invitrogen, USA), Agilent 2100 bioanalyzer (Agilent, USA), IIIumina Hiseq / Nova seq (IIIumina, USA).

[0032] 2. Experimental Methods

[0033] 1) Sample quality control

[0034] A. Sample type: intact and uncontaminated genomic DNA;

[0035] B. Sample requirements: For Nanodrop 2000 to detect genomic DNA quality, the required concentration is ≥20ng / μL, the total amount is ≥400ng, and the sample purity is: OD260 / 280=1.7~1.9, OD260 / 230≥2.0;

[0036] C. Sample integrity: Agarose gel electrophoresis is required, with clear main bands and no obvious diffusion or tailing.

[0037] 2) Primer design and optimization of single-site PCR conditions

[0038] A. Designing high-quality sequencing primers

[0039] Primer F = Illumina adapter sequence 1 + specific amplification forward primer;

[0040] Primer R = Illumina adapter sequence 2 + specific amplification Reverse primer;

[0041] B. The product of standard DNA after bisulfite treatment was used as the test sample. The amplification product of each primer was accurate, clear and uniform in size, and was used for subsequent experiments.

[0042] 3) Multiplex PCR primer panel

[0043] A. Mix the optimized primers to form a multiplex PCR primer panel;

[0044] B. Use the product after treatment with bisulfite of the standard in step 2) as a template for amplification;

[0045] C. Based on capillary electrophoresis, determine whether each primer pair in a multiplex system can amplify efficiently and specifically;

[0046] D. After testing and adjustments to balance the amplification efficiency of each primer, the multiplex PCR panal was finally confirmed, and multiplex PCR amplification was performed.

[0047] 4) Bisulfite treatment

[0048] A. Process the samples according to the EZ DNA Methylation-Gold™ Kit instructions;

[0049] B. Convert unmethylated cytosine C in genomic DNA to uracil U.

[0050] 5) Multiplex PCR reaction of target fragments in samples

[0051] A. Amplification of the target region in the transformed sample: Multiplex PCR amplification was performed using the optimized multiplex PCR primer panel.

[0052] Table 1: Reaction System

[0053] 10×buffer (Takara) 2μL dNTP (2.5mM) 2.4μL <![CDATA[MgCl2(25mM)]]> 1.2μL Multiplex PCR panel primers (1 μL) 2μL HotTaq 5U / μL (Takara) 0.3μL DNA samples treated with bisulfite 1μL <![CDATA[ddH2O]]> 11.1 μL Total volume 20μL

[0054] Table 2: Reaction Conditions

[0055] Step 1 95℃ for 2 minutes 1× Step 2 95℃20s 62℃40s 72℃ for 1 minute 11 × (-0.5℃ / cycle) Step 3 95℃20s 62℃30s 72℃ for 1 minute 24× Step 4 72℃ for 1 minute 1× Step 5 4℃ forever

[0056] B. 1.5% agarose gel electrophoresis was used to confirm the validity of the PCR amplification of the sample;

[0057] C. Quantitatively mix the multiplex PCR products from each panel of the same sample in equal proportions;

[0058] D. Dilute the mixed multiplex PCR product 10-20 times and use it as a template for the subsequent Index PCR step, i.e., add a specific tag sequence;

[0059] 6) Add specific tag sequences to samples

[0060] A. Using primers with index sequences, a specific tag sequence compatible with the Illumina platform is introduced into the ends of the library via PCR amplification;

[0061] B. Configure the following reaction system in a 96-well plate:

[0062] Table 3: Reaction System

[0063]

[0064] Table 4: Reaction Conditions

[0065] Step 1 95℃ for 2 minutes 1× Step 2 95℃20s 60℃30s 72℃30s 11× Step 3 72℃ for 3 minutes 1× Step 4 4℃ forever

[0066] C. Mix all sample index PCR products in equal proportions according to amplification efficiency;

[0067] 7) Sample mixing and gel recycling

[0068] A. Prepare a 2% agarose gel, take 50 μL of index PCR mixture, and electrophoresis at 120V for 35 minutes;

[0069] B. Referring to the product DNA Marker B, extract the brighter band area near the size of the target product;

[0070] C. Refer to the TIANGEN Gel Extraction kit instructions for the gel recovery procedure.

[0071] 8) Library quantification and sequencing

[0072] A. The fragment length distribution of the library was verified using an Agilent 2100 Bioanalyzer;

[0073] B. After accurate quantification of the library molar concentration, high-throughput sequencing was finally performed on the Illumina Hiseq or Nova seq platform in 2×150bp paired-end sequencing mode to obtain Fast Q data, and quantitative detection and bioinformatics analysis were performed on each methylation level.

[0074] 3. Experimental Results

[0075] Through literature review and statistical modeling of 58 biomarkers using open bladder cancer databases, the analysis revealed a strong correlation between the methylation level of these 58 biomarkers and the occurrence of bladder cancer. For example... Figure 1 As shown, Figure 1A heatmap analysis of 58 markers in 20 bladder cancer tissue samples was conducted. The methylation results were further screened based on the P-value (P < 0.05) to obtain 31 markers. The combination of these 31 markers was used to determine the occurrence of individual bladder cancer. The above experimental method was used to detect the above methylation sites in cancer tissue (10 cases) and adjacent normal tissue (10 cases) samples from a confirmed bladder cancer population. It was found that these methylation sites had a high degree of methylation in the DNA of bladder cancer tissues. The degree of methylation was significantly different between cancer and non-cancer tissues, indicating that the methylation degree of these marker methylation sites can sensitively and specifically reflect the occurrence of bladder cancer.

[0076] The methylation sites of 31 markers in 57 urinary sediment samples (39 clinically diagnosed with bladder cancer and 18 from the general population) were detected using the above experimental method. Lasso analysis further yielded six markers: OTX2_28, PTPRN2_16, cg05091238_46, cg11536474_41, cg19763461_39, and cg25092838_2nd_55. The forward and reverse primers for these six markers are as follows: OTX2_28 forward primer...

[0077] GTAGTTTYGTAGTTTYGTAGGTTTGG, OTX2_28 reverse primer CRAAAACACAACAACTAATAAATAAACTTC; PTPRN2_16 forward primer GTTTTAGTTTGTTAAGTAGTTGAGATTATAGG, PTPRN2_16 reverse primer CRATAACTCATACCTATAATCCCAACAC; cg05091238_46 forward primer GGGGAAGGAAGTTATTTTATTTTATGTT, cg05091238_46 reverse primer ATCACTCTCTCRAATATACCAACTTAAAAA; cg11536474_4 Forward primer 1: GGAAAGATGGTTTGTTGGTGTG, cg11536474_41; Reverse primer: TCCRTATAAAACCTAAAAACACACTATAAAAC; Forward primer 19763461_39: ATGTTGTATTTTTAYGGATTTTGTTTTG, cg19763461_39; Reverse primer: CTACCCTACCCTCTTCACATCTTCTC; Forward primer 25092838_2nd_55: AGGGGGTGTAGAGGGTAGAGAGTT, cg25092838_2nd_55; Reverse primer: AACRTATAAACCCAAATTTCATTAATCT. The corresponding methylation site sequences are shown in Table 5, and the specific chromosomal locations of the six markers are shown in Table 6.

[0078] Table 5: Methylation site sequences of the six markers

[0079]

[0080] Experiments revealed that the methylation sites of the aforementioned six markers exhibited high methylation levels in the urinary DNA of bladder cancer patients. The methylation levels differed significantly between the two population groups, indicating that the selected combination of methylation sites of these markers generated a high signal associated with bladder cancer in urinary DNA, demonstrating superior sensitivity for bladder cancer detection. Furthermore, using urine as a test sample is a non-invasive method, significantly reducing the burden on patients and increasing their compliance with testing.

[0081] Table 6: Chromosomal locations of the six markers

[0082] OTX2_28 39 chr14:56808033 PTPRN2_16 49 chr7:157347016 cg05091238_46 108 chr3:158095820 cg11536474_41 115 chr2:63058856 cg19763461_39 105 chr2:63057423 cg25092838_2nd_55 78 chr14:56812397

[0083] ROC curves were plotted for the average methylation rates of six markers at their respective methylation sites in 57 urinary sediment samples across two population groups, and AUC values ​​were calculated based on the ROC curves. Table 7 shows the characteristic parameters of the six markers. Simultaneously, logistic regression was performed on the methylation rates of the six marker methylation sites. Based on the fitted equations, a bladder cancer risk score and a threshold for bladder cancer incidence were calculated for each sample. The samples were then divided into bladder cancer-positive and negative groups by comparing their scores with the thresholds. The grouping based on the methylation level model was compared with the clinical pathology of the samples to obtain the ROC curves used to determine the diagnostic performance of the methylation level model, as shown in Table 7. Figure 2 As shown, the AUC, sensitivity, and specificity were obtained from the ROC curves: 0.87, 0.83, and 0.88. Figure 3 As shown in the box plot, the difference scores of bladder cancer samples and non-cancer samples are significantly different, and the model can effectively distinguish between the two types of samples.

[0084] Table 7: Characteristic parameters of the six markers

[0085] OTX2_28 OTX2 23.215 18.4016 0.816 PTPRN2_16 PTPRN2 -83.741 49.6248 0.764 cg05091238_46 SHOX2 20.001 19.2388 0.737 cg11536474_41 OTX1 6.793 22.6545 0.528 cg19763461_39 OTX1 -2.140 22.1395 0.816 cg25092838_2nd_55 OTX2 0.090 7.2923 0.711

[0086] Example

[0087] This invention also provides a kit for detecting DNA methylation biomarker compositions for bladder cancer. The kit includes reagents for detecting the methylation level of the aforementioned DNA methylation biomarker compositions, and further includes any one of nucleic acid extraction reagents, methylation conversion reagents, PCR reaction reagents, and sequencing reagents. The kit can be used to detect DNA methylation levels in tissue samples, urine sediment samples, urine samples, and urine exfoliated cell samples, and can employ PCR amplification, quantitative real-time PCR, methylation microarray method, digital PCR, bisulfite sequencing, and methylation-specific microarray method. The specific detection procedure is as follows: Figure 4 As shown, genomic DNA quality was first assessed. Primers were designed for methylation sites, and the single-point primer / multiplex PCR system was optimized. Samples were subjected to panel-based multiplex PCR, and multiple panels of the same sample were mixed to construct a library. Specific tags were added to each sample. Different samples were then mixed, and the library was purified and recovered via agarose gel. Library quality control and quantification were performed, and finally, the samples were pooled and sequenced. Analysis of the obtained methylation data revealed that, compared to normal tissue, a higher methylation level of the DNA methylation biomarker composition of six markers (OTX2_28, PTPRN2_16, cg05091238_46, cg11536474_41, cg19763461_39, and cg25092838_2nd_55) suggested the presence of bladder cancer.

[0088] This invention provides a DNA methylation biomarker composition for bladder cancer detection, comprising six markers: OTX2_28, PTPRN2_16, cg05091238_46, cg11536474_41, cg19763461_39, and cg25092838_2nd_55. Using this DNA methylation biomarker composition to predict bladder cancer occurrence, the AUC obtained from the ROC curve is 0.87, clearly distinguishing between bladder cancer and non-cancerous conditions. By detecting the methylation level of the six marker methylation sites, the risk of bladder cancer can be determined. Based on these six markers, a kit for bladder cancer detection can be prepared, which can simultaneously detect the methylation level of the six markers, thereby improving the prediction of bladder cancer occurrence.

[0089] Although the present invention has been described in detail through the preferred embodiments above, it should be understood that the above description should not be considered as a limitation of the present invention. Various modifications and substitutions to the present invention will be apparent to those skilled in the art after reading the above. Therefore, the scope of protection of the present invention should be defined by the appended claims.

Claims

1. A combination of DNA methylation biomarkers for bladder cancer detection, characterized in that, The DNA methylation biomarker combination comprises the SEQ ID NO.1 sequence of OTX2_28, the SEQ ID NO.2 sequence of PTPRN2_16, the SEQ ID NO.3 sequence of cg05091238_46, the SEQ ID NO.4 sequence of cg11536474_41, the SEQ ID NO.5 sequence of cg19763461_39, and the SEQ ID NO.6 sequence of cg25092838_2nd_55.

2. The use of the DNA methylation biomarker combination as described in claim 1 in the preparation of a kit for detecting bladder cancer.

Citation Information

Patent Citations

  • Auxiliary diagnose method, reagent kit and system of bladder cancer through union of drive gene point mutation and methylation, and application

    CN110628910A

  • Detecting the presence or absence of multiple types of cancer

    US20220243278A1