A nerve necrosis virus grouper oral vaccine and a preparation method thereof

Abstract

The application discloses a nerve necrosis virus goliath grouper oral vaccine and a preparation method thereof. The amino acid sequence of the antigen of the nerve necrosis virus goliath grouper oral vaccine is shown as SEQ ID No: 1. The preparation method comprises the following steps: 1) construction of a recombinant plasmid: a fusion gene with a nucleotide sequence shown as SEQ ID No: 1 is synthesized, the fusion gene is inserted into an expression vector to obtain a recombinant vector, the recombinant vector is transformed into a prokaryotic expression bacterium, and the prokaryotic expression bacterium is cultured to select a successfully transformed prokaryotic expression bacterium; 2) the successfully transformed prokaryotic expression bacterium is induced to express; and 3) the induced prokaryotic expression bacterium is used to feed halocyprid larvae, and halocyprid larvae enriched and wrapped with the prokaryotic expression bacterium are obtained to obtain a nerve necrosis virus infection goliath grouper medicine. The nerve necrosis virus goliath grouper oral vaccine has high protection rate and an immune protection efficiency of 100% for goliath groupers. The application can be applied to the prevention and control of nerve necrosis virus diseases in the goliath grouper breeding process.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of molecular biology and immunology, and particularly relates to a nervous necrosis virus grouper oral vaccine and a preparation method thereof. BACKGROUND

[0002] Grouper is a general term for fish of the subfamily Epinephelinae, and its meat is delicious and has the reputation of sea chicken. The artificial breeding of grouper benefited from the success of artificial breeding of grouper in Japan in the 1960s. In the 1980s, the domestic grouper aquaculture industry gradually began to sprout, and Hainan, Guangdong, Fujian, Guangxi and Zhejiang coasts gradually began to breed grouper. At present, there are many varieties of grouper cultured in China, among which E. coiodes, E. akaara and the like are dominant. By 2016, the annual output of artificial breeding of grouper has broken through 100,000 tons. However, there are still many problems in the grouper aquaculture industry, such as low survival rate of seedlings, low coverage of good strains, lack of refinement of feed, and disease problems at each stage of grouper breeding.

[0003] Nervous necrosis virus (NNV) belongs to Nodaviridae and Betanodavirus. The harm of nervous necrosis virus to grouper fry is extremely serious. An important feature of the disease induced by the virus is that the swim bladder of the diseased fish is swollen and spirals or rotates on the water surface. Fish fry infected with NNV will have poor appetite and body color will turn black, and the situation of spinning or spiraling on the water surface will appear, and within a week, the mortality rate of fry can be as high as 100%. Due to its high infectivity and great harm to aquaculture, the disease has been listed by the International Animal Health Organization (OIE) as one of the important fish diseases. Therefore, how to prevent and treat nervous necrosis virus disease has become an important problem that needs to be solved in the current grouper aquaculture industry.

[0004] Regarding the immunity and prevention of NNV, the use of vaccines and effective drugs is an important means of prevention and treatment. At present, there have been successful reports of inactivated vaccines against fish nervous necrosis virus, such as immunizing parent fish, and indeed detecting the presence of virus antibodies in fertilized eggs; in the immunization experiment of E. akaara, an immune effect of 67% was achieved. Of course, NNV oral vaccine also has a good protection rate, and some studies have expressed NNV coat protein in tobacco chloroplasts and used it as an oral vaccine to induce immunity in fish, and fish immunized by oral vaccine were partially protected.

[0005] The research and application of oral vaccines for fish mainly aims at enhancing the immunization effect by designing to bypass the enzymolysis of the main bioactive substances and directly absorb the hindgut. Oral vaccines not only effectively avoid the stress reaction caused by injection, but also reduce the injection and labor costs, and have popularization significance in aquaculture production. Although some achievements have been made in the research of oral vaccines for fish, a series of problems have not been completely solved, such as how to better maintain the antigenicity of the vaccine, the specific mechanism of oral immunization, how to establish an effective oral delivery system, etc.

[0006] The effect of oral immunization is affected by the absorption of the gastrointestinal mucosa system and the antigen presentation efficiency of antigen presenting cells. Generally, it is believed that the effect of oral immunization is not as good as anal perfusion, because the antigen is digested in the stomach and the anterior intestinal tract, and there is not enough antigen to reach the hindgut. Therefore, researchers have used new technologies and methods to protect the vaccine from the destruction of gastric acid and various digestive enzymes, and to enable the slow and sustained release of antigenic substances, so as to achieve better immunization effect. At present, the sources of oral vaccines mainly include slow-release microcapsules, engineered microorganisms, transgenic plants and transgenic animals.

[0007] Although there are some progress in the oral vaccine of NNV, there is still a lack of vaccines and drugs that can be put into production and are effective. SUMMARY

[0008] The purpose of the present application is to provide a simple and convenient, low-cost, high-stability, convenient-to-store, and high-immunoprotection-efficiency nerve necrosis virus grouper oral vaccine and a preparation method thereof.

[0009] The first purpose of the present application is to provide a nerve necrosis virus grouper oral vaccine, wherein the coding nucleotide sequence of the antigen protein of the nerve necrosis virus grouper oral vaccine is shown in SEQ ID No: 1.

[0010] The coding gene of the antigen of the nerve necrosis virus grouper oral vaccine in the present application contains a coat protein (CP) gene of a red-spotted grouper nervous necrosis virus (RGNNV) and a grouper beta-defensin protein (DEFB) gene, and the coat protein gene and the grouper beta-defensin protein gene are connected through a flexible linker protein (Linker), so as to obtain the coding gene of the antigen of the nerve necrosis virus grouper oral vaccine of the present application.

[0011] The second purpose of the present application is to provide a recombinant expression vector, characterized in that it comprises the nucleotide sequence shown in SEQ ID NO. 1.

[0012] The third purpose of the present application is to provide a recombinant bacterium, characterized in that it comprises the above-mentioned recombinant expression vector.

[0013] A fourth object of the present application is to provide an Artemia, characterized in that it contains the recombinant bacteria described above. The present application uses Artemia to enrich and coat the oral vaccine described above, which can be mass-produced, and the Artemia can protect the vaccine from the destruction of gastric acid and various digestive enzymes, while enabling the slow and sustained release of antigenic substances, so as to achieve better immunization effect.

[0014] A fifth object of the present application is to provide the use of the Artemia described above in the preparation of a nerve necrosis virus goliath fish oral vaccine.

[0015] Preferably, the nerve necrosis virus goliath fish oral vaccine is prepared from the Artemia described above and a pharmaceutically acceptable excipient or carrier.

[0016] Preferably, the nerve necrosis virus goliath fish oral vaccine is a drug for preventing goliath fish infected with a nerve necrosis virus.

[0017] A sixth object of the present application is to provide a method for preparing a drug for goliath fish infected with a nerve necrosis virus, characterized in that it comprises the following steps:

[0018] 1) Construction of a recombinant plasmid: synthesize a fusion gene with the nucleotide sequence shown in SEQ ID No: 1, insert the fusion gene into an expression vector to obtain a recombinant vector, transform the recombinant vector into a prokaryotic expression bacterium, culture, and screen out the prokaryotic expression bacterium successfully transformed;

[0019] 2) Inducing expression of the prokaryotic expression bacterium successfully transformed;

[0020] 3) Feeding the Artemia after hatching with the prokaryotic expression bacterium induced to express, enriching and coating the Artemia with the prokaryotic expression bacterium, and obtaining a nerve necrosis virus goliath fish oral vaccine.

[0021] A seventh object of the present application is to provide the use of a goliath fish defensin protein as a molecular adjuvant in a drug for improving the protective effect of a goliath fish nerve necrosis virus capsid protein as a goliath fish vaccine, wherein the coding nucleotide sequence of the goliath fish nerve necrosis virus capsid protein is shown in SEQ ID NO. 1 1-1014 nucleotides, and the coding nucleotide sequence of the goliath fish defensin protein is shown in SEQ ID NO. 1 1045-1236 nucleotides.

[0022] The present application has the following advantages:

[0023] 1. The nerve necrosis virus goliath fish oral vaccine of the present application has high stability and is not easily degraded.

[0024] 2. The use of Artemia to enrich and coat the oral vaccine has low cost, safe product, no toxicity, no pollution, no spread, can be mass-produced, and is convenient to store.

[0025] 3. The nerve necrosis virus grouper oral vaccine of the present application has high protection rate and the immune protection efficiency for the grouper reaches 100%. BRIEF DESCRIPTION OF DRAWINGS

[0026] Figure 1 A in the figure shows the pGEX-4T-1-CP-DEFB plasmid mode chart; B shows the amino acid sequence of CP-DEFB; C shows the SDS PAGE results of the induced expression products of each group; D shows the western blotting results of the induced expression products of each group. Note: Control. Induced pGEX-4T-1 empty prokaryotic expression bacteria; CP. Induced pGEX-4T-1-CP prokaryotic expression bacteria; CP-DEFB. Induced pGEX-4T-1-CP-DEFB prokaryotic expression bacteria.

[0027] Figure 2 A in the figure shows the survival rate of the grouper in each experimental group after injection of RGNNV; Figure 2 B in the figure shows the CP antibody titer in the serum of each experimental group at 14 and 28 days after immunization; Figure 2 C in the figure shows the relative expression amount of CP or RdRp of RGNNV in the tissue of each experimental group after injection of RGNNV at the qPCR level. Note: Control. Artemia group fed with pGEX-4T-1 bacteria enrichment; CP. Artemia group fed with pGEX-4T-1-CP bacteria enrichment; Artemia group fed with pGEX-4T-1-CP-DEFB bacteria enrichment. DETAILED DESCRIPTION

[0028] The present application will be further described below in conjunction with examples. The examples are intended to exemplarily describe the present application, but not to limit the present application in any form.

[0029] In the present application, the conventional experimental methods and experimental materials involved in the examples are as follows:

[0030] 1. Experimental fish: The 23-day-old pearl grouper juveniles used for the test were obtained from the Chexi Biotechnology Co., Ltd. in Maoming Binhe New Area.

[0031] 2. Experimental artemia: Artemia eggs were provided by an artemia breeding farm in Haikou, Hainan. Before use, part of the artemia eggs were taken to extract tissue RNA, reverse transcribed into cDNA, and PCR detected for virus carrying to confirm that the artemia eggs were healthy and non-toxic.

[0032] 3. Prokaryotic expression bacteria: Escherichia coli BL21 is a product of Novagen Company.

[0033] 4. Brine water: sea salt and deionized water were mixed to prepare 15‰ brine water, and NaHCO3 was added to adjust the pH value.

[0034] 5. Experimental reagents: IPTG was purchased from Sigma Company, and was prepared to 1M concentration, and was stored at -20℃ for standby; Leibovitz's L-15 medium was purchased from Sigma Company; trypsin (AmRESCO, 0458); FBS was purchased from GIBCO Company; the antibody of CP was prepared by the laboratory, and was used at a concentration of 1:3000; cell culture solution: 10% FBS Leibovitz's L-15 medium, stored at 4℃ for standby; LB medium: 10g tryptone, 5g yeast extract, 10g sodium chloride (20g agar powder was added when preparing plates), dissolved in ddH2O, 1mol / L NaOH was used to adjust the pH value to 7.4, and the volume was made to 1000mL, and was sterilized by steam at 120℃ under high pressure for 20min, and was stored at 4℃ for standby. TBST: TrisHCl (1M, pH7.5): 50mL, NaCl: 8g, KCl: 0.2g, Tween: 0.5ml, and distilled water was added to 1L.

[0035] 7. Total RNA extraction: SV Total RNA Isolation Kit (Promega) was used to extract cell RNA, and the RNA extraction was operated according to the operation manual.

[0036] 8. Real-time fluorescence quantitative PCR (qRT-PCR) experiment: 2×SYBR Green Real-time PCR Mix kit (TOYOBO, Japan) was used to prepare the reaction system.

[0037] 9. Serum antibody titer: enzyme-linked immunosorbent assay (ELISA) was used to detect the titer, and the purified CP antigen and the primary antibody of CP (1:2000) were prepared by the laboratory, the secondary antibody (Abeam, USA), 96-well microtiter plate (BIOFIL, Guangzhou, China) and colorimetric substrate TMB (Tiangen, Beijing, China) were purchased from the corresponding manufacturers. According to the operation manual, the results were read by a multifunctional enzyme marker (Thermo, USA).

[0038] 10. SDS-PAGE analysis and Western blotting: the protein gel was prepared by Kedao Biological Company kit, and the experimental operation was performed according to the operation manual of SDS-PAGE and Western blotting. Finally, the gel photograph was taken by Tanon 5200 (Shanghai, China).

[0039] Example 1: Preparation of the oral vaccine of the nervous necrosis virus of Epinephelus coioides

[0040] 1) Construction of recombinant plasmid

[0041] Construction of plasmid pGEX-4T-1-CP-DEFB: According to the coat protein (CP) of the nervous necrosis virus of Epinephelus coioides (nucleotides 1-1014 in SEQ ID NO. 1) and the defensin protein (DEFB) of the nervous necrosis virus of Epinephelus coioides (nucleotides 1045-1236 in SEQ ID NO. 1) obtained from the NCBI query, the two protein sequences were connected with a flexible linker (Gly4Ser)3. Figure 1 A). The designed gene sequence of the fusion protein (CP-DEFB fusion protein) (SEQ ID NO: 1, the amino acid sequence encoded by which is shown in Figure 1 B) was submitted to GenScript for full gene synthesis and insertion into plasmid pGEX-4T-1 to obtain pGEX-4T-1-CP-DEFB. At the same time, the coat protein (CP) gene of the nervous necrosis virus of Epinephelus coioides was also inserted into plasmid pGEX-4T-1 to obtain pGEX-4T-1-CP. After the constructed plasmids pGEX-4T-1-CP-DEFB and pGEX-4T-1-CP, as well as empty pGEX-4T-1 were transformed into Escherichia coli BL21 (DE3), they were cultured on LB solid medium containing ampicillin, and the successfully transformed strains were screened by subsequent bacterial liquid PCR and sequencing.

[0042] The composition of the LB liquid medium was as follows: 10 g / L of proteose peptone, 5 g / L of yeast powder, and 10 g / L of sodium chloride.

[0043] SEQ ID NO. 1 (CP- Linker -Defensin)

[0044] GGTGGAGGCGGTTCAGGCGGAGGTGGCTCT ATGAAGGGACTGAGCTTGGTTCTCCTCGTGCTTCTCCTGATGCTCACCGTCGGGGAGGGCAATGATCCAGAAATGCAGTATTGGACATGTGGGTATAGAGGACTCTGCAGACGGTTCTGCCATGCCCAGGAGTACATCGTTGGTCATCACGGTTGCCCTCGGAGATACAGATGCTGTGCTGTGCGGTCTTAG

[0045] 2) Induction expression of protein

[0046] The successfully transformed pGEX-4T-1, pGEX-4T-1-CP, pGEX-4T-1-CP-DEFB strains were added to LB liquid medium containing 50 μg / ml ampicillin for overnight culture; the overnight culture was added to fresh LB liquid medium, and cultured at 37°C until OD 600 was 0.6, IPTG was added to a final concentration of 1.0 mM, and the culture was continued at 37°C for 6 h. After centrifugation, PBS buffer was added to the bacterial solution, and the bacterial cells were broken by ultrasonic wave for 1-2 min. The bacterial cell solution was centrifuged (5000 g, 4°C, 10 min), and then the supernatant and the precipitate were separated, and subjected to SDS-PAGE analysis and western blotting detection Figure 1 B, C, D).

[0047] 3) Exploration of protein induction expression conditions: set IPTG concentration: 0.25, 0.5, 1.0, 1.5 units: mM; set two induction temperatures: 16°C, 37°C; shake the bacteria to OD 600 0.6, and then add IPTG of different concentrations to the bacteria in logarithmic growth phase, and induce at 16°C and 37°C overnight. Subsequently, ultrasonic wave was used to break the bacteria, and SDS-PAGE was performed, followed by Coomassie brilliant blue staining and decolorization. The induction expression effect was best at 1.0 mM.

[0048] 4) Preparation of subunit oral vaccine of nervous necrosis virus (using Artemia to enrich and encapsulate vaccine proteins):

[0049] Hatching and breeding of Artemia: Artemia eggs were placed in a 1000 mL triangular glass flask; hatching conditions: 15‰ concentration of seawater at 28°C, sunlight lamp irradiation, real-time oxygenation; hatching time: 20-24 h.

[0050] Treatment of the prokaryotic expression bacteria of the fusion protein before feeding: shake the prokaryotic expression bacteria of the fusion protein to OD 600After reaching 0.6, 37℃ 1.0mM IPTG was used to induce expression for 6h, the bacteria was centrifuged, the supernatant was discarded, and the bacteria was washed with PBS for 3 times, finally, the bacteria was mixed with PBS to the same concentration, and stored at 4℃ for later use.

[0051] In this example, we induced 3 groups of prokaryotic expression bacteria: group 1: pGEX-4T-1 empty plasmid prokaryotic expression bacteria; group 2: pGEX-4T-1-CP prokaryotic expression bacteria; group 3: pGEX-4T-1-CP-DEFB fusion protein prokaryotic expression bacteria. Then, the bacteria was prepared according to the above method and stored for later use. Subsequently, the 3 groups of prokaryotic expression bacteria were fed to Artemia haline at 48h after hatching, and Artemia haline was collected after 2h, and then stored at -80℃ for later use.

[0052] Example 2: Immune application of oral vaccine

[0053] The pearl-spotted juvenile fish were divided into 3 groups, 500 fish in each group, and were fed with Artemia haline in groups 1 to 3, respectively. The fish in group 1 were fed with control Artemia haline; the fish in group 2 were fed with Artemia haline enriched with CP protein; and the fish in group 3 were fed with Artemia haline enriched with CP-DP protein. The feeding method was as follows: the total feeding time was 10 days. In the first 5 days, live Artemia haline was mainly fed, and the fish were fed once at the 1st, 3rd and 5th day, respectively. Each time, the fish were fed in excess to ensure that all the fish received the immunization. In the last 5 days, with the growth of the juvenile fish, the Artemia haline was mixed with feed at a mass ratio of 1:10, and then the mixture was sieved and fed to the juvenile fish until all the juvenile fish were full until they stopped eating.

[0054] Twenty-eight days after the last feeding of Artemia haline vaccine, the fish in the three groups were injected intraperitoneally with 100μL RGNNV (half lethal dose of 5.62x10 5 TCID 50 / 0.1mL); within 20 days, the death of the three groups of pearl-spotted fish was observed, the number of survivors in each group was counted (as shown in Figure 2 A), and the relative protection rate of the vaccine was calculated.

[0055] The results showed that the relative protection rate of the neurovirulent virus oral subunit vaccine fused with β-defensin was 100%, and the relative protection rate of the neurovirulent virus oral subunit vaccine with single expression of CP protein was 88.2%. The calculation results of the relative protection rate of the vaccine are shown in Table 1. At the same time, the CP antibody titer level in the serum showed that the CP-DEFB vaccine group was significantly higher than the CP vaccine group (as shown in Figure 2 B); in addition, the fluorescence quantification results showed that the CP-DEFB vaccine group had better inhibition effect on virus replication (as shown in Figure 2 C).

[0056] Table 1

[0057]

Claims

1. A neuronecrosis virus oral vaccine for grouper, characterized in that: The nucleotide sequence encoding the antigen protein of the oral vaccine for grouper with nervous necrosis virus is shown in SEQ ID No:

1.

2. A recombinant expression vector, characterized in that: Contains the nucleotide sequence shown in SEQ ID NO.

1.

3. A recombinant bacterium, characterized in that: Comprising the recombinant expression vector according to claim 2.

4. A Artemia, characterized in that: Contains the recombinant bacteria according to claim 3.

5. Use of the Artemia according to claim 4 in preparing an oral vaccine for grouper against nervous necrosis virus.

6. The use according to claim 5, characterized in that The oral vaccine for grouper with nervous necrosis virus is prepared by comprising the Artemia described in claim 4 and a pharmaceutically acceptable adjuvant or carrier.

7. The use according to claim 5, characterized in that The nervous necrosis virus grouper oral vaccine is a medicine for preventing nervous necrosis virus from infecting grouper.

8. A method for preparing a drug for treating grouper infected with nervous necrosis virus, characterized in that: The steps include: 1) Construction of recombinant plasmid: Synthesize a fusion gene with the nucleotide sequence shown in SEQ ID No: 1, insert the fusion gene into an expression vector to obtain a recombinant vector, transform the recombinant vector into prokaryotic expression bacteria, culture them, and screen for successfully transformed prokaryotic expression bacteria; 2) Induce the expression of the successfully transformed prokaryotic expression bacteria; 3) The induced expression prokaryotic expression bacteria are used to feed the hatched Artemia, and the Artemia containing the prokaryotic expression bacteria are enriched and encapsulated to obtain a drug for the nervous necrosis virus infection of grouper.

9. Use of grouper defensin protein as a molecular adjuvant in the preparation of a drug for improving the protective effect of the capsid protein of red-spotted grouper nervous necrosis virus as a grouper vaccine, wherein the nucleotide sequence encoding the capsid protein of the grouper nervous necrosis virus is shown as nucleotides 1-1014 in SEQ ID NO.1, and the nucleotide sequence encoding the grouper defensin protein is shown as nucleotides 1045-1236 in SEQ ID NO.1.

Images