Higginsia gumbelii pathogenic gene ChTHR1 and application thereof

By inhibiting the expression of the ChTHR1 gene or protein in Bacillus anthracnose from Higgins, the problem of controlling anthracnose in cruciferous vegetables has been solved, providing new drug targets and methods, and reducing the occurrence of the disease and economic losses.

CN116622884BActive Publication Date: 2026-04-24SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310565624.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-05-18
Publication Date
2026-04-24
Estimated Expiration
2043-05-18

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively control anthracnose in cruciferous vegetables caused by Higgins anthracnose, especially in the hot and humid environment of South China, leading to severe economic and quality losses.

Method used

By inhibiting the expression of the ChTHR1 gene or protein in *H. higgins*, drugs against *H. higgins* can be designed or screened to reduce its sporulation, appressorium formation rate, mycelial biomass, UV resistance, and melanin production, thereby preventing and controlling anthracnose.

Benefits of technology

It effectively reduced the pathogenicity of Higgins anthrax, decreased the prevalence and outbreak of anthrax, provided new drug targets for screening control drugs, and reduced crop losses.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116622884B_ABST
    Figure CN116622884B_ABST
Patent Text Reader

Abstract

The application discloses a Higgins anthracnose pathogenic gene ChTHR1 and application thereof. The nucleotide sequence of the ChTHR1 gene is shown as SEQ ID NO:1, and the amino acid sequence of the encoded protein is shown as SEQ ID NO.3. The application determines that the pathogenic gene ChTHR1 has a key role in spore production, the rate of appressorium formation, mycelium biomass, ultraviolet resistance, melanin production and melanin accumulation of Higgins anthracnose, and can be used as a drug target for drug design and screening against Higgins anthracnose. Higgins anthracnose spreads between leaf blades of Brassica parachinensis and other cruciferous vegetables in Guangdong by means of conidia, and the conidia are eliminated or inhibited to prevent the prevalence of plant anthracnose. The ChTHR1 gene is used as a target for drug development, a drug for preventing and treating anthracnose caused by Higgins anthracnose and reducing the pathogenicity of plant Higgins anthracnose is screened, and the effect of the drug is evaluated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial genetic engineering technology, specifically to a pathogenic gene ChTHR1 of Higgins anthrax and its applications. Background Technology

[0002] *Colletotrichum higginsianum* is a semi-vitreous fungus belonging to the kingdom Fungi, phylum Ascomycota, class Sordariomycetes, order Glomerellales, family Glomerellaceae, and genus *Colletotrichum*. *Colletotrichum higginsianum* has a very wide host range, infecting not only the model plant *Arabidopsis thaliana*, but also many cruciferous vegetables, such as Chinese cabbage, bok choy, radish, and kale, causing severe anthracnose disease and significant economic losses. In South my country, the hot and humid environment is ideal for the occurrence and spread of *Colletotrichum higginsianum*, making anthracnose disease in cruciferous vegetables particularly severe. Taking Chinese cabbage, a major cruciferous vegetable in South China, as an example, severe anthracnose outbreaks can directly lead to yield losses of up to 40%, and the indirect economic losses due to quality damage are incalculable. Therefore, more effective control of anthracnose in cruciferous vegetables is urgently needed.

[0003] The infection process of Higgins anthracnose is similar to that of rice blast fungus (Pyricularia oryzae), both requiring appressoriums to penetrate the plant's epidermal cells through strong turgor pressure. In Higgins anthracnose, the turgor pressure of the appressorium is approximately 4 MPa. To maintain this high turgor pressure, the appressorium synthesizes a layer of melanin on its inner cell wall. Melanin-deficient mutants result in the loss of appressorium turgor pressure, thus preventing Higgins anthracnose from infecting host plant cells.

[0004] Fungal melanin is a class of negatively charged, hydrophobic, high-molecular-weight pigments synthesized by the oxidative polymerization of tyrosine or indole compounds. Anthrax fungi and most Ascomycota fungi synthesize DHN-melanin via the polyketide synthase pathway. While melanin is not essential for the growth and development of most fungi, its functions are very diverse. The main role of fungal melanin is to protect fungi from environmental stressors, such as damage mediated by ultraviolet radiation and oxidants, extreme temperatures, hydrolases, heavy metal toxicity, and antimicrobial drugs. In many fungal diseases, fungi influence pathogen-host interactions through melanin synthesis. In Aspergillus fumigatus, melanin is a key structural component of the conidial wall. Furthermore, it is associated with adhesin expression and other virulence factors, playing a crucial role in the early stages of infection.

[0005] Developing antimicrobial drugs targeting melanin shows great promise. On one hand, the melanin synthesis pathway is relatively conserved in plant pathogenic fungi, meaning drugs targeting melanin have broad-spectrum antimicrobial activity. On the other hand, because melanin has little impact on fungal growth and development, it does not directly kill the fungus but only inhibits its infection. Therefore, these drugs cause less disruption to the ecological balance and make it difficult for plant pathogens to develop resistance. More pathogenic genes of *H. higgins* anthracnose need to be identified to evaluate and screen corresponding anti-*H. higgins* anthracnose drugs to reduce crop losses. Summary of the Invention

[0006] The purpose of this invention is to overcome the above-mentioned deficiencies of the prior art and provide a new fungal pathogenicity gene ChTHR1 and its encoded protein that has an important influence on the sporulation, appressorium formation rate, mycelial biomass, UV resistance, melanin production and melanin accumulation of fungi such as Higgins anthrax.

[0007] The first object of the present invention is to provide the use of inhibiting the expression of a gene with a nucleotide sequence as shown in SEQ ID NO: 1 or a protein with an amino acid sequence as shown in SEQ ID NO: 3 in the design or screening of drugs against *Anthracis plantarum*.

[0008] The second objective of this invention is to provide a method for preventing and controlling anthracnose caused by *H. higgins* fungus.

[0009] A third objective of this invention is to provide a method for reducing the pathogenicity of *Hicks anthracnose* in plants.

[0010] A fourth objective of this invention is to provide a reagent for detecting the expression of a gene with a nucleotide sequence as shown in SEQ ID NO: 1 or a protein with an amino acid sequence as shown in SEQ ID NO: 3 in *H. higgins*, and its application in screening drugs for the prevention and control of anthracnose caused by *H. higgins* or evaluating the ability of drugs to reduce the pathogenicity of *H. higgins*.

[0011] The fifth objective of this invention is to provide a method for screening drugs to prevent and treat anthracnose caused by *H. higgins*.

[0012] A sixth objective of this invention is to provide a method for evaluating the ability of a drug to reduce the pathogenicity of *H. chinensis* in plants.

[0013] To achieve the above objectives, the present invention is implemented through the following solution:

[0014] Application of inhibiting the expression of genes with nucleotide sequences as shown in SEQ ID NO: 1 or proteins with amino acid sequences as shown in SEQ ID NO: 3 in the design or screening of drugs against *Anthracis higginense*.

[0015] Specifically, its application in the design or screening of drugs that reduce the pathogenicity of *H. higgins* anthracnose in plants.

[0016] In specific embodiments of the present invention, it is applied in the design or screening of inhibitors for sporulation, appressorium formation rate, mycelial biomass, UV resistance, melanin production, and melanin accumulation of *H. higgins* fungus.

[0017] The present invention also provides a method for preventing and controlling anthracnose caused by *H. higgins*, by inhibiting the expression of genes with nucleotide sequences as shown in SEQ ID NO: 1 or proteins with amino acid sequences as shown in SEQ ID NO: 3 in *H. higgins*.

[0018] In a specific embodiment of the present invention, the method reduces one or more of the following: sporulation rate, appressorium formation rate, mycelial biomass, UV resistance, melanin production, and melanin accumulation of *H. chinensis*.

[0019] The present invention also provides a method for reducing the pathogenicity of *H. higgins* anthracnose in plants by inhibiting the expression of genes with nucleotide sequences as shown in SEQ ID NO: 1 or proteins with amino acid sequences as shown in SEQ ID NO: 3 in *H. higgins* anthracnose.

[0020] In a specific embodiment of the present invention, the method reduces one or more of the following: sporulation rate, appressorium formation rate, mycelial biomass, UV resistance, melanin production, and melanin accumulation of *H. chinensis*.

[0021] The present invention also provides a reagent for detecting the expression of genes with nucleotide sequences as shown in SEQ ID NO: 1 or proteins with amino acid sequences as shown in SEQ ID NO: 3 in *H. higgins*, and its application in screening drugs for the prevention and control of anthracnose caused by *H. higgins* or evaluating the ability of drugs to reduce the pathogenicity of *H. higgins*.

[0022] In a specific embodiment of the present invention, the expression of a gene with a nucleotide sequence as shown in SEQ ID NO: 1 or a protein with an amino acid sequence as shown in SEQ ID NO: 3 in *H. higgins* is inhibited by a drug, thereby reducing one or more of the following: sporulation rate, appressorium formation rate, mycelial biomass, UV resistance, melanin production, and melanin accumulation in *H. higgins*.

[0023] The expression of the gene with the nucleotide sequence shown in SEQ ID NO: 1 or the protein with the amino acid sequence shown in SEQ ID NO: 3 in *H. higgins* was inhibited by the drug, indicating that the drug can be used to prevent and treat anthracnose caused by *H. higgins* or reduce the pathogenicity of *H. higgins*.

[0024] This invention also provides a method for screening drugs to prevent and control anthracnose caused by *H. higgins*, by detecting the nucleotide sequence of the drug-treated *H. higgins* as shown in SEQ ID NO: 1 (gene) or the amino acid sequence of the protein as shown in SEQ ID NO: 3 (protein).

[0025] The drug inhibited the expression of the gene with the nucleotide sequence shown in SEQ ID NO: 1 or the protein with the amino acid sequence shown in SEQ ID NO: 3 of *H. higgins*, indicating that the drug can be used to prevent and control anthracnose caused by *H. higgins*.

[0026] The present invention also provides a method for evaluating the ability of a drug to reduce the pathogenicity of *Anthracnose phytohesii*, by detecting the nucleotide sequence of the drug-treated *Anthracnose phytohesii* as shown in SEQ ID NO: 1, or the protein sequence of the drug as shown in SEQ ID NO: 3.

[0027] The drug inhibited the expression of the gene with the nucleotide sequence shown in SEQ ID NO: 1 or the protein with the amino acid sequence shown in SEQ ID NO: 3 of *H. higgins*, indicating that the drug can be used to reduce the pathogenicity of *H. higgins* in plants.

[0028] Compared with the prior art, the present invention has the following beneficial effects:

[0029] 1. This invention identifies a pathogenic gene, ChTHR1, which plays a key role in the sporulation, appressorium formation rate, mycelial biomass, UV resistance, melanin production, and melanin accumulation of *H. higgins* anthrax. This gene can serve as a drug target for the design and screening of drugs against *H. higgins* anthrax.

[0030] 2. Higgins anthracnose spreads among the leaves of cruciferous vegetables such as Chinese cabbage through conidia. Eliminating or inhibiting conidia production is an effective measure to prevent the spread of anthracnose in plants. The ChTHR1 gene is closely related to the pathogenicity of Higgins anthracnose, participating in the production of its spores and appressoriums. Deletion of ChTHR1 leads to reduced spore production, appressorium formation rate, mycelial biomass, UV resistance, melanin production, and melanin accumulation, thus decreasing pathogenicity and effectively controlling the spread and outbreak of anthracnose in cruciferous vegetables.

[0031] 3. The ChTHR1 gene provides a specific drug target for developing novel drugs against Higgins anthracnose. Using the ChTHR1 gene as a drug target allows for the screening of drugs that control anthracnose caused by Higgins anthracnose and reduce the pathogenicity of Higgins anthracnose in plants, and the evaluation of drug efficacy. Therefore, the pathogenic gene ChTHR1 has broad application prospects in the control of plant fungi and fungal diseases. Attached Figure Description

[0032] Figure 1 This is a schematic diagram of the construction of the ChTHR1 gene knockout vector.

[0033] Figure 2 This is a schematic diagram showing the location and process of ChTHR1 gene knockout.

[0034] Figure 3 To verify the ChTHR1 knockout results for Southern hybridization.

[0035] Figure 4 Colony morphology of wild-type strain (WT), ChTHR1 gene deletion mutants Chthr1Δ-38, Chthr1Δ-48, and Chthr1 complement transformants Chthr1ΔC-7 and Chthr1ΔC-19 after culturing on PDA medium for 7 days.

[0036] Figure 5 This is a schematic diagram of the construction of the ChTHR1 gene complementation vector.

[0037] Figure 6This is a comparison of the growth rates of wild-type strain (WT) and the ChTHR1 gene deletion mutants Chthr1Δ-38, Chthr1Δ-48, and Chthr1 complemented transformants Chthr1ΔC-7 and Chthr1ΔC-19 after 7 days of culture on PDA medium.

[0038] Figure 7 A comparison of conidial formation rates between wild-type strain (WT), ChTHR1 gene deletion mutants Chthr1Δ-38 and Chthr1Δ-48, and ChTHR1 complementation transformants Chthr1ΔC-7 and Chthr1ΔC-19.

[0039] Figure 8 This is a comparison of the appressorium formation rate of wild-type strain (WT) with the ChTHR1 gene deletion mutants Chthr1Δ-38, Chthr1Δ-48 and the ChTHR1 complementation transformants Chthr1ΔC-7, Chthr1ΔC-19.

[0040] Figure 9 This is a comparison of mycelial biomass between the wild-type strain (WT), the ChTHR1 gene deletion mutants Chthr1Δ-38 and Chthr1Δ-48, and the ChThr1 complement transformants Chthr1ΔC-7 and Chthr1ΔC-19. Figure A shows colony morphology, and figure B shows a comparison of colony diameter.

[0041] Figure 10 A comparison of UV resistance between wild-type strain (WT), ChTHR1 gene deletion mutants Chthr1Δ-38 and Chthr1Δ-48, and ChThr1 complement transformants Chthr1ΔC-7 and Chthr1ΔC-19.

[0042] Figure 11 A comparison of melanin production between wild-type strain (WT), ChTHR1 gene deletion mutants Chthr1Δ-38 and Chthr1Δ-48, and ChThr1 complement transformants Chthr1ΔC-7 and Chthr1ΔC-19.

[0043] Figure 12 This figure compares the pathogenicity of wild-type strain (WT) with the ChTHR1 gene deletion mutants Chthr1Δ-38 and Chthr1Δ-48, and the ChThr1 complementation transformants Chthr1ΔC-7 and Chthr1ΔC-19 in the Arabidopsis thaliana variety Col-0. WT represents the wild-type strain, Chthr1Δ-38 and Chthr1Δ-48 are ChTHR1 gene deletion mutants, and Chthr1ΔC-7 and Chthr1ΔC-19 are ChTHR1 gene complementation transformants. H2O is the control solution. Detailed Implementation

[0044] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; the materials and reagents used, unless otherwise specified, are commercially available.

[0045] Example 1: Obtaining ChTHR1 gene deletion mutants and complement mutants

[0046] I. Experimental Methods

[0047] 1. Isolation and cloning of the ChTHR1 gene

[0048] The sequence information (Gene ID: 28867994) was obtained from the NCBI gene database (https: / / www.ncbi.nlm.nih.gov / gene / ). The ChTHR1 gene from *Colletotrichum higginsianum* was retrieved through a homologous sequence search in the Higgins anthrax database (http: / / www.broadinstitute.org / annotation / genome / colletotrichum_group / MultiHome.html). To study the function of this gene, the full sequence of the ChTHR1 gene was cloned from the genome of wild-type strain IMI349063 of *Colletotrichum higginsianum* using primers ChTHR1F and ChTHR1R (Table 1). The full sequence of the ChTHR1 gene was then ligated into the p821 vector and sequenced. Simultaneously, the coding sequence of this gene was cloned from the cDNA of wild-type strain IMI349063 and ligated into the p821 vector for sequencing analysis. The nucleotide sequence of the ChTHR1 gene is shown in SEQ ID NO: 1, the cDNA sequence is shown in SEQ ID NO: 2, and the amino acid sequence of the protein it encodes is shown in SEQ ID NO: 3.

[0049] Table 1 Primer sequence information

[0050] Primer name Sequence (5'-3') ChTHR1F ATGGCGCCCTCAGC ChTHR1R TTATGTGCCGCCACCGG THR1upF ACGACGGCCAGTGCCAAGCTTTTAAGCCAAAAAACGACTTGATAGA THR1upR GACCTGCAGGCATGCAAGCTTAGTTGCTATGAAAAGACTGTGGCG THR1dsF CCGGGTACCGAGCTCGAATTCGTGCGATGATGCCACAAACTC THR1dsR TATGGAGAAAACTCGAGAATTCGACACCGGGAGAGGGGAGG HygF AAGCTTGCATGCCTGCAG HygR GAATTCGAGCTCGGTACCCGGG THR1T1F CGACAGCTTTATTCCAACGTAAGC THR1T1R AGCTTCGATGTAGGAGGGC THR1T2F AGCTTCGATGTAGGAGGGC THR1T2R CCTGTCAAAACTCATGCCCC PTHR1F ACATAGCTTATATCTAGGACAGGCG PTHR1F TGTTACTAAACCTAGCTTGGGAAGG HBTHR1F1F CCGGGTACCGAGCTCGAATTCCCGCCGCCACGGAGGGGC HBTHR1F1R GAAAACTCGAGCTCGAGAATTCCTCTAGCCGAAGGTATGAACCG HBTHR1F2F TCACACCAGATCCGCCTGTGCCGCCACCGGTGACC HBTHR1F2R ACTCTAGATCTAGAGTCGACCGGTGGCGGCGGCATGGTCGCG HBTHR1F3F GGCATCATCGCACTTACTTGTACAGCTCGTCCATGCC HBTHR1F3R CACAGGCGGATCTGGTGTGAGCA HBTHR1F4F CTTGCATGCCTGCAGGTCGACCCGACATCCGGGGAACAC HBTHR1F4R CAAGTAAGTGCGATGATGCCACAAACTC

[0051] 2. Constructing the ChTHR1 gene knockout vector

[0052] (1) Using the genomic DNA of wild-type strain IMI349063 as a template, the upstream and downstream fragments were amplified using the primer pairs THR1upF and THR1upR, and the primer pairs THR1dsF and THR1dsR, as shown in Table 1. The nucleotide sequence of the upstream fragment is shown in SEQ ID NO: 4, and the nucleotide sequence of the downstream fragment is shown in SEQ ID NO: 5.

[0053] The PCR amplification reaction system was as follows: PrimeSTAR Max Premix (2×) 25μL, Forward Primer 1μL, Reverse Primer 1μL, Template (1ng / μL) 1μL, and ddH2O to a final volume of 50μL.

[0054] The PCR amplification program was as follows: 98℃ for 3 min; 98℃ for 10 s, 60℃ for 5 s, 72℃ for 30 s, 35 cycles; 72℃ for 2 min, 4℃ forever.

[0055] (2) After digesting the p821 vector with HindIII, the upstream fragment was ligated into the p821 vector containing the hygromycin gene cassette using seamless cloning technology. The reaction system was: 168 ng of linearized p821 vector, 30 ng of upstream fragment, 4 μL of 5×CE II Buffer, 2 μL of Exnase II, and ddH2O to a final volume of 20 μL. Subsequently, the p821 vector with the upstream fragment ligated was digested with EcoRI, and the downstream fragment was ligated into the vector using the same seamless cloning technology to form the p821-THR1KO knockout vector. The reaction system was: 198 ng of linearized p821 vector with the upstream fragment ligated, 30 ng of downstream fragment, 4 μL of 5×CE II Buffer, 2 μL of Exnase II, and ddH2O to a final volume of 20 μL. The resulting vector comprised the p821-THR1KO vector (nucleotide sequence shown in SEQ ID NO: 6) consisting of the upstream fragment of the ChTHR1 gene, the hygromycin resistance gene, and the downstream fragment of the ChTHR1 gene. The reaction conditions for the above recombinant reaction system were: 37°C, incubation in a PCR instrument for 30 min.

[0056] 3. Obtain the Chthr1Δ gene deletion mutant

[0057] (1) After transforming the p821-THR1KO vector containing the upstream sequence of the ChTHR1 gene—hygromycin resistance gene—ChTHR1 gene downstream sequence into Agrobacterium, the transformant was obtained by transforming it into the wild-type strain IMI349063 of Higgins anthrax via Agrobacterium-mediated transformation.

[0058] (2) During gene replacement, most of the exogenous DNA is inserted into the genome of *Hicksian anthrax*. Due to the presence of homologous sequences at both ends, some homologous recombination occurs, thus requiring the knockout of genes involved in homologous recombination. The location and process of gene knockout for homologous recombination are as follows: Figure 1 and Figure 2 As shown.

[0059] ① Select the transformants that grow in the experiment, extract the genomic DNA of all transformants, and use them as templates to perform PCR using the primer pairs HygF and HygR, ChTHR1F and ChTHR1R, THR1T1F and THR1T1R, and THR1T2F and THR1T2R in Table 1.

[0060] Positive transformants could be amplified to a 1474 bp band of hygromycin plus its promoter using the HygF and HygR primer pairs (nucleotide sequence shown in SEQ ID NO: 7), but could not be amplified to a 925 bp band of the ChTHR1 gene using the ChTHR1F and ChTHR1R primer pairs (nucleotide sequence shown in SEQ ID NO: 1). Conversely, the wild-type strain of *H. higgins* anthrax could amplify the ChTHR1 gene band, but could not amplify the hygromycin plus its promoter band.

[0061] ② Using primer pairs THR1T1F and THR1T1R, and primer pairs THR1T2F and THR1T2R, amplification was performed using these two primer pairs. Positive transformants could all be amplified to a 2500bp band (nucleotide sequences are shown in SEQ ID NO: 8 and SEQ ID NO: 9, respectively), while the wild-type strain of *H. higgins* could not be amplified to a 2500bp band. It was preliminarily determined that these transformants with the target band (2500bp) were gene substitution mutants (the ChTHR1 gene was replaced by a hygromycin resistance gene and its promoter, Chthr1Δ).

[0062] ③ Select the two mutants (positive transformants, Chthr1Δ-38 and Chthr1Δ-48) verified in step ②, extract their genomic DNA, and perform Southern hybridization verification. Southern hybridization was performed using the Roche Digoxigenin DNA Labeling and Detection Kit (DIG-High Prime DNA Labeling and Detection KitⅠ).

[0063] The genomes of the two mutants were digested with Acc65Ⅰ. Using wild-type strain IMI349063 as a control, hybridization probes were synthesized by PCR amplification using primer pairs PTHR1F and PTHR1R from Table 1. The probe synthesis system consisted of: p821-THR1KO 10 ng, Phanta Max Super-Fidelity DNA Polymerase 1 μL, 2×Phanta Max Buffer 25 μL, PCR DIG Labeling Mix 1 μL, primers PTHR1F and PTHR1R from Table 1 2 μL, 5×CEII Buffer 4 μL, Exnase II 2 μL, and ddH2O to a final volume of 20 μL. The reaction program was: 95℃ for 3 s; 95℃ for 15 s, 60℃ for 15 s, 72℃ for 30 s, 35 cycles; 72℃ for 1 min; 4℃ forever.

[0064] 4. Reinstatement and restoration of the Chthr1Δ gene deletion mutant

[0065] (1) In order to verify that the mutant phenotype was caused by the deletion of the ChTHR1 gene, the complementation vector pSFZY002-HBTHR1 was constructed.

[0066] The upstream 2000–1000 bp fragment of the ChTHR1 gene was amplified using primer pairs HBTHR1F1F and HBTHR1F1R in Table 1 (nucleotide sequence shown in SEQ ID NO: 10). The ChTHR1 gene and its upstream 1000 bp promoter sequence were amplified using primer pairs HBTHR1F2F and HBTHR1F2R in Table 1 (nucleotide sequence shown in SEQ ID NO: 11). The 720 bp fragment of the mCherry gene was amplified using primer pairs HBTHR1F3F and HBTHR1F3R in Table 1 (nucleotide sequence shown in SEQ ID NO: 12). The downstream 1000 bp fragment of the ChTHR1 gene was amplified using primer pairs HBTHR1F4F and HBTHR1F4R in Table 1 (nucleotide sequence shown in SEQ ID NO: 13).

[0067] (2) The upstream 2000-1000 bp fragment of the ChTHR1 gene obtained in step (1) was seamlessly cloned into the EcoRI site of the pSFZY002 vector. The ChTHR1 gene and its upstream 1000 bp promoter sequence, the 720 bp fragment of the mCherry gene, and the downstream 1000 bp fragment of the ChTHR1 gene obtained in step (1) were sequentially seamlessly cloned into the SalI site of the pSFZY002 vector to obtain the complementation vector pSFZY002-HBTHR1 (nucleotide sequence as shown in SEQ ID NO: 14; see schematic diagram of gene complementation vector construction). Figure 3 After transforming the complement vector pSFZY002-HBTHR1 into Agrobacterium tumefaciens, the Higgins anthrax mutant Chthr1Δ-38 was transformed using the Agrobacterium tumefaciens-mediated transformation (ATMT) method to obtain complement strains Chthr1ΔC-7 and Chthr1ΔC-19.

[0068] II. Experimental Results

[0069] Southern hybridization validation results are as follows: Figure 4 As shown, a 5749bp band was detected in the wild-type strain (WT), while a 3445bp band was detected in the transformants (Chthr1Δ-38, Chthr1Δ-48) with the ChTHR1 gene knocked out, indicating that the ChTHR1 gene in Chthr1Δ has been knocked out and the inserted hygromycin-containing fragment is a single copy.

[0070] Example 2: Phenotypic changes in ChTHR1 gene deletion mutants

[0071] I. Experimental Methods

[0072] The complemented strains Chthr1ΔC-7 and Chthr1ΔC-19 constructed in Example 1 (Chthr1ΔC was obtained by complementing the Chthr1Δ-38 deletion mutant in Example 1, where C represents recovery or supplementation) were selected, and the changes in gene recovery phenotypes were compared using the following methods:

[0073] 1. The Higgins anthrax bacteria to be tested were inoculated into PDA medium and cultured for 7 days. The colony diameter was measured and the changes in colony growth rate were compared.

[0074] 2. The Higgins anthrax bacteria to be tested were inoculated into PDA medium and cultured for 7 days. Three mycelial blocks were then punched using a 0.5 cm diameter punch and placed in PDB liquid medium for shaking incubation for 6 days. The bacterial suspension was filtered, and the number of spores was counted (in units of 10⁻⁶).5 1 spore / bottle, compare the changes in sporulation rate and appressorium formation rate of the strain.

[0075] 3. Take the bacterial solution from step 2 and dilute it to 10. 6 The spores were counted at 1 spore / ml to obtain a spore suspension. 100 μL of the spore suspension was inoculated into PDB liquid medium and cultured for 5 days. The mycelium was then filtered, dried, and weighed to compare the changes in mycelial biomass.

[0076] 4. The Higgins anthrax bacteria to be tested were inoculated into PDA medium and cultured for 3 days. After being irradiated with ultraviolet light for 5 hours, they were cultured for another 4 days. The colony diameter was measured to compare their resistance to ultraviolet light.

[0077] 5. The Higgins anthrax bacteria to be tested were inoculated into PDA medium and cultured for 7 days. Three mycelial blocks were punched with a 0.5 cm diameter punch and placed in PDB liquid medium for shaking culture for 10 days. The mycelia were filtered out, dried and the intracellular melanin of the mycelia was extracted and the melanin production was compared.

[0078] II. Experimental Results

[0079] The phenotypic change of Chthr1Δ was caused by the deletion of the ChTHR1 gene. Since the difference between the Chthr1Δ deletion mutant and the wild type is very large, the phenotype of the deletion mutant was restored after the ChTHR1 gene was added back, and the phenotype was the same as that of the wild type strain IMI349063.

[0080] like Figure 5 As shown, compared with WT, the ChTHR1 gene deletion mutants Chthr1Δ-38 and Chthr1Δ-48 showed reduced melanin accumulation and lighter colony color on PDA medium, while the melanin accumulation of the supplementary strains Chthr1ΔC-7 and Chthr1ΔC-19 was restored.

[0081] like Figure 6 As shown, after 7 days of growth on PDA medium, there was no significant difference in mycelial growth rate between wild-type strain WT and Chthr1Δ-38, Chthr1Δ-48, Chthr1ΔC-7, and Chthr1ΔC-19.

[0082] like Figure 7 The sporulation of Chthr1Δ-38 and Chthr1Δ-48 was significantly reduced, while Chthr1ΔC-7 and Chthr1ΔC-19 recovered to the same sporulation level as the wild-type strain WT.

[0083] like Figure 8As shown, the appressorium formation rate of Chthr1Δ-38 and Chthr1Δ-48 was significantly reduced, while the appressorium formation rate of Chthr1ΔC-7 and Chthr1ΔC-19 was significantly increased.

[0084] like Figure 9 As shown, the mycelial biomass of Chthr1Δ-38 and Chthr1Δ-48 was significantly reduced, while Chthr1ΔC-7 and Chthr1ΔC-19 recovered to the same mycelial biomass level as the wild-type strain WT.

[0085] like Figure 10 China A and Figure 10 As shown in Figure B, the UV resistance of Chthr1Δ-38 and Chthr1Δ-48 was significantly reduced, while Chthr1ΔC-7 and Chthr1ΔC-19 recovered to the same level as the wild-type strain WT.

[0086] like Figure 11 As shown, the melanin production of Chthr1Δ-38 and Chthr1Δ-48 was significantly reduced, while Chthr1ΔC-7 and Chthr1ΔC-19 recovered to the same melanin production level as the wild-type strain WT.

[0087] The above results indicate that the melanin accumulation, sporulation, appressorium formation rate, mycelial biomass, UV resistance, and melanin production of the ChTHR1 gene deletion mutant in PDA medium were all inferior to or lower than those of the wild-type strain WT. After the ChTHR1 gene was reintroduced, the reintroduced strain was able to restore the mutant's missing phenotype, which was the same as that of the wild-type IMI349063.

[0088] Example 3: Pathogenicity determination of ChTHR1 gene deletion mutants and complement transformants

[0089] I. Experimental Methods

[0090] The conidia of the wild-type strain WT, the ChTHR1 gene deletion mutants (Chthr1Δ-38, Chthr1Δ-48), and the complement transformants (Chthr1ΔC-7, Chthr1ΔC-19) from Example 1 were diluted to 5 × 10⁻⁶. 6 The spore suspension of the strain was sprayed onto live Arabidopsis plants using a spray inoculation method. Three Arabidopsis plants were sprayed with each strain. After the upper and lower surfaces of the Arabidopsis leaves were completely sprayed, the plants were placed in plastic basins and covered with a layer of plastic wrap. They were then incubated in an incubator at 25°C with a light condition of 16 hours of light followed by 8 hours of darkness. After 4 days of incubation, the disease status of the live Arabidopsis plants was observed, photographed, and the disease index of the plants was evaluated.

[0091] II. Experimental Results

[0092] Pathogenicity test results are shown in Figure 12 The results showed that plants inoculated with the ChTHR1 gene deletion mutants Chthr1Δ-38 and Chthr1Δ-48 had reduced disease incidence, while the wild-type strain WT and the ChTHR1 complement transformants Chthr1ΔC-7 and Chthr1ΔC-19 were able to infect normally. This indicates that the ChTHR1 gene is a key pathogenic gene of *Hicks anthracnose*.

[0093] Example 4: Using the expression of the ChTHR1 gene and protein as targets to screen and evaluate drugs against Higgins anthrax.

[0094] Higgins anthrax bacteria were cultured in PDB liquid medium for 10 days. After collecting the hyphae, they were divided into several small portions. The selected compound or candidate drug was added to each portion, and the mixture was cultured in complete medium for several hours. Mycelial RNA or protein was then extracted. Real-time quantitative PCR was used to detect the expression of the ChTHR1 gene, and Western blotting or ELISA was used to detect the expression of the ChTHR1 protein. If ChTHR1 expression was inhibited by the candidate drug, the mycelial cells would show no ChTHR1 gene or protein, or a significant reduction in both. The obtained compound was then used in accordance with the method in Example 3 to determine whether the pathogenicity of wild-type Higgins anthrax bacteria against Arabidopsis thaliana was reduced in the presence of this compound or candidate drug, further confirming the compound's efficacy against Higgins anthrax.

[0095] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description and ideas, and it is neither necessary nor possible to exhaustively describe all implementation methods here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. A method for controlling anthracnose caused by *H. higgins* fungus, characterized in that, The expression of the gene with the nucleotide sequence shown in SEQ ID NO: 6 or the protein with the amino acid sequence shown in SEQ ID NO: 3 in Bacillus anthracis was suppressed using a Chthr1 gene knockout vector containing the nucleotide sequence shown in SEQ ID NO:

1.

2. A method for reducing the pathogenicity of *Hicksian anthracnose* in plants, characterized in that, The expression of the gene with the nucleotide sequence shown in SEQ ID NO: 6 or the protein with the amino acid sequence shown in SEQ ID NO: 3 in Bacillus anthracis was suppressed using a Chthr1 gene knockout vector containing the nucleotide sequence shown in SEQ ID NO:

1.

3. The method according to claim 2, characterized in that, Reduce one or more of the following: sporulation rate, appressorium formation rate, mycelial biomass, UV resistance, melanin production, and melanin accumulation of *H. higgins* anthracnose in plants.

4. A reagent for detecting the expression of genes with nucleotide sequences as shown in SEQ ID NO: 1 or proteins with amino acid sequences as shown in SEQ ID NO: 3 in *H. higgins*, and its application in screening drugs for the prevention and control of anthracnose caused by *H. higgins* or evaluating the ability of drugs to reduce the pathogenicity of *H. higgins*.

5. The application according to claim 4, characterized in that, Assess one or more of the following parameters of *Anthracis higgins*: sporulation rate, appressorium formation rate, mycelial biomass, UV resistance, melanin production, and melanin accumulation.

6. A method for screening drugs to prevent and control anthracnose caused by *H. higgins* fungus, characterized in that, Detect the nucleotide sequence of the drug-treated plant *Anthracis higgins* as shown in SEQ ID NO: 1 (gene) or the amino acid sequence of the protein as shown in SEQ ID NO: 3 (protein).

7. A method for evaluating the ability of a drug to reduce the pathogenicity of *H. higgins* anthracnose in plants, characterized in that, Detect the nucleotide sequence of the drug-treated plant *Anthracis higgins* as shown in SEQ ID NO: 1 (gene) or the amino acid sequence of the protein as shown in SEQ ID NO: 3 (protein).

Citation Information

Patent Citations

  • Fungus pathogenic gene ChAtg8 derived from colletotrichum higginsanum and application thereof

    CN113106106A

  • Application of protein MoUPE3 in regulation and control of pathogenicity of pyricularia grisea

    CN116082473A