Cotton bollworm larva cuticle protein gene lcp17 and application thereof

By silencing the LCP17 epidermal protein gene of cotton bollworm larvae using RNAi technology and combining it with a carbon quantum dot vector, the problems of cotton bollworm resistance and environmental pollution were solved, achieving safe and efficient biological control.

CN116732105BActive Publication Date: 2026-04-24GUIZHOU TOBACCO SCI RES INST
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202310912623.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-07-25
Publication Date
2026-04-24
Estimated Expiration
2043-07-25

AI Technical Summary

Technical Problem

Existing chemical control methods have led to increased resistance in cotton bollworms and severe environmental pollution, highlighting the lack of safe and effective control methods.

Method used

The LCP17 epidermal protein gene of cotton bollworm larvae was silenced using RNAi technology. Carbon quantum dots (CQDs) were used as dsRNA vectors to reduce the expression of the insect gene LCP17 by injecting dsLCP17.

Benefits of technology

It effectively reduces the amount of food consumed by cotton bollworms, delays their development, improves the silencing efficiency of dsRNA, provides a new approach to biological control, and reduces the use of chemical pesticides.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116732105B_ABST
    Figure CN116732105B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of genetic engineering, and particularly relates to a cotton bollworm larva cuticle protein gene LCP17 and application thereof. The application aims to provide a new selection for biological control of insects. The technical scheme of the application is a cotton bollworm larva cuticle protein, the amino acid sequence of which is shown as SEQ ID No. 3. The application further provides the cotton bollworm larva cuticle protein gene LCP17, the nucleotide sequence of which is shown as SEQ ID No. 1 or SEQ ID No. 2. The gene of the application can be used as a target for biological control of insects, and provides a new approach for reducing the use of chemical pesticides and controlling pests without pollution.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the LCP17 gene of cotton bollworm larvae and its application. Background Technology

[0002] The cotton bollworm is a polyphagous pest found worldwide, causing significant damage to crops such as corn, cotton, soybeans, and tobacco, resulting in substantial economic losses (Sivakumar et al., 2007). For many years, mitigating the damage caused by the cotton bollworm has been a serious challenge. Currently, field control of the cotton bollworm mainly relies on chemical control; however, long-term and excessive use of chemical agents has led to increased resistance, greatly increasing the difficulty of control and causing a series of problems such as environmental pollution and excessive pesticide residues. Therefore, there is an urgent need to explore new, safe, and efficient control methods. Among these, RNAi technology shows great potential in the control of pests and in the application of species-specific insecticides.

[0003] RNA interference (RNAi), first discovered in *C. elegans*, has been widely used in pest control. RNAi refers to the phenomenon where double-stranded RNA is recognized by endonucleases and cleaved into small interfering RNA (siRNA), which then binds to homologous sequences, causing the degradation of the mRNA of a specific gene and successfully silencing the target gene. Compared with traditional gene knockout techniques, RNAi technology has advantages such as low investment, short cycle time, and ease of operation, greatly promoting the research of functional genes in non-model insects.

[0004] Carbon quantum dots (CQDs) are nanoparticles with a particle size of less than 10 nm. Due to their good water solubility and extremely low toxicity, they have attracted much attention in recent years. Summary of the Invention

[0005] The purpose of this invention is to provide a new option for biological control of insects.

[0006] The technical solution of the present invention is the application of the epidermal protein of cotton bollworm larvae in regulating insect growth and development, and its amino acid sequence is shown in SEQ ID No. 3.

[0007] Furthermore, the coding sequence of the epidermal protein of the cotton bollworm larva is shown in SEQ ID No. 1 or SEQ ID No. 2.

[0008] The regulation mentioned here is a negative regulation.

[0009] Specifically, the negative regulation is achieved through RNAi technology.

[0010] Specifically, the RNAi technology uses dsLCP17.

[0011] Specifically, the nucleotide sequence of said dsLCP17 is shown in SEQ ID No. 4.

[0012] The nucleotide sequences of the primer pairs for amplifying dsLCP17 are shown in SEQ ID No. 5 and SEQ ID No. 6.

[0013] This invention also provides the application of bollworm larval epidermal protein in insect control, the amino acid sequence of which is shown in SEQ ID No. 3.

[0014] Furthermore, the coding sequence of the epidermal protein of the cotton bollworm larva is shown in SEQ ID No. 1 or SEQ ID No. 2.

[0015] Specifically, the insect in question is the cotton bollworm.

[0016] The present invention also provides a method for controlling insects, the main step of which is to reduce the expression of the insect gene LCP17.

[0017] Furthermore, RNAi technology was used to reduce the expression of the insect gene LCP17.

[0018] Specifically, the RNAi technology uses dsLCP17.

[0019] Specifically, the nucleotide sequence of said dsLCP17 is shown in SEQ ID No. 4.

[0020] The nucleotide sequences of the primer pairs for amplifying dsLCP17 are shown in SEQ ID No. 5 and SEQ ID No. 6.

[0021] Furthermore, dsLCP17 was used to inject insects.

[0022] In particular, the dsLCP17 is supported by nanomaterials.

[0023] Specifically, the nanomaterial is carbon quantum dots (CQDs).

[0024] In this method, dsLCP17 and CQDs were each prepared into a 100 ng / μL solution and then mixed.

[0025] Specifically, the volume ratio of dsLCP17 to CQDs is 11:1.

[0026] Preferably, the final concentration of dsRNA in the mixed solution is 13000 ng / μL.

[0027] Specifically, the insect in question is the cotton bollworm.

[0028] The insect in question is a second-instar larva.

[0029] The present invention also provides a substance for reducing the expression of the LCP17 gene.

[0030] Furthermore, the substance that reduces the expression of gene LCP17 is dsLCP17.

[0031] Specifically, the nucleotide sequence of said dsLCP17 is shown in SEQ ID No. 4.

[0032] The nucleotide sequences of the primer pairs for amplifying dsLCP17 are shown in SEQ ID No. 5 and SEQ ID No. 6.

[0033] The present invention also provides the application of substances that reduce the expression of the LCP17 gene in insect control.

[0034] The beneficial effects of this invention are as follows: This invention cloned the larval epidermal protein gene LCP17 from the cotton bollworm and analyzed its expression pattern. Further research was conducted on the function of this gene, and RNAi technology demonstrated that interfering with its expression reduced larval feeding, leading to stunted development, decreased viability, and death. The gene of this invention can serve as a target for biological control of insects, providing a new approach to reduce the use of chemical pesticides and achieve pollution-free pest control. This invention also introduces nanomaterials (carbon quantum dots) as a carrier for dsRNA, effectively improving the silencing efficiency of dsRNA. Attached Figure Description

[0035] Figure 1 A schematic diagram of the carbon quantum dot structure.

[0036] Figure 2 Electrophoretic detection results of carbon quantum dots (CQDs) bound to dsRNA; Lane 1 is the control band, and the 6 bands are 100bp, 250bp, 500bp, 750bp, 1000bp, and 2000bp respectively; the remaining lanes are electrophoretic bands of CQDs and dsRNA mixed in different proportions.

[0037] Figure 3 The expression pattern of LCP17 gene in different developmental stages of cotton bollworm; the horizontal axis is 1L: 1st instar; 2L: 2nd instar; 3L: 3rd instar; 4L: 4th instar; 5L: 5th instar; 6L: 6th instar; P: pupa; M: male adult; F: female adult; the vertical axis is the relative expression level of LCP17 gene.

[0038] Figure 4 LCP17 gene expression patterns in different tissues of cotton bollworm; FB: fat body; MT: Malpighian tubules; CT: epidermis; MG: midgut; the vertical axis represents the relative expression level of the LCP17 gene.

[0039] Figure 5 The expression level of the LCP17 gene in the cotton bollworm under LCP17 gene silencing; the vertical axis represents the relative expression level of the LCP17 gene.

[0040] Figure 6 The effect of LCP17 gene silencing on the developmental stages of cotton bollworm; x-axis: 2L: 2nd instar; 3L: 3rd instar; 4L: 4th instar; 5L: 5th instar; 6L: 6th instar; prepupa: prepupal stage; pupa: pupal stage; adult: adult stage; y-axis: developmental time.

[0041] Figure 7 The effect of LCP17 gene silencing on the mortality rate of cotton bollworm; the vertical axis represents the mortality rate.

[0042] Figure 8 Phenotypic changes in cotton bollworm after LCP17 gene silencing.

[0043] Figure 9 The effect of LCP17 gene silencing on the feeding amount of cotton bollworm; the vertical axis represents the feeding amount.

[0044] Figure 10 The effect of LCP17 gene silencing on the body weight of cotton bollworms; the horizontal axis represents experimental time, and the vertical axis represents body weight.

[0045] Figure 11 The expression level of LCP17 gene in cotton bollworms after injection of CQDs-dsLCP17; the vertical axis represents the relative expression level of LCP17 gene.

[0046] Figure 12 The effect of CQDs-dsLCP17 injection on the mortality rate of cotton bollworms; the vertical axis represents the mortality rate. Detailed Implementation

[0047] The cuticle of insects, also known as the exoskeleton, is an extracellular structure composed of cross-linked proteins and chitin polymers. Under the influence of insect hormones, insects renew their cuticle with each molt. Cuticle proteins, as major components of the insect body surface, have received considerable attention in recent years as a model system for studying hormonal regulation during metamorphosis and gene regulation during molting. Currently, cuticle proteins from various insects have been identified and studied. LCP genes are a relatively abundant family of epidermal protein genes in insects. LCP17 and LCP22 have been isolated from silkworms, while AgLCP9.2, AgLCP12.3, and AgLCP12.6 have been isolated from German beetles. In silkworms, large amounts of LCP17 and LCP22 were detected on the first day of the fourth molt, and their expression levels remained high until the fourth day of the final larval instar. Three cDNAs encoding keratinocyte proteins were cloned from the German beetle and named AgLCP9.2, AgLCP12.3, and AgLCP12.6. Differential expression of the three keratinocyte proteins was found in the epidermis.

[0048] This invention obtained the LCP17 gene of the cotton bollworm through sequence alignment. To clarify the application of this gene, the inventors first analyzed its spatiotemporal expression characteristics. The results showed that the LCP17 gene is expressed at all developmental stages of the cotton bollworm, with the highest expression level in the 6th instar, followed by the 5th instar. The expression level of LCP17 is relatively low in the egg, 1st, 2nd, 3rd, 4th instars, pupae, and adults (females and males). The expression level of LCP17 in the cotton bollworm varies in different tissues, with the highest expression level in Malpighian tubules, followed by the midgut and fat body, and the lowest expression level in the epidermis.

[0049] Based on the aforementioned expression pattern analysis, in order to further clarify the function of this gene, the applicant considered silencing its expression. Therefore, a dsRNA targeting this gene was designed using RNAi technology. Injection of dsLCP17 effectively reduced the gene's expression in the insect, leading to reduced feeding, stunted development, and death in larvae. This demonstrates that this gene can serve as a target for subsequent biological control of cotton bollworm and its closely related insects. To improve the silencing efficiency of the dsRNA, the inventors chose carbon quantum dots as the carrier and optimized the dosage relationship between carbon quantum dots and dsRNA.

[0050] The cotton bollworms used in the following examples were purchased from Henan Jiyuan Baiyun Industrial Co., Ltd., and subsequently reared at the Guangdong Provincial Agricultural Pest Biological Control Engineering Technology Center. Larvae were fed artificial feed, and adults were fed a 10% honey water solution. They were reared in an artificial intelligence incubator in our laboratory under the following conditions: temperature 27–28°C, humidity controlled at 30–40%, and photoperiod 14L:10D.

[0051] Table 1 shows the primers used in the following examples.

[0052]

[0053]

[0054] Example 1: Obtaining the LCP17 gene sequence

[0055] The LCP17 gene of *Spodoptera litura* and the homologous gene of *Helicoverpa armigera* were compared using the BLAST function on the NCBI website, and the nucleotide sequence of *Helicoverpa armigera* LCP17 was obtained. The accession number for the *Spodoptera litura* LCP17 gene is LOC111347903, and the accession number for the *Helicoverpa armigera* LCP17 gene is LOC110383613.

[0056] SEQ ID No.1 LCP17 full-length gene

[0057] CAGATTTATATTCTTCGACGAACGGCCGGTTTTTCAAACTGGTAGCAAAACCTCCTCATTTCTATTCTGGACGTTTAGTATATAAAGACGAACTTGCTTTAATTCAATCAGATTGAAACAAAAAGTTGACATCCCGCAAGCAACATGAAATTCTTAGTAGT CCTCGCCGTAGCCGTCGCGTGCGCAAGCGCCGACGTGTCTCACGTTGTCAGCGCTGACTACAGCGCCCCTGTCGTCAAGTCCAGCTACGACATCAGCCCTGAGGGTGCCTTCCAATACGCGTATGAAACCGGCAACGGCATCTACGCCCAGGCCTCTGGAT CTGTCAAGAACCAGAACTCCGAATACCCCTCCCTGGAGGTAGCTGGAGCCTACAAATACACCGCCCCCGATGGTACCCCCGTGGAACTGTCCTACGTCGCTGACGAGAACGGTTACAAACCCCAGGGCGCTCATCTCCCCGTCGGCCCGCCATCCCTGAG TACATCGCTCGCTCCCTGGCCTACATCGCTGCTCACCCCCCACCAGTTGAGGGAGTCAAGTCTGTCCCCAAACCCGCTTACGGTTAAGATGTCAACAACACCAGCTAGTACAAACCCTACTGCCATTGTATTGTAGTCAATAAAGTTATTATTGTTCGTGA

[0058] SEQ ID No.2LCP17 CDS area

[0059] ATGAAATTCTTAGTAGTCCTCGCCGTAGCCGTCGCGTGCGCAAGCGCCGACGTGTCTCACGTTGTCAGCGCTGACTACAGCGCCCCTGTCGTCAAGTCCAGCTACGACATCAGCCCTGAGGGTGCCTTCCAATACGCGTATGAAACCGGCAACGGCATCTACGCCCAGGCCTCTGGATCTGTCAAGAACCAGAACTCCGAATACCCCTCCCTG GAGGTAGCTGGAGCCTACAAATACACCGCCCCCGATGGTACCCCCGTGGAACTGTCCTACGTCGCTGACGAGAACGGTTACAAACCCCAGGGCGCTCATCTCCCCGTCGGCCCCGCCATCCCTGAGTACATCGCTCGCTCCCTGGCCTACATCGCTGCTCACCCCCCACCAGTTGAGGGAGTCAAGTCTGTCCCCAAACCCGCTTACGGTTAA

[0060] The protein encoded by SEQ ID No. 3LCP17

[0061] mkflvvlava vacasadvsh vvsadysapv vkssydispe gafqyayetg ngiyaqasgsvknqnseyps levagaykyt apdgtpvels yvadengykp qgahlpvgpa ipeyiarsla yiaahpppvegvksvpkpay g

[0062] Example 2: Expression patterns of the LCP17 gene in different developmental stages and tissues of cotton bollworm.

[0063] Total RNA extraction and first-strand cDNA synthesis from cotton bollworm

[0064] (1) Total RNA was extracted using the Trizol extraction method, and its mass and concentration were determined using agarose gel electrophoresis and NanoDrop (Thermo Fisher Scientific Inc.);

[0065] (2) First-strand cDNA synthesis: The PrimeScript reverse transcription kit was used. TMThe RT reagent kit with gDNA Eraser (Prefect Real Time) (Takara, RRO47A) was used to synthesize the first strand of cDNA from the extracted total RNA sample according to the manufacturer's instructions. The reagents were thawed on ice, briefly centrifuged, and all reagents were collected at the bottom of the tube and kept on ice until needed. The reverse transcription reaction mixture consisted of: 2 μL of 5×gDNA Eraser Buffer, 1 μL of gDNA Eraser, 1 μL of Total RNA, and RNase-free dH2O to a final volume of 10 μL; incubated at 42°C for 2 min. The following components were then added to the reaction mixture: 1 μL of PrimeScriptRT Enzyme Mix I, 1 μL of RT Primer Mix, 4 μL of 5×PrimerScript Buffer 2, and RNase-free dH2O to a final volume of 20 μL; incubated at 37°C for 15 min; then incubated at 85°C for 5 s, and immediately cooled on ice. The resulting cDNA solution can be stored at -20°C.

[0066] RT-PCR analysis

[0067] The RT-qPCR reaction system was as follows: cDNA 2 μL, TB Green II 5 μL, Primer F 0.5 μL, Primer R 0.5 μL, ddH2O 2 μL. The reaction program was: 95℃ for 30 s, (98℃: 10 s, 60℃: 45 s) × 40, melting curve: 95℃: 5 s (4.4℃ / s), 60℃ (2.2℃ / s), 95℃ 0.11℃ / s, taking 5 photos for every 1℃ increase. The relative expression level of the target gene was calculated using the 2-ΔΔCt method.

[0068] The results showed that the LCP17 gene was expressed at all developmental stages of the cotton bollworm, with the highest expression level in the 6th instar, followed by the 5th instar. The expression levels of LCP17 were relatively low in the egg, 1st, 2nd, 3rd, 4th instar, pupa, and adult (female and male) stages. Figure 3 ).

[0069] The expression level of LCP17 in cotton bollworm varies in different tissues, with the highest expression level in Malpighian tubules, followed by the midgut and fat body, and the lowest expression level in the epidermis. Figure 4 ).

[0070] Example 3: In vitro synthesis of dsLCP17

[0071] Primers for dsRNA were designed using PrimerPriemer software (Table 1), with the T7 promoter sequence added to the 5' end of both ends. These primers were then synthesized by Sangon Biotech (Shanghai) Co., Ltd. Using mixed cDNA from different developmental stages of *Bollworm* as templates, PCR amplification was performed using the synthesized primers. After purification and recovery according to the kit instructions (DNA purification and recovery kit, Sangon Biotech, Shanghai), a template containing the T7 polymerase promoter sequence for dsLCP17 was obtained. A green fluorescent protein (GFP) plasmid purchased from Guangzhou Qingke Biotechnology Co., Ltd. was used as a template to obtain a template for dsGFP synthesis using the same method. dsLCP17 and dsGFP were synthesized using the Hiscribe™ T7 in Vitreotranscription kit (New England Biolabs). Quantification was performed using a NaNoDrop2000 (Thermo Scientific). The samples were stored at -80°C for later use.

[0072] SEQ ID No.4dsLCP17

[0073] TAGTAGTCCTCGCCGTAGCCGTCGCGTGCGCAAGCGCCGACGTGTCTCACGTTGTCAGCGCTGACTACAGCGCCCCTGTCGTCAAGTCCAGCTACGACATCAGCCCTGAGGGTGCCTTCCAATACGCGTATGAAACCGGCAACGGCATCTACGCCCAGGCCTCTGGATCTGTCAAGAACCAGAACTCCGAATACCCCTCC CTGGAGGTAGCTGGAGCCTACAAATACACCGCCCCCGATGGTACCCCCGTGGAACTGTCCTACGTCGCTGACGAGAACGGTTACAAACCCCAGGGCGCTCATCTCCCCGTCGGCCCCGCCATCCCTGAGTACATCGCTCGCTCCCTGGCCTACATCGCTGCTCACCCCCCACCAGTTGAGGGAGTCAAGTCTGTCCCCAA

[0074] Example 4: Effect of dsLCP17 on the silencing efficiency of LCP gene in cotton bollworm.

[0075] Using a microinjector (WPI, MICRO-2T), dsLCP17 and dsGFP were injected at a dose of 100 nL / larva into second-instar cotton bollworm larvae of similar size from the penultimate abdominal segment. Sixty larvae were injected in each group. Active second-instar larvae were collected at 24 and 48 h, with eight larvae per tube. All samples were tested in triplicate. Total RNA was extracted from all samples and reverse transcribed into cDNA. The silencing efficiency of the LCP17 gene after RNAi was assessed using RT-qPCR.

[0076] The RT-qPCR reaction system was as follows: cDNA 2 μL, TB Green II 5 μL, Primer F 0.5 μL, Primer R 0.5 μL, ddH2O 2 μL. The reaction program was: 95℃ for 30 s, (98℃: 10 s, 60℃: 45 s) × 40, melting curve: 95℃: 5 s (4.4℃ / s), 60℃ (2.2℃ / s), 95℃ 0.11℃ / s, taking 5 photos for every 1℃ increase. The relative expression level of the target gene was calculated using the 2-ΔΔCt method.

[0077] The results showed that 24 hours after injection of dsLCP17, the relative expression level of LCP17 decreased by 1.95-fold, and 48 hours after injection, the relative expression level of LCP17 decreased by 3.89-fold, both of which were significantly different from the control group. Figure 5 ).

[0078] Example 5: Effect of dsLCP17 on the developmental duration of cotton bollworm

[0079] To investigate the effect of dsLCP17 injection on the developmental stage of cotton bollworm, 30 healthy second-instar larvae of uniform size were selected from both the interference and treatment groups. Each group was injected with 100 ng of dsLCP17 and dsGFP, respectively. Ten larvae constituted one biological replicate, and all samples were prepared in triplicate. The larvae from both the treatment and control groups were cultured in artificial climate chambers at 27–28°C, 30–40% humidity, and a photoperiod of 14 L:10 D. They were fed fresh artificial feed. The number of larvae changing in instar was counted at fixed times each day at 10:00 AM and 3:00 PM, and the percentage change in instar was calculated to analyze the effect of the LCP17 gene on the developmental stage of cotton bollworm.

[0080] The results showed that in the dsGFP control group, it took an average of 1.95 days for all 2L larvae to transform into 3L larvae; an average of 2.43 days for all 3L larvae to transform into 4L larvae; an average of 2.35 days for all 4L larvae to transform into 5L larvae; an average of 2.45 days for all 5L larvae to transform into 6L larvae; an average of 2.13 days for all 6L larvae to transform into prepupae; an average of 2.16 days for all prepupae to complete pupation; an average of 11.28 days for all pupae to emerge as adults; and an average adult survival time of 11 days before death. Compared with the dsGFP control, after silencing the LCP17 gene, the statistical results of each stage showed that the 2L larval stage in the treatment group lasted for 2.08 days, which was 0.13 days later than the control; the 3L larval stage lasted for 2.76 days, which was 0.33 days later than the control; the 4L larval stage lasted for 2.83 days, which was 0.48 days later than the control; the 5L larval stage lasted for 2.65 days, which was 0.2 days later than the control; the 6L larval stage lasted for 2.73 days, which was 0.6 days later than the control; the prepupal stage lasted for 2.27 days, which was 0.11 days later than the control; the pupal stage lasted for 11.68 days, which was 0.6 days later than the control; and the adult stage lasted for 11.02 days, which was 0.02 days later than the control. The 3L, 4L, 6L, and pupal stages in the treatment group were significantly different from the control group, while the 2L, 5L, prepupa, and adult stages showed no significant difference from the control group. Figure 6 ).

[0081] Example 6: Effects of dsLCP17 on the survival rate and feeding of cotton bollworms

[0082] Thirty larvae from the dsRNA-treated group and 30 larvae from the control group were placed in artificial climate chambers with a temperature of 27–28°C, humidity of 30–40%, and a photoperiod of 14 L:10 D. They were fed fresh artificial feed, and the number of larval deaths was counted daily for 7 days. The differences in growth and development between the treated and control groups of cotton bollworms were observed and recorded by taking photos.

[0083] The mortality rate of second-instar larvae after injection of dsLCP17 was statistically analyzed at 7 days of development. The results showed that the mortality rate was 23.33%, while the mortality rate of the control group was 6.67%, and the difference was statistically significant. Figure 7 The silencing of dsLCP17 in bollworm larvae may not have resulted in a high mortality rate, possibly because dsRNA is partially degraded in their digestive tract. However, phenotypic observation revealed that by day 4, the control group had already reached the end of the third instar, while 16% of the surviving larvae in the dsLCP17-treated group remained at the beginning of the third instar. Figure 8 ).

[0084] Thirty healthy larvae of uniform size were selected from both the dsRNA-treated group and the control group and placed in artificial climate chambers at 27–28°C, with humidity controlled at 30–40% and a photoperiod of 14L:10D. The larvae were fed normally, and their fresh weight and feed weight before and after feeding were measured daily to observe changes in feed intake and body weight. Feed intake = feed weight after feeding - feed weight before feeding.

[0085] Using larvae injected with dsGFP as a control, the change in feed intake in the control was influenced by molting. In the first three days after injection of dsLCP17, the feed intake of larvae was lower than that of the control, but the difference was not statistically significant. On the fourth day after interference, the feed intake of larvae injected with LCP17 gene dsRNA was significantly lower than that of the control, decreasing by 28.97%. On the fifth day, the feed intake of larvae injected with LCP17 gene dsRNA was significantly lower than that of the control, reaching 76.56% of the control's feed intake. On the sixth day after interference, the feed intake of larvae injected with LCP17 gene dsRNA was significantly lower than that of the control, reaching 83.44% of the control's feed intake. On the seventh day after interference, the feed intake of larvae injected with LCP17 gene dsRNA was significantly lower than that of the control, decreasing by 23.17% compared to the control. Figure 9 ).

[0086] The effect of dsRNA injection on the body weight of cotton bollworms was analyzed. The body weight of larvae in both groups was statistically analyzed. It was found that the body weight of the dsLCP17 treatment group was lower than that of the control group at all time points. However, there was no significant difference in body weight between the treatment group and the control group in the first four days. On the fifth, sixth, and seventh days, the body weight of the treatment group was significantly different from that of the control group, with the control group's body weight being 1.38 times, 1.24 times, and 1.25 times that of the treatment group, respectively. Figure 10 ).

[0087] Example 7: Effects of dsLCP17 carrying CQDs on the silencing efficiency and mortality rate of cotton bollworms

[0088] Imidazole-modified graphene nanomaterials carbon quantum dots (CQDs) were selected. Figure 1 Carbon quantum dot nanomaterials, purchased from Xianfeng Nanomaterials Technology Co., Ltd., have a diameter <10 nm and a positively charged surface, enabling them to electrostatically bind to nucleic acids. A 100 ng / μL CQDs solution was prepared, and dsLCP17 was diluted to 100 ng / μL. The volume ratios of dsRNA to CQDs were 1:0, 2:1, 3:1, 4:1, 5:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, and 20:1, respectively, and mixed thoroughly. The binding effect of dsRNA to different amounts of CQDs complexes was detected on a 1% agarose gel. With increasing volume ratio, the migration band intensity of 400-bp dsRNA gradually increased. Figure 2As can be seen, in addition to the double-stranded band appearing at the dsRNA:CQDs = 1:0 ratio, a double-stranded band appears twice at the dsRNA:CQDs = 5:1 ratio. The higher the ratio, the more obvious the band. When the dsRNA:CQDs = 11:1, the ability of CQDs to encapsulate dsRNA becomes weaker and weaker. Therefore, it can be determined that the carrying capacity of CQDs for 400-bp-dsRNA exceeds the limit at this ratio, so this ratio was selected for subsequent experiments.

[0089] dsRNA was mixed with 100 ng / μL of nanocarriers (CQDs) at a volume ratio of 11:1 to form a CQDs-dsLCP17 complex. The control was prepared by the same method described above to obtain the CQDs-dsGFP complex.

[0090] To ensure that the total mass of injected dsRNA and injected CQDs-dsLCP17 is consistent, calculations were performed to inject the CQDs-dsLCP17 complex and the CQDs-dsGFP complex into the second instar larvae of the same size cotton bollworm from the penultimate abdominal segment. 60 larvae were injected in each group, and 109 nL was injected into each treatment group.

[0091] Sixty larvae from each of the treatment and control groups were placed in artificial climate chambers at 27–28°C, 30–40% humidity, and a photoperiod of 14 L:10 D, respectively, and fed with fresh artificial feed. Active second-instar larvae of the cotton bollworm were collected at 24 and 48 hours post-injection, eight larvae per tube, and all samples were tested in triplicate. Total RNA was extracted from all samples and reverse transcribed into cDNA. RT-qPCR was used to detect the silencing efficiency of dsLCP17 loaded with CQDs on cotton bollworms at 24 and 48 hours.

[0092] The results showed that 24 hours after injection of the dsLCP17 mixture, the relative expression level of LCP17 decreased by 2.66-fold, and 48 hours after injection, the relative expression level of the LCP17 gene decreased by 6.46-fold, both of which were significantly different from the control group. Figure 11 ).

[0093] The CQDs-dsLCP17 complex and the CQDs-dsGFP complex were then injected into second-instar larvae of the same size cotton bollworm from the penultimate abdominal segment. 60 larvae were injected into each group, with each larva in the treatment group receiving 109 nL. The larvae in the treatment group and 30 larvae in the control group were placed in artificial climate chambers at 27–28°C, humidity controlled at 30–40%, and a photoperiod of 14 L:10 D. They were fed fresh artificial feed, and the number of larval deaths was recorded daily for 7 days.

[0094] The mortality rate of second-instar larvae after 7 days of development following injection of CQDs-dsLCP17 and CQDs-dsGFP complexes was statistically analyzed. The results showed that the mortality rate in the treatment group was 40%, while that in the control group was 6.67%, with a significant difference. Figure 12 ).

[0095] Furthermore, lepidopteran insects possess enzymes that degrade RNA. dsRNA is degraded in the midgut and hemolymph, reducing the amount ultimately ingested by the target pest and resulting in the loss of some RNAi components. Encapsulating dsRNA with nanomaterials, located on the outer layer of the dsRNA, can protect it from or reduce degradation by dsRNA enzymes, thus improving the interference efficiency of dsRNA. Experiments show that after loading, the insect mortality rate increased from 20% to 40%. Figure 7 and Figure 12 ).

Claims

1. The application of bollworm larval epidermal protein in insect control, characterized by: The amino acid sequence of the larval epidermal protein is shown in SEQ ID No. 3; the application is to use RNAi technology to reduce the expression of the gene LCP17 encoding the larval epidermal protein in insects, the RNAi technology is achieved by injecting dsLCP17 into insects, the nucleotide sequence of dsLCP17 is shown in SEQ ID No. 4; the insect is a second instar larva of the cotton bollworm.

2. The application according to claim 1, characterized in that: The gene encoding the epidermal protein of the cotton bollworm larva is shown in SEQ ID No. 1 or SEQ ID No.

2.

3. The application of bollworm larval epidermal proteins in regulating insect growth and development, characterized by: The amino acid sequence of the larval epidermal protein is shown in SEQ ID No. 3; the regulation of insect growth and development is achieved by using RNAi technology to reduce the expression of the gene LCP17 encoding the larval epidermal protein in the insect to prolong the insect's residence time at the 3L, 4L, 6L or pupal stages. The RNAi technology is implemented by injecting dsLCP17 into the insect, and the nucleotide sequence of dsLCP17 is shown in SEQ ID No. 4; the insect is the cotton bollworm.

4. The application according to claim 3, characterized in that: The gene encoding the epidermal protein of the cotton bollworm larva is shown in SEQ ID No. 1 or SEQ ID No.

2.

5. A method for controlling insects, characterized in that: The expression of LCP17, the gene encoding the larval epidermal protein, was reduced in insects using RNAi technology. The RNAi technology was achieved by injecting dsLCP17 into insects. The nucleotide sequence of dsLCP17 is shown in SEQ ID No.

4. The amino acid sequence of the larval epidermal protein is shown in SEQ ID No.

3. The insect was a second-instar larva of the cotton bollworm.

6. The method according to claim 5, characterized in that: The dsLCP17 is loaded with carbon quantum dots; dsLCP17 and CQDs are each prepared into a 100 ng / μL solution and then mixed; the mass ratio of dsLCP17 to CQDs is 11:1; the final concentration of dsLCP17 in the mixed solution is 13000 ng / μL.

7. The application of substances that reduce the expression of gene LCP17 in insect control, characterized by: The substance that reduces the expression of gene LCP17 is dsLCP17, the nucleotide sequence of which is shown in SEQ ID No. 4, and the insect is a second-instar larva of the cotton bollworm.

Citation Information

Patent Citations

  • DsRNA of cotton bollworm CYP4L11 gene and applications of dsRNA

    CN108588072A