A preparation method of feline calicivirus pseudovirus

Feline calicivirus pseudovirus is prepared by PCR amplification and recombinant vector construction methods, which solves the problem of lack of feline calicivirus research tools in the existing technology and provides a safe and efficient research tool suitable for feline calicivirus research and drug screening.

CN116790666BActive Publication Date: 2025-09-30JILIN UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310749595.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-06-25
Publication Date
2025-09-30
Estimated Expiration
2043-06-25

AI Technical Summary

Technical Problem

Currently, there is no method for constructing feline calicivirus pseudoviruses, and existing technologies cannot provide safe and effective research tools, making feline calicivirus research and drug screening difficult.

Method used

Primers were designed for PCR amplification of the gp2 gene to construct the pDONR 221 vector. BP and LR reactions were performed to reconstruct the expression vector pLV[Exp]-EGFP:T2A:Puro-EF1A>{FCV-gp2}, which was co-transfected with the lentiviral packaging plasmid into HEK293T cells to prepare feline calicivirus pseudovirus.

Benefits of technology

The prepared feline calicivirus pseudovirus has no replication activity, high biosafety, and good stability. It can be used for feline calicivirus research, antiviral preparation screening, and vaccine evaluation. As a positive control standard, it has wide application value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004300718550000061
    Figure BDA0004300718550000061
  • Figure HDA0004300718580000011
    Figure HDA0004300718580000011
  • Figure HDA0004300718580000012
    Figure HDA0004300718580000012
Patent Text Reader

Abstract

The invention discloses a method for preparing a feline calicivirus pseudovirus. The method comprises the following steps: first obtaining the gp2 gene by PCR amplification, then constructing an entry cloning vector pDown-{FCV-gp2} containing the gp2 gene sequence by BP reaction, and then recombining the promoter-carrying pUp-EF1A vector, pDown-{FCV-gp2}, and pLV.Des2d.C / EGFP:T2A:Puro by LR reaction to obtain a recombinant expression vector pLV[Exp]-EGFP:T2A:Puro-EF1A>{FCV-gp2}, which is then co-transfected with a lentiviral packaging plasmid into HEK293T cells. The feline calicivirus pseudovirus prepared by the method has no replication activity, high biosafety, and can provide a powerful screening tool for feline calicivirus research, antiviral preparations, and vaccine evaluation, with wide application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to a method for preparing feline calicivirus pseudovirus, and belongs to the technical field of genetic engineering. Background Art

[0002] Feline calicivirus (FCV), a member of the genus Herpesvirus in the family Caliciviridae, is a highly pathogenic pathogen of most felines, widespread and worldwide. FCV infects felines through the nose, mouth, and joints and is highly contagious. It primarily infects cats, causing typical respiratory symptoms and oral ulcers. It can also infect other feline species, including lions, tigers, and cheetahs, posing a significant threat to the health of cats and other rare wildlife. Recent reports suggest that the pathogenicity of FCV is increasing, with the continued emergence of virulent FCV variants, which can cause not only upper respiratory tract illness but also lesions in the spleen and liver, and in more severe cases, fatal systemic disease.

[0003] When conducting scientific research and drug screening on feline calicivirus, FCV needs to be used directly. However, due to the high pathogenicity and strong infectivity of FCV, there is an urgent need to develop safe and effective FCV research methods. Pseudovirus refers to a retrovirus that can integrate the envelope glycoprotein of another different type of virus to form an envelope with an exogenous virus, while the genome retains the characteristics of the retrovirus's own genome. Due to the defective nature of the nucleic acid molecule, pseudoviruses only have one cell infection cycle, so they have high biosafety. They are widely used in virus research, screening of antiviral agents, and vaccine development. They can also be used as positive control standards and internal control standards in viral nucleic acid detection.

[0004] Currently, there are no reports on the construction of feline calicivirus pseudoviruses. Summary of the Invention

[0005] The object of the present invention is to solve the above-mentioned deficiencies in the prior art and to provide a method for preparing feline calicivirus pseudovirus.

[0006] Technical Solution

[0007] A method for preparing a feline calicivirus pseudovirus comprises the following steps:

[0008] (1) Design primers for PCR amplification to obtain the gp2 gene, which was then ligated into the pDONR 221 vector via BP reaction to obtain the entry cloning vector pDown-{FCV-gp2} containing the gp2 gene sequence;

[0009] (2) The pUp-EF1A vector carrying the promoter, the entry cloning vector pDown-{FCV-gp2} containing the gp2 gene sequence, and the pLV.Des2d.C / EGFP:T2A:Puro backbone vector were recombined through LR reaction to obtain the recombinant expression vector pLV[Exp]-EGFP:T2A:Puro-EF1A>{FCV-gp2};

[0010] (3) The recombinant expression vector pLV[Exp]-EGFP:T2A:Puro-EF1A>{FCV-gp2} and the lentiviral packaging plasmid were co-transfected into HEK293T cells. After the transfection, the cells were centrifuged, and the supernatant was collected and filtered to obtain the filtrate.

[0011] (4) The filtrate is further centrifuged and the supernatant is discarded to obtain feline calicivirus pseudovirus.

[0012] Furthermore, in step (1), the primers for PCR amplification include pD-220915-1567wtt-PF1 and pD-220915-1567wtt-PR1, the sequence of pD-220915-1567wtt-PF1 is shown in SEQ ID NO.1, and the sequence of pD-220915-1567wtt-PR1 is shown in SEQ ID NO.2.

[0013] pD-220915-1567wtt-PF1:

[0014] GGGGACAAGTTTGTACAAAAAAGCAGGCTGCCACCATGTGCTCAACCTGC GCTAACG(SEQ IDNO.1)

[0015] pD-220915-1567wtt-PR1:

[0016] GGGGACCACTTTGTACAAGAAAGCTGGGTTCATAGTTTAGTCATTGTGCTC CTAATATTC(SEQ IDNO.2)

[0017] Furthermore, in step (1), the nucleotide sequence of the gp2 gene is shown as SEQ ID NO.3.

[0018] Furthermore, in step (2), the mass ratio of the pUp-EF1A vector, the entry cloning vector pDown-{FCV-gp2} containing the gp2 gene sequence, and the pLV.Des2d.C / EGFP:T2A:Puro backbone vector is (1-2):(1-2):(5-10).

[0019] Furthermore, in step (3), the lentiviral packaging plasmids are pMD2.G and psPAX2. During transfection, the mass ratio of pMD2.G, psPAX2 and pLV[Exp]-EGFP:T2A:Puro-EF1A>{FCV-gp2} is 1:1:2.

[0020] Furthermore, in step (3), the transfection method adopts the cationic liposome method.

[0021] Furthermore, in step (3), the centrifugation conditions are: 4°C, 2000g centrifugation for 30 min.

[0022] Furthermore, in step (4), the centrifugation condition is: 50,000 g centrifugation for 2 h.

[0023] Beneficial effects of the present invention:

[0024] The present invention first designs primers to obtain the gp2 gene through PCR amplification, then uses a BP reaction to construct an entry cloning vector pDown-{FCV-gp2} containing the gp2 gene sequence. The pUp-EF1A vector carrying the promoter, pDown-{FCV-gp2}, and pLV.Des2d.C / EGFP:T2A:Puro are then recombined using an LR reaction to obtain the recombinant expression vector pLV[Exp]-EGFP:T2A:Puro-EF1A>{FCV-gp2}. This vector is then co-transfected with a lentiviral packaging plasmid into HEK293T cells to obtain feline calicivirus pseudovirus particles. Compared with the prior art, the feline calicivirus pseudovirus prepared by the method of the present invention has no replication activity, high biosafety, and good stability. It can provide a powerful screening tool for feline calicivirus research, antiviral preparations, and vaccine evaluation. It can also be used as a positive control standard in feline calicivirus nucleic acid detection, and has a wide range of application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 is a map of the recombinant expression vector pLV[Exp]-EGFP:T2A:Puro-EF1A>{FCV-gp2};

[0026] Figure 2 Agarose gel electrophoresis diagram for enzyme digestion identification;

[0027] Figure 3 This is the result of virus packaging test;

[0028] Figure 4 These are the results of the infectivity test of feline calicivirus pseudovirus fluid. DETAILED DESCRIPTION

[0029] The technical solutions of the present invention are described clearly and completely below with reference to the accompanying drawings and specific embodiments. In the following embodiments, the experimental methods used are conventional methods unless otherwise specified; the materials, reagents, etc. used in the following embodiments are all commercially available unless otherwise specified.

[0030] Sources of materials used in the following examples:

[0031] Lipofectamine 2000 and I culture medium was purchased from Invitrogen; HEK293T cells were purchased from ATCC; pDONR 221 vector was purchased from Shanghai Lianmai Bioengineering Co., Ltd.; dNTP Mixture (10 μM) and DNA Polymerase were purchased from Kumei Biotechnology Co., Ltd.; pUp-EF1A vector and pLV.Des2d.C / EGFP:T2A:Puro backbone vector were purchased from Yunzhou Biotechnology (Guangzhou) Co., Ltd.; packaging plasmids pMD2.G and psPAX2 were purchased from Yunzhou Biotechnology (Guangzhou) Co., Ltd.

[0032] Example 1

[0033] 1. Extract viral RNA from the feline calicivirus ATCC PTA-5798 strain, design primers for PCR amplification to obtain the gp2 gene, and then ligate it to the pDONR 221 vector via BP reaction to obtain the entry cloning vector pDown-{FCV-gp2} containing the gp2 gene sequence;

[0034] (1) Obtaining the target fragment

[0035] 1. Primer Design

[0036] According to the BP reaction principle, the primer sequence was designed: attB site + specific primer sequence.

[0037] pD-220915-1567wtt-PF1:

[0038] GGGGACAAGTTTGTACAAAAAAGCAGGCTGCCACCATGTGCTCAACC TGCGCTAACG(SEQ IDNO.1)

[0039] pD-220915-1567wtt-PR1:

[0040] GGGGACCACTTTGTACAAGAAAGCTGGGTTCATAGTTTAGTCATTGTG CTCCTAATATTC(SEQ IDNO.2)

[0041] The product was sent to Kumei Biotechnology Co., Ltd. for synthesis.

[0042] 2. PCR Amplification

[0043] PCR reaction system: 5× Primer STAR TM Buffer 10μL, dNTP Mixture (10μM) 4μL, Primer-F (10μM) 1μL, Primer-R (10μM) 1μL, Template DNA 1μL, Primer STAR TM Add 0.5 μL of HS DNA Polymerase and add ddH2O to make up to 50 μL.

[0044] PCR program: 98°C for 3 min, 98°C for 10 s; 60°C for 10 s; 72°C for 60 s; 72°C for 6 min, 30 cycles.

[0045] 3. Subject the PCR reaction products to agarose gel electrophoresis, cut out the gel block containing the target fragment and recover it. After measuring the concentration using NanoDrop8000, store the DNA at -20℃ for later use.

[0046] (II) BP reaction to construct vector pDown-{FCV-gp2}

[0047] 1. Extraction of pDONR 221 backbone plasmid

[0048] Preparation: Check whether RNase A has been added to Buffer P1; whether anhydrous ethanol has been added to the rinse buffer PW; whether there is precipitation in Buffer P2 and P3; add 500μL of balance solution BL to the adsorption column, centrifuge at 12000rpm for 1min, and then discard the waste liquid.

[0049] a. Take 4-5 mL of overnight culture solution, centrifuge at 12000 rpm for 2 minutes to collect the cells, and discard the culture medium;

[0050] b. Add 250 μL of Buffer P1 to the pellet and vortex to thoroughly resuspend the cells.

[0051] c. Add 250 μL of Buffer P2, gently invert the tube 5-10 times, and let it stand at room temperature for 2-4 minutes.

[0052] d. Add 350 μL of Buffer P3 and immediately gently invert the tube 5-10 times;

[0053] e. Centrifuge at 12,000 rpm for 10 minutes, transfer the supernatant to an adsorption column, centrifuge at 12,000 rpm for 30 seconds, and discard the liquid in the collection tube;

[0054] f. (Optional) Add 500 μL of deproteinized PD buffer, centrifuge at 12,000 rpm for 30 seconds, and discard the liquid in the collection tube;

[0055] g. Add 600 μL of rinse buffer PW, centrifuge at 12000 rpm for 30 seconds, and discard the liquid in the collection tube;

[0056] h. Repeat step g once;

[0057] i. Centrifuge the empty adsorption column at 12000 rpm for 2 min;

[0058] j. Place the adsorption column in a clean 1.5 mL centrifuge tube and add 50-100 μL of elution buffer EB to the center of the adsorption membrane. Let it stand at room temperature for 2 minutes, and then centrifuge at 12,000 rpm for 2 minutes.

[0059] Note: The plasmid was prepared using the Tiangen Plasmid Mini Kit. Refer to the instructions of the Tiangen Plasmid Mini Kit to prepare the various backbone vector DNAs used in the vector construction process.

[0060] 2.BP reaction

[0061] BP reaction system: attB-PCR product 75ng, pDONR 221 backbone vector 75ng, BP Clonase TM II Enzyme Mix 1 μL, TE Buffer, pH 8.0, add to 4 μL.

[0062] BP reaction conditions: incubate at 25°C for 1 h; after the reaction, add 1 μL proteinase K and incubate at 37°C for 15 min to terminate the BP reaction.

[0063] 3. Transformation of E. coli Competent Cells

[0064] a. Remove competent cells from -80°C and thaw on ice;

[0065] b. In a clean bench, add 5 μL of BP reaction product to 100 μL of competent cells and gently

[0066] Mix well by flicking;

[0067] c. Ice bath for 30 minutes;

[0068] d. Heat shock at 42°C for 90 seconds;

[0069] e. Ice bath for 2-3 minutes;

[0070] f. Add 250 μL LB medium or SOC medium;

[0071] G.250rpm, 37℃, shake culture (recovery) for about 1h;

[0072] h. Spread the revived bacterial solution onto a plate containing Kana antibiotics and culture inverted at 37°C overnight.

[0073] 4. Positive clone selection and identification

[0074] Randomly pick 3-6 single colonies, rinse the bacteria into a sterile 0.2mL sterile EP tube, take 1μL as the template for colony PCR, and use the rest as the strain for inoculating bacteria to extract plasmid DNA.

[0075] Colony PCR reaction system: template 1 μL, dNTP Mixture (2.5 mM) 0.8 μL, sequencing primer-F1 (10 μM) 0.5 μL, sequencing primer-R (10 μM) 0.5 μL, 10× Buffer 1 μL, Taq DNA Polymerase 0.5 μL, ddH2O to 10 μL.

[0076] Colony PCR reaction program: 94°C for 3 min, 94°C for 30 s; 60°C for 30 s; 72°C for 1 min / 1-2 Kb; 25 cycles, 72°C for 5-10 min.

[0077] After colony PCR is complete, add 6× loading buffer and perform electrophoresis. Select clones that can amplify the target length using the DNA ladder. Inoculate into LB medium and culture overnight at 37°C, 250 rpm. Extract small plasmid DNA and send for sequencing. Use Sequencher software to compare the returned sequencing results with the standard sequence. The correctly sequenced entry vector is pDown-{FCV-gp2}, and you can proceed to the next step of the LR reaction to construct the final vector.

[0078] 2. The pUp-EF1A vector carrying the promoter, the entry cloning vector pDown-{FCV-gp2} containing the gp2 gene sequence, and the pLV.Des2d.C / EGFP:T2A:Puro backbone vector were recombined through LR reaction to obtain the recombinant expression vector pLV[Exp]-EGFP:T2A:Puro-EF1A>{FCV-gp2}. The map of the prepared recombinant expression vector pLV[Exp]-EGFP:T2A:Puro-EF1A>{FCV-gp2} is shown in Figure 1 .

[0079] 1.LR reaction

[0080] The LR reaction system is shown in Table 1:

[0081] Table 1

[0082]

[0083] LR reaction conditions: incubate at 25°C for 3 h. After the reaction is complete, add 1 μL proteinase K and incubate at 37°C for 15 min to terminate the reaction.

[0084] Note: In the 2d LR reaction, the pTail vector is not required.

[0085] 2. Transformation of LR reaction products into competent cells

[0086] Take 2 μL of LR reaction product to transform competent cells. Refer to the transformation steps of BP reaction product. Finally, spread the revived bacterial liquid on LB plate containing Amp antibiotic and culture it upside down at 37℃ overnight.

[0087] 3. Colony PCR

[0088] Randomly pick 3-6 single colonies and perform the colony PCR reaction according to step 1. Finally, perform agarose gel electrophoresis and pick colonies that can amplify DNA bands of the target band length according to the DNA ladder. Inoculate and culture the bacteria and extract plasmid DNA.

[0089] 4. Enzyme digestion identification

[0090] Use SnapGene software to open the vector map (see Figure 1 ), determine the enzyme digestion scheme, and then use NEB's restriction endonuclease to digest the plasmid DNA of the final vector. After the enzyme digestion reaction is completed, perform agarose gel electrophoresis and analyze with reference to DNALadder. Figure 2 The figure is an agarose gel electrophoresis diagram of enzyme digestion identification, where lane M is the marker and lane 44 is the recombinant expression vector. The corresponding four bands (3389, 3985, 1246, 2761) are consistent with expectations, indicating that DNA bands of the expected size can be cut out and the enzyme digestion is correct.

[0091] 3. Lipofectamine transfection of HEK293T cells to prepare feline calicivirus pseudovirus

[0092] (1) Take the glycerol bacteria containing the target gene plasmid and inoculate it into liquid LB for overnight culture. Then use the endotoxin-free extraction kit to extract the plasmid DNA. The concentration is measured by NanoDrop8000 and then set aside.

[0093] (2) One day before transfection, HEK293T cells were seeded into 100 mm culture dishes and DMEM medium (ThermoFisher) containing 10% FBS was added. The cells were cultured at 37°C and 5% CO2 for 24 h. The cell fusion rate before transfection was approximately 80% to 90%.

[0094] (3) Change the medium 1 hour before transfection and add I culture medium and continue to culture.

[0095] (4) Mix solution A and solution B separately. 1.5 mL of solution A I and 4 μg DNA (packaging plasmid pMD2.G, psPAX2 and target gene plasmid, respectively, added in a mass ratio of 1:1:2), gently pipetting and mixing with the pipette tip. Mix 1 with 40 μL of Lipofectamine 2000 by gently pipetting, and incubate at room temperature for 5 minutes. Add solution A to solution B, mix by gently pipetting, and incubate at room temperature for 20 minutes.

[0096] (5) Slowly add the incubated transfection complex dropwise to the cells in the changed medium, gently shake to evenly distribute it, and incubate at 37°C, 5% CO2. 6 hours after transfection, replace the medium with DMEM containing 10% FBS and continue to incubate at 37°C, 5% CO2.

[0097] (6) 48 h after transfection, the culture supernatant was collected and concentrated, centrifuged at 2000 g for 30 min at 4°C, and the supernatant was collected and filtered through 0.45 μM to remove cell debris.

[0098] (7) Add the filtrate to a centrifuge tube and centrifuge at 50,000 g for 2 h. Discard the supernatant and collect the lentiviral particles. Resuspend each pellet in 200 μL of HBSS buffer, aliquot, and store at -80°C.

[0099] 1. Observe pseudoviruses under a fluorescence microscope and perform virus packaging detection

[0100] Virus packaging test results are shown in Figure 3 ,It can be seen that 48 hours after infection with feline calicivirus pseudovirus, bright green fluorescence was visible under the fluorescence microscope, which was positive, indicating that the pseudovirus was successfully constructed.

[0101] 2. Feline Calicivirus Pseudovirus Titer Detection

[0102] Add 200 μL of virus concentrate to a centrifuge tube. Add 1.5 mL of 20% sucrose solution to the lower layer. After equilibration, centrifuge at 50,000 g for 2 h. Remove the supernatant and collect the precipitated virus particles. Resuspend each pellet in 200 μL of HBSS buffer and determine the viral titer using the p24 ELISA method.

[0103] Test results: Feline calicivirus pseudovirus titer is 3.79×10 8 TU / mL.

[0104] 3. Infect HEK293 cells with the prepared feline calicivirus pseudovirus solution and perform pseudovirus infectivity test: HEK293 cells were plated at 8×10 5 The number of cells was seeded into 96-well plates in advance. When the cells grew to a monolayer, the cell culture medium was aspirated and washed with DMEM to remove any residual fetal bovine serum. The pseudovirus was diluted 10-fold in DMEM to 10 -8 The diluted pseudovirus solution was inoculated into 96-well plates containing cell monolayers and incubated in a 37°C incubator for 1 hour. The pseudovirus solution was aspirated from the plates, and 200 μl of complete culture medium was added to each well. The cells were then incubated in a cell incubator for 48 hours. The cells were observed for GFP expression under a fluorescence microscope every 12 hours.

[0105] Feline calicivirus pseudovirus fluid infectivity test results Figure 4 As shown, it can be seen that there are GFP-positive cells in HEK293 cells, indicating that the prepared feline calicivirus pseudovirus can infect HEK293 cells.

Claims

1. A method for preparing a feline calicivirus pseudovirus, characterized in that: The steps include: (1) Design primers for PCR amplification to obtain the gp2 gene, which was then ligated to the pDONR 221 vector via BP reaction to obtain the entry cloning vector pDown-{FCV-gp2} containing the gp2 gene sequence; (2) The pUp-EF1A vector carrying the promoter, the entry cloning vector pDown-{FCV-gp2} containing the gp2 gene sequence, and the pLV.Des2d.C / EGFP:T2A:Puro backbone vector were recombined through LR reaction to obtain the recombinant expression vector pLV[Exp]-EGFP:T2A:Puro-EF1A>{FCV-gp2}; (3) The recombinant expression vector pLV[Exp]-EGFP:T2A:Puro-EF1A>{FCV-gp2} and the lentiviral packaging plasmid were co-transfected into HEK293T cells. After the transfection, the cells were centrifuged, and the supernatant was collected and filtered to obtain the filtrate. (4) The filtrate is further centrifuged and the supernatant is discarded to obtain feline calicivirus pseudovirus; In step (1), the nucleotide sequence of the gp2 gene is shown in SEQ ID NO. 3; In step (3), the lentiviral packaging plasmids are pMD2.G and psPAX2. During transfection, the mass ratio of pMD2.G, psPAX2 and pLV[Exp]-EGFP:T2A:Puro-EF1A>{FCV-gp2} is 1:1:

2.

2. The method for preparing a feline calicivirus pseudovirus according to claim 1, wherein In step (1), the primers for PCR amplification include pD-220915-1567wtt -PF1 and pD-220915-1567wtt -PR1, the sequence of pD-220915-1567wtt -PF1 is shown in SEQ ID NO.1, and the sequence of pD-220915-1567wtt -PR1 is shown in SEQ ID NO.

2.

3. The method for preparing a feline calicivirus pseudovirus according to claim 1, wherein In step (2), the mass ratio of the pUp-EF1A vector, the entry cloning vector pDown-{FCV-gp2} containing the gp2 gene sequence, and the pLV.Des2d.C / EGFP:T2A:Puro backbone vector is (1-2):(1-2):(5-10).

4. The method for preparing a feline calicivirus pseudovirus according to claim 1, wherein In step (3), the centrifugation conditions are: 4°C, 2000 g for 30 min.

5. The method for preparing a feline calicivirus pseudovirus according to any one of claims 1 to 4, wherein In step (4), the centrifugation condition is: 50,000 g for 2 h.