Primer, kit and method for rapidly detecting feline calicivirus
By designing specific primers and probes using RAA-LFD technology, the problems of time-consuming and missed detection of feline calicivirus were solved, achieving rapid, sensitive and specific detection results.
Patent Information
- Application Number
- CN202510981994.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-16
- Publication Date
- 2025-10-17
AI Technical Summary
Existing feline calicivirus detection methods are time-consuming and difficult to operate, and existing primer designs may not effectively cover all variants, resulting in missed detections.
Highly specific primers ORF1-F and ORF1-R were designed and combined with a FAM/Biotin dual-labeled probe. RAA-LFD technology was used to carry out RAA reaction at a constant temperature of 39°C, and nucleic acid-colloidal gold immunochromatographic test strips were used for visual detection.
Rapid, sensitive and specific feline calicivirus detection was achieved, with a minimum detection limit of 8.67×101 copies/μL, which is more sensitive than the conventional PCR method and does not cross-react with other cat pathogens or host RNA.
Smart Images
Figure CN120796586A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of genetic engineering, and particularly relates to a primer, a kit and a method for rapidly detecting feline calicivirus. BACKGROUND
[0002] Feline calicivirus (FCV) is a single-stranded RNA virus, and the high variation rate of the genome of the feline calicivirus (FCV) leads to frequent antigenic drift. The feline calicivirus (FCV) infection has various symptoms, and the mild symptoms include upper respiratory tract symptoms (sneezing, eye and nose secretions), tongue ulcer and gingivostomatitis, and lameness is occasionally observed. The highly pathogenic strain (VS-FCV) can cause systemic lesions: skin alopecia, ulceration and scab formation in the mouth, nose, ear and foot pad, accompanied by subcutaneous edema; internal organ damage includes interstitial pneumonia and liver, spleen and pancreas necrosis, and presents a tendency of multiple organ failure. The antigenic drift of the feline calicivirus leads to the emergence of various variant strains, and the feline calicivirus is not effectively treated as other pathogenic infections.
[0003] The traditional diagnosis methods of the feline calicivirus include reverse transcription polymerase chain reaction (RT-PCR), cell culture virus isolation, electron microscopy and immunohistochemistry, but these diagnosis methods not only consume time and money, but also are inconvenient to operate in practice. In recent years, the nucleic acid isothermal amplification technology, such as recombinase-aid amplification (RAA) technology, is a nucleic acid detection technology that can replace PCR. RAA is a constant-temperature nucleic acid rapid amplification technology, which can make the final amplification product grow exponentially, and complete the amplification of the target gene, but the existing primer design may not effectively cover all variant strains, leading to missed detection.
[0004] Therefore, there is an urgent need for a primer that can rapidly detect the feline calicivirus. SUMMARY
[0005] The application aims to provide a primer, a kit and a method for rapidly detecting feline calicivirus, which can overcome the problem of long diagnosis time. The method provided by the application has high specificity, short detection time, high sensitivity and easy operation.
[0006] In order to achieve the above-mentioned purpose, the application provides the following technical scheme:
[0007] The application aims to provide a primer for detecting feline calicivirus, which comprises a forward primer ORF1-F and a reverse primer ORF1-R.
[0008] The sequence of the forward primer ORF1-F is shown in SEQ ID NO. 1.
[0009] The sequence of the reverse primer ORF1-R is shown as SEQ ID NO. 2.
[0010] Preferably, the 5' end of the sequence of the forward primer ORF1-F is modified with biotin.
[0011] The application also provides a detection kit for detecting feline calicivirus, which comprises the primers described above.
[0012] Preferably, the kit further comprises a probe ORF1-probe, which is connected by tetrahydrofuran from two part sequences; the sequence of the first part is shown as SEQ ID NO. 3, and the sequence of the second part is shown as SEQ ID NO. 4.
[0013] Preferably, the 5' end of SEQ ID NO. 3 is connected with carboxyfluorescein; the 3' end of SEQ ID NO. 4 is connected with C3 spacer; and the 3' end of SEQ ID NO. 3 and the 5' end of SEQ ID NO. 4 are connected by tetrahydrofuran.
[0014] Preferably, the kit further comprises a negative control sample, a positive control sample, a buffer, and a test strip.
[0015] The application also provides a detection method for detecting feline calicivirus for non-diagnostic purposes, which comprises the following steps:
[0016] S1: using total RNA of a sample to be detected as a template, and preparing cDNA by using a reverse transcription reagent;
[0017] S2: using the kit described above and the cDNA prepared in step S1 to perform a RAA reaction, to obtain a reaction product;
[0018] S3: using a nucleic acid-colloidal gold immunochromatography test strip to visually detect the reaction product obtained in step S2.
[0019] Preferably, the concentration of the cDNA in step S1 is 8.67 x 10 1 copies / μL.
[0020] Preferably, the temperature for constant temperature incubation in the RAA reaction in step S2 is 37-41℃.
[0021] Preferably, the concentration of the primers in the kit in step S2 is 2 μm / μL.
[0022] Compared with the prior art, the application has the following beneficial effects:
[0023] (1) The application provides a RAA primer pair and a probe with FAM / Biotin double labels which specifically recognize a cat calicivirus conserved region gene, and further optimizes the concentration of the primer, adopts a RAA-LFD (recombinase assisted amplification-flow-through layer chromatographic test strip) technology, achieves good results, and obtains a detection result under a constant temperature condition of 39 DEG C for 35 min, amplifies about 10 12 copies, reaches a nucleic acid detectable level, and has the advantages of rapidity and effectiveness.
[0024] (2) The application also optimizes other parameters in the amplification system, cooperates with the designed primer, realizes high specificity and high sensitivity detection of the cat calicivirus, and the minimum detection limit is 8.67x10 1 copies / μL, and the sensitivity is higher than that of the ordinary PCR method.
[0025] (3) The detection method of the cat calicivirus provided by the application does not have cross-reactions with other common pathogenic agents of cat groups and does not have non-specific reactions with host RNA, and has high specificity.
[0026] (4) The application has the advantages of simple operation, on-site detection without special detection personnel, rapid and accurate detection, and good application effect in preliminary application, and has important significance for the prevention and control of the cat calicivirus. BRIEF DESCRIPTION OF DRAWINGS
[0027] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the application, and other drawings can be obtained by those skilled in the art without creative labor under the premise of the drawings.
[0028] Figure 1 The figure is a schematic diagram of the detection results of primer concentration optimization. Wherein, 1: 2 μL, 2: 1.5 μL, 3: 1 μL, 4: 0.5 μL, 5: negative control.
[0029] Figure 2 The figure is a schematic diagram of the detection results of reaction temperature optimization. Wherein, 1: negative control, 2: 37 DEG C, 3: 38 DEG C, 4: 39 DEG C, 5: 40 DEG C, 6: 41 DEG C.
[0030] Figure 3 The figure is a schematic diagram of the detection results of the analysis of primer sensitivity. Wherein, 1: 8.67x10 3 copies / μL, 2: 8.67x10 2 copies / μL, 3: 8.67x10 1copies / μL, 4: 8.67 x 10 0 copies / μL, 5: 8.67 x 10 - 1 copies / μL, 6: negative control.
[0031] Figure 4 A schematic diagram of the detection results of the primer specificity analysis is shown in the figure. Wherein, 1: positive control, 2: FHV-1, 3: FAstV, 4: negative control. DETAILED DESCRIPTION
[0032] The purpose of the present application is to provide a primer for detecting feline calicivirus, which comprises a forward primer ORF1-F, a reverse primer ORF1-R;
[0033] The sequence of the forward primer ORF1-F is shown in SEQ ID NO. 1.
[0034] The sequence of the reverse primer ORF1-R is shown in SEQ ID NO. 2.
[0035] Preferably, the 5' end of the forward primer ORF1-F sequence is modified with biotin.
[0036] The present application also provides a detection kit for detecting feline calicivirus, which comprises the above-mentioned primer.
[0037] Preferably, the kit further comprises a probe ORF1-probe, which is connected by tetrahydrofuran from two part sequences; the sequence of the first part is shown in SEQ ID NO. 3, and the sequence of the second part is shown in SEQ ID NO. 4.
[0038] Preferably, the 5' end of SEQ ID NO. 3 is connected with carboxyfluorescein; the 3' end of SEQ ID NO. 4 is connected with C3 spacer; and the 3' end of SEQ ID NO. 3 and the 5' end of SEQ ID NO. 4 are connected by tetrahydrofuran.
[0039] Preferably, the kit further comprises a negative control sample, a positive control sample, a buffer, and a test strip.
[0040] The present application also provides a detection method for detecting feline calicivirus for non-diagnostic purposes, which comprises the following steps:
[0041] S1: using total RNA of a sample to be detected as a template, preparing cDNA by using a reverse transcription reagent;
[0042] S2: using the kit and the cDNA prepared in step S1 to perform RAA reaction, to obtain a reaction product;
[0043] S3: using the nucleic acid-colloidal gold immunochromatography test strip to visually detect the reaction product obtained in step S2.
[0044] Preferably, the concentration of the cDNA in step S1 is 8.67 x 10 1 copies / μL.
[0045] Preferably, the temperature of the constant temperature incubation in step S2 is 37-41℃, and the temperature of the constant temperature incubation is preferably 37, 38, 39, 40, 41℃, further preferably 39, 40℃, and more preferably 39℃.
[0046] Preferably, the concentration of the primers in the kit in step S2 is 10 nmol / μL.
[0047] In order to further illustrate the present application, the technical solutions provided by the present application are described in detail below in combination with the drawings and examples, but they should not be understood as limiting the scope of protection of the present application.
[0048] The production process, experimental method or detection method involved in the embodiments of the present application are all conventional methods in the prior art if not otherwise specified, and the name and / or abbreviation thereof all belong to the conventional names in the art, which are very clear and explicit in the related application field, and the person skilled in the art can understand the conventional process steps and apply the corresponding equipment according to the name, and implement it according to the conventional conditions or the conditions recommended by the manufacturer.
[0049] The various instruments, equipment, raw materials or reagents used in the embodiments of the present application do not have special restrictions on the source, and are all conventional products that can be purchased through normal commercial channels, or can be prepared according to the conventional methods well known to those skilled in the art.
[0050] The A Buffer, B Buffer and reaction dry powder in the RAA reaction system are all from the RAA-nfo nucleic acid amplification kit, which is purchased from Hangzhou Zhongce Biological Technology Co., Ltd.
[0051] The single nucleic acid detection test strip is purchased from Shanghai Sangon Biological Co., Ltd.
[0052] Example 1: Design of specific primers and probes
[0053] The cDNA was prepared using the RNA fast 200 total RNA extraction cat calicivirus RNA Prime Script TMIV 1st strand cDNA Synthesis Mix kit, and was stored at -20℃.
[0054] The positive plasmid was constructed, the recombinant plasmid DNA containing the target gene ORF1 fragment was constructed, the recombinant plasmid was transformed into DH5α competent cells for amplification, the plasmid was extracted using Plasmid Mini Kit I kit, the plasmid concentration was determined using a full-wavelength enzyme marker (Thermo Fisher), and the plasmid was stored at -20°C. The partial genomic sequence of the target gene ORF1 is shown below.
[0055] Target gene fragment:
[0056] ACAATGTTAGACTGGATGAACTACCCGCCAATCAACATGTGGTAACTGTTAATTCAGTGTTTGATTTGGCCTGGGCTCTTCGCCGGCACCTATCATTGACAGGGCAGTTCCAAGCCATCAGGGCCGCATATGATGTGCTTACTGCCCCTGACAAAATTCCTGCAATGTTGAGGCACTGGATGGATGAAACCTCCTTTTCAAATGAGCATGTGGTCACGCAATTCATTACACCTGGTGGCGTAGTGATCCTTGAATCGTGTGGTGGTGCTCGAATCTGGGCTATGGGTCACAATGTGATCCGCGCCGGGGGCGTTACCGCCACGCCCGTCGGTGGGTGTGTTAGGCTGATGGGACTCTCTGCTCAGACGATGCCATGGTCTGAAATCTTTAGGGAATTCT (SEQ ID NO. 5)
[0057] After comparing the complete sequences of a total of 141 cat calicivirus strains published in the GenBank database of NCBI within China, specific primers and probes were designed for the conserved region of cat calicivirus, as shown in Table 1. The primers and probes were synthesized and modified by Shanghai Sangon.
[0058] Table 1 List of primers and probes
[0059]
[0060] Note: In the XML format file of the sequence listing, r represents a or g, and y represents c or t.
[0061] The probe ORF1-probe consists of two sequences connected by tetrahydrofuran between the 3' end of SEQ ID NO. 3 and the 5' end of SEQ ID NO. 4; the sequence of the first part is shown in SEQ ID NO. 3, and the sequence of the second part is shown in SEQ ID NO. 4; the 5' end of SEQ ID NO. 3 is connected with carboxyfluorescein, and the 3' end of SEQ ID NO. 4 is connected with a C3 spacer.
[0062] ORF1-R: biotin-AYARTGTTAGRYTGGATGAACTACCCGCCA
[0063] Probe ORF1-probe: FAM-TGTGGTAACYGTTAATTCRGTGTT | THF | GATTTG GCCTGGGCT | C3-Spacer |.
[0064] Establishment and optimization of the reaction system in Example 2
[0065] In a total reaction system of 50 μL, 12.9 μL of sterilized water, 25 μL of A Buffer, 2 μL of forward primer with a concentration of 2 μM, 2 μL of reverse primer with a concentration of 2 μM, 0.6 μL of probe with a concentration of 2 μM, 5 μL of cDNA template, and 2.5 μL of B Buffer are contained.
[0066] The specific operation is as follows:
[0067] (1) The forward primer, the reverse primer, and the probe described above in Example 1 are respectively added to a centrifugal tube according to the volume, and 25 μL of A Buffer is added, followed by short shaking and rapid centrifugation; 5 μL of cDNA template and 12.9 μL of sterilized water are placed in a PCR tube, mixed, and then placed in the centrifugal tube, followed by short shaking and rapid centrifugation to obtain a mixed solution;
[0068] (2) The mixed solution is transferred to a reaction unit tube containing reaction dry powder, and mixed by flicking;
[0069] (3) 2.5 μL of B Buffer is added, and mixed thoroughly to activate the reaction;
[0070] (4) The reaction tube is placed in a thermostat at 39°C for incubation for 30 min;
[0071] (5) After the reaction is completed, 10 μL of reaction product is taken and mixed with 190 μL of sterilized water;
[0072] (6) Visual detection is performed using a single nucleic acid detection test strip: 80 μL of diluted sample is transferred to the sample pad of a single nucleic acid detection test strip; the result is observed after 2-5 min;
[0073] The result is determined as follows: two bands should appear in positive samples, and only one band at the control line in negative samples; when red bands appear at the quality control line and the detection line of the nucleic acid detection test strip, it is determined that the sample contains feline calicivirus.
[0074] Optimization of primer concentration: under the condition that other reaction components in the system remain unchanged, 2 μL, 1.5 μL, 1 μL and 0.5 μL of the upstream and downstream primers were respectively added to the reaction system, and sterile water was added to 50 μL, the reaction conditions remained unchanged, a negative control (sterile water) was set, and the primer concentration of the RAA-LFD detection method was optimized. Under different concentrations of primers, the positive standard plasmid was amplified and detected, and the results are shown in Figure 1 , and clear detection lines and quality control lines appeared at the lowest primer concentration of 1 μL.
[0075] In order to save the amount of primers, 1 μL of primer was used as the amount of reaction in the following.
[0076] Optimization of reaction temperature: under the condition that other reaction components in the system remain unchanged, the reaction temperature of the experiment was reacted according to the temperature gradient 37℃, 38℃, 39℃, 40℃, 41℃, a negative control (sterile water) was set, and the results are shown in Figure 2 , the band is the clearest at 39℃.
[0077] The reaction temperature of 39℃ was selected for the subsequent experiment.
[0078] Example 3 Determination of sensitivity test
[0079] The positive plasmid constructed was determined for concentration using a full-wavelength enzyme marker (Thermo Fisher), and the copy number was calculated according to the copy number calculation formula: copy number (copies / μL) = [DNA concentration (ng / μL) / fragment size (bp)] × 9.12 × 10 11 . Then the positive plasmid was diluted by 10 times, different dilutions of the positive plasmid were used as templates, the primer concentration and reaction conditions optimized in Example 2 were used, a negative control (sterile water) was set, and the sensitivity of the RAA-LFD detection method was determined.
[0080] The positive plasmid of different dilutions was detected according to the detection method of RAA-LFD in Example 2.
[0081] The results are shown in Figure 3 , and it can be seen from Figure 3 that when the first pair of primer set ORF1-F, ORF1-R and probe ORF1-probe are used for RAA-LFD application, the copy number is 8.67 × 10 3-8.67×10 1 When the detection line and quality control line were clear, the sensitivity of the method reached 8.67×10 1 copies / μL, while the sensitivity of PCR detection is about 10 3 The sensitivity of the detection method is about 100 times higher than that of the qPCR method. 2 copies / μL, the sensitivity of this detection method is increased by about 10 times compared with the above results, indicating that the RAA-LFD detection method in this experiment has high sensitivity.
[0082] Example 4 Determination of specificity test
[0083] To investigate whether the RAA-LFD detection method would cross-react with other common pathogens in cats, DNA or cDNA of Feline Herpesvirus Type 1 (FHV-1) and Feline Mamastrovirus (FAstV) were used as templates, positive plasmid DNA containing the ORF1 gene fragment of feline calicivirus was used as a template as a positive control, and cDNA of negative samples detected as feline calicivirus was used as a template as a negative control to evaluate the specificity of the RAA-LFD detection method.
[0084] The above different templates were detected according to the RAA-LFD detection method of the present invention.
[0085] The results are as follows Figure 4 Show, from Figure 4 It can be seen that no band appeared at the detection line of the colloidal gold immunochromatographic test strip sample pad after the negative control reacted with FPV and FHV-1 as templates, while a band appeared at the detection line of the colloidal gold immunochromatographic test strip sample pad of the positive control.
[0086] The above results indicate that this detection method does not cross-react with other common pathogens in cats, does not react non-specifically with host RNA, and has a high degree of specificity.
[0087] In summary, the present invention provides an RAA primer pair that specifically recognizes the conserved region gene of feline calicivirus and a probe with a FAM / Biotin dual label, and further optimizes the concentration of the primers and adopts the RAA-LFD technology to achieve high specificity and high sensitivity detection of feline calicivirus.
[0088] Although the above embodiments have been described in detail, it should be understood that these are only some embodiments of the present application, but not all embodiments. Other embodiments can be obtained based on the above embodiments without creativity, and these embodiments all belong to the protection scope of the present application.
Claims
1. A primer for detecting feline calicivirus, characterized in that The primers include a forward primer ORF1-F and a reverse primer ORF1-R; The sequence of the forward primer ORF1-F is shown in SEQ ID NO.1; The sequence of the reverse primer ORF1-R is shown in SEQ ID NO.
2.
2. The primer according to claim 1, characterized in that The 5' end of the forward primer ORF1-F sequence was modified with biotin.
3. A detection kit for detecting feline calicivirus, characterized in that The kit comprises the primer according to any one of claims 1 to 2.
4. The detection kit for detecting feline calicivirus according to claim 3, wherein The kit further comprises a probe ORF1-probe, which is composed of two sequences connected by tetrahydrofuran; the sequence of the first sequence is shown as SEQ ID NO.3, and the sequence of the second sequence is shown as SEQ ID NO.
4.
5. The detection kit for detecting feline calicivirus according to claim 4, wherein The 5' end of SEQ ID NO.3 is connected to carboxyfluorescein; the 3' end of SEQ ID NO.4 is connected to the C3 spacer arm; the 3' end of the probe SEQ ID NO.3 and the 5' end of SEQ ID NO.4 are connected via tetrahydrofuran.
6. The detection kit for detecting feline calicivirus according to claim 3, wherein The kit also includes a negative control sample, a positive control sample, a buffer solution, and a test strip.
7. A method for detecting feline calicivirus for non-diagnostic purposes, characterized in that The method comprises the following steps: S1: Using the total RNA of the sample to be tested as a template, prepare cDNA using reverse transcription reagents; S2: performing RAA reaction with the cDNA prepared in step S1 using the kit according to any one of claims 3 to 6, and obtaining a reaction product after isothermal amplification; S3: Visually detect the reaction product obtained in step S2 using a nucleic acid-colloidal gold immunochromatographic test strip.
8. The detection method according to claim 7, characterized in that The concentration of cDNA in step S1 was 8.67×10 1 copies / μL.
9. The detection method according to claim 7, characterized in that The RAA reaction in step S2 is incubated at a constant temperature of 37-41°C.
10. The detection method according to claim 7, characterized in that: The primer concentration in the kit in step S2 is 2 μm / μL.