Cyrtomium fortunei eplpp1-5 gene and application thereof
By cloning and expressing the CePLPP1-5 gene of tiger nut, the problem of insufficient research on genes related to tiger nut oil synthesis was solved, and the oil content of yeast and Arabidopsis thaliana was significantly increased.
Patent Information
- Application Number
- CN202310979411.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-08-05
- Publication Date
- 2026-04-07
- Estimated Expiration
- 2043-08-05
AI Technical Summary
Current technologies lack molecular biology research on tiger nuts, and there is a lack of in-depth understanding of genes related to oil synthesis, making it difficult to increase oil content.
The CePLPP1-5 gene of tiger nuts was cloned and expressed. The CePLPP1-5 gene was inserted into yeast and Arabidopsis thaliana through recombinant yeast expression vector pESC-URA and plant expression vector pCAMBIA3301 to increase the oil content.
It significantly increased the content of DAG and TAG in yeast cells and improved the oil content in Arabidopsis thaliana, laying the foundation for tiger nut plants with high oil content.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bioengineering technology, specifically relating to the Ce PLPP1-5 gene in tiger nuts and its applications. Background Technology
[0002] Tiger nuts (Cyperus esculentusis), also known as tiger nut, originated in the Mediterranean region of Africa. They possess advantages such as wide adaptability, strong resistance to adverse conditions, and high yield; their oil yield per unit area is four times that of soybeans, earning them the reputation of a new oilseed crop. Tiger nut oil contains over 80% unsaturated fatty acids and is rich in nutrients. Researching the biosynthetic pathways of oil in tiger nut tubers lays the foundation for understanding the mechanism of oil synthesis in plant tubers. Furthermore, it allows for the targeted improvement of tiger nut germplasm resources and the discovery of candidate genes related to oil synthesis in tubers through genetic engineering. Current research on tiger nuts mainly focuses on introduction, cultivation, and analysis of tuber oil components, with relatively limited research in molecular biology. Summary of the Invention
[0003] The purpose of this invention is to solve the above-mentioned problems by providing a CePLPP1-5 gene for tiger nuts and its application.
[0004] The CePLPP1-5 gene for tiger nuts has its base sequence shown in SEQ ID NO.1 of the sequence listing.
[0005] The CePLPP1-5 gene of tiger nuts was reverse transcribed from the RNA of tiger nut tubers into cDNA. Using the cDNA as a template, primers were used:
[0006] CePLPP1-5F: ATGGCACTGGGGAAGCTGG
[0007] CePLPP1-5R: TCACATTTTTTTGGCCAAAAT
[0008] Obtained by PCR amplification.
[0009] A recombinant yeast expression vector, which is a plant expression vector into which the gene shown in SEQ ID NO.1 is inserted;
[0010] The yeast expression vector is pESC-URA;
[0011] A recombinant plant expression vector, wherein the gene shown in SEQ ID NO.1 is inserted into a plant expression vector;
[0012] The plant expression vector is pCAMBIA3301;
[0013] Application of the CePLPP1-5 gene in tiger nut in increasing the oil content of plant tubers;
[0014] The plant in question is tiger nut or Arabidopsis thaliana;
[0015] The CePLPP1-5 gene of tiger nuts has its nucleotide sequence shown in SEQ ID NO.1 of the sequence listing;
[0016] The method for preparing the CePLPP1-5 gene from tiger nuts involves reverse transcription of RNA from tiger nut tubers into cDNA, using the cDNA as a template and primers:
[0017] CePLPP1-5F: ATGGCACTGGGGAAGCTGG
[0018] CePLPP1-5R: TCACATTTTTTTGGCCAAAAT
[0019] Obtained by PCR amplification;
[0020] A recombinant yeast expression vector, wherein the gene shown in SEQ ID NO.1 is inserted into a yeast expression vector;
[0021] The yeast expression vector is pESC-URA;
[0022] A recombinant plant expression vector, wherein the gene shown in SEQ ID NO.1 is inserted into a plant expression vector;
[0023] The plant expression vector is pCAMBIA3301;
[0024] The application of the CePLPP1-5 gene in tiger nuts in increasing plant oil yield.
[0025] The plant in question is tiger nut or Arabidopsis thaliana;
[0026] Application of the CePLPP1-5 gene in tiger nuts in improving yeast oil production;
[0027] The application of the CePLPP1-5 gene from tiger nuts in increasing the DAG and TAG content in yeast.
[0028] This invention discloses a CePLPP1-5 gene for tiger nuts, the nucleotide sequence of which is shown in SEQ ID NO.1. The CePLPP1-5 gene of this invention is obtained by reverse transcription of RNA from tiger nut tubers into cDNA, followed by PCR amplification using primers with the cDNA as a template. The application of the CePLPP1-5 gene in increasing the oil content of tiger nut tubers shows that: transferring the CePLPP1-5 gene from tiger nuts into *Saccharomyces cerevisiae* significantly increases the DAG and TAG content in yeast cells; transferring the CePLPP1-5 gene into *Arabidopsis thaliana* revealed that the oil content in T3 generation seeds was significantly higher than that of wild-type lines. This invention demonstrates that expression of the CePLPP1-5 gene in tiger nuts can increase oil content, laying the foundation for cultivating new tiger nut varieties with high oil content. Attached Figure Description
[0029] Figure 1 RNA extraction from tiger nut tubers;
[0030] Figure 2 PCR image of bacterial culture containing CePLPP1-5 gene ligation cloning vector;
[0031] Figure 3 PCR identification of the pESC-URA-CePLPP1-5 recombinant vector in bacterial culture;
[0032] Figure 4 pESC-URA-CePLPP1-5 recombinant vector was transformed into Saccharomyces cerevisiae culture and identified by PCR.
[0033] Figure 5 Staining identification of lipid content in Saccharomyces cerevisiae cells;
[0034] Figure 6 Detection of DAG and TAG content in Saccharomyces cerevisiae cells;
[0035] Figure 7 Determination of TAG content in transgenic Arabidopsis thaliana control group and seeds transgenic with CePLPP1-5 gene; Detailed Implementation
[0036] Example 1: RNA extraction and reverse transcription from tiger nuts
[0037] Experimental materials: Tiger nuts HJ2 (Cyperus esculentus) cultivated by Jilin Agricultural University were planted, and fresh tiger nut tubers were harvested; the experimental steps are as follows:
[0038] 1. RNA extraction from tiger nut tubers
[0039] RNA was extracted from tiger nut tubers using extraction reagents from Taraka Biotechnology (Beijing) Co., Ltd. The specific steps are as follows:
[0040] (1) After washing the tiger nut tubers with running water and drying the surface moisture, grind them thoroughly with liquid nitrogen. Take an appropriate amount of the ground sample, add it to a 1.5 mL RNA-specific centrifuge tube, add 1 mL RNAiso PLUS and shake vigorously. Let it stand at room temperature for 5 min.
[0041] (2) Centrifuge at 13,000 rpm for 10 min at 4℃, take 700 uL of supernatant and transfer it to a new 1.5 mL centrifuge tube, add 200 uL of chloroform, mix thoroughly and let stand at room temperature for 5 min.
[0042] (3) Centrifuge at 13,000 rpm for 15 min at 4℃, take 400 uL of supernatant, add 1 mL of isopropanol, and let stand at room temperature for 10 min.
[0043] (4) Centrifuge at 13,000 rpm for 15 min at 4℃, discard the supernatant, and take 1 mL of 75% ethanol to wash the precipitate.
[0044] (5) Centrifuge at 7500 rpm for 5 min at 4℃, discard the supernatant, and use a pipette to remove the ethanol from the tube.
[0045] (6) Take 25 uL of DEPC water to fully dissolve the precipitate, and the solution is the extracted RNA.
[0046] The concentration was determined using Nanodrop, and the purity was simultaneously detected using agarose gel electrophoresis. Figure 1 As shown, 28S rRNA and 18S rRNA are clearly visible and bright, with 28S rRNA being approximately twice as bright as 18S rRNA, indicating that RNA extraction was complete.
[0047] 2. Synthesis of the first strand of cDNA
[0048] RNA stored at -80℃ was reverse transcribed according to the instructions of the reverse transcription kit. The reaction system is shown in Table 1. The cDNA after reverse transcription was stored at -20℃ for later use.
[0049] Table 1 Reverse transcription reaction system
[0050] reagents Reaction system (10 μL) gDNA Eraser 1 5×gDNA Eraser Buffer 2 RNase Free Water 5 Total RNA 2
[0051] Centrifuge at 42℃ for 2 min, and collect all liquid to the bottom of the tube. The reaction system for the second step is shown in Table 2.
[0052] Table 2 Reverse transcription reaction system
[0053] reagents Reaction system (10 μL) Prime Script RT Enzyme Mix I 1 5×Prime Script Buffer II 4 RT Prime Mix I 1 RNase Free Water 4
[0054] Centrifuge at 37°C for 15 min; then at 85°C for 5 s. After the reaction is complete, centrifuge again and collect the sample in a -20°C refrigerator for later use.
[0055] Example 2 Cloning of the coding region sequence of CePLPP1-5 gene in tiger nuts
[0056] This project used cDNA from tiger nut tubers as a template, designed specific primers for PCR amplification, and amplified the CePLPP1-5 gene. The PCR reaction system is shown in Table 3, and the reaction time is shown in Table 3-1.
[0057] Cloning primers:
[0058] CePPLP1-5F: ATGGCACTGGGGAAGCTGG
[0059] CePPLP1-5R: TCACATTTTTTTGGCCAAAAT
[0060] cDNA from tiger nut tubers was amplified, and the amplified product was ligated into the T1-Simple cloning vector. The resulting cells were then transformed into DH5α competent E. coli cells. Single colonies were picked and subjected to culture PCR amplification. A clear and bright band was observed at 1266 bp by agarose gel electrophoresis, indicating successful cloning of the vector. Figure 2 ).
[0061] Table 3. CePLPP1-5 gene PCR reaction system
[0062] Element System (μL) PCR Taq Mix 12.5 Primer F 1 Primer R 1 cDNA 2 <![CDATA[ddH2O]]> 8.5
[0063] Table 3-1 PCR Reaction Conditions
[0064] condition time 95℃ 5 min 95℃ 5 s 58℃ 30 s 72℃ 1.1 min 4℃ 7 min
[0065] Example 3 Construction of yeast expression vector for tiger nuts CePLPP1-5 gene
[0066] The yeast expression vector pESC-URA was purchased from Beijing Huayueyang Biotechnology Co., Ltd. It is a URA-deficient vector with dual promoters of GAL1 and GAL10, and FLAG and myc as protein tags. The vector contains Not I and Cla I restriction sites, and recombinant primers were designed using the above two restriction sites.
[0067] Recombinant primers:
[0068] ATAAGAAT GCGGCCGC ATGGCACTGGGGAAGCTGG
[0069] CC ATCGAT TCACATTTTTTTGGCCAAAAT
[0070] The pESC-URA-CePLPP1-5 recombinant vector was double-digested using the two enzymes mentioned above. The products were recovered by gel electrophoresis. The target fragment was ligated to the linearized vector. 5 μL of the ligation product was transferred to 100 μL of competent E. coli cells, gently vortexed to mix, and incubated on ice for 30 min. The cells were then subjected to a 42°C water bath for 30 s, followed by another 2 min on ice. 400 μL of E. coli liquid culture medium was added, and the mixture was incubated at 37°C for 1 h on a shaker at 200 rpm. The mixture was centrifuged at 8000 rpm for 1 min, and approximately 100 μL of supernatant was reserved to resuspend the bacterial pellet. The resuspended pellet was plated onto LB / K+ solid medium and incubated at 37°C for 12 h. Single clones were picked and cultured for identification by PCR. Figure 3 The target band was 1266 bp in size and bright, indicating successful construction of the expression vector. It was named pESC-URA-CePLPP1 and transformed into *Saccharomyces cerevisiae*. The specific transformation steps are as follows:
[0071] (1) Take 50 µL of competent cells of Saccharomyces cerevisiae INVSC1, place them on ice, and add 1-4 µg of pre-cooled recombinant plasmid, 10 µL of carrier DNA (95-100℃, 5 min, immediately ice bath, repeat once) and 0.4 mL of PEG / LiAc in a semi-freeze-thaw state. Mix well by pipetting and incubate in a 30℃ water bath for 30 min (invert once during the incubation period).
[0072] (2) Place the centrifuge tubes in a 42°C water bath for 15 min (invert once during the process).
[0073] (3) Centrifuge at 6000 rpm for 30 s and discard the supernatant. Resuspend in 300 µL of sterile ddH2O and centrifuge for 30 s and discard the supernatant.
[0074] (4) Resuspend in 50 µL of ddH2O, spread on auxotrophic SD-URA solid medium, and incubate at 30℃ for 48 h-96 h. Screen positive transformants using auxotrophic SD-URA medium for colony PCR identification. Figure 4 As shown, the target band size is 1266 bp, indicating that the target gene has been successfully transferred into Saccharomyces cerevisiae.
[0075] Example 4: Induction of recombinant protein expression in Saccharomyces cerevisiae
[0076] (1) The correctly identified recombinant positive transformant pESC-URA-CePLPP1-5 was inoculated into 20 mL of SD-URA liquid medium and cultured in a shaker at 30℃ and 220 rpm for 24 h to activate it. At the same time, the empty vector pESC-URA-0 without the target gene was selected as a negative control.
[0077] (2) Take 2% of the activated bacterial solution and transfer it to 30 mL of SD-URA liquid medium. Ferment at 30℃ and 220 rpm for 48 h.
[0078] (3) Centrifuge the fermentation broth at 4℃ and 6000 rpm for 5 min, resuspend it three times with sterile 0.9% NaCl solution, and finally resuspend the cells with an equal volume of SC-URA liquid medium. At the same time, add 2% galactose for continuous induction culture for 24 h, 36 h, 48 h, 60 h, 72 h, and 84 h, and add galactose every 12 h. Extract the total protein from the galactose-induced cells using the acid-washed glass bead method. The specific method is as follows:
[0079] (1) After pre-cooling solution A, take 4 mL and put it into a 50 mL centrifuge tube. Add 10 mL of induced yeast cells and mix thoroughly.
[0080] (2) Centrifuge at 4℃ and 6000 rpm for 5 min to precipitate yeast cells and discard the supernatant.
[0081] (3) Take 20 µL of solution B and mix it thoroughly with the yeast cells, and quickly transfer it to a centrifuge tube.
[0082] (4) Place the 1.5 mL centrifuge tube in a 100℃ water bath for 3 min to inactivate the protease, and then place the sample in a -20℃ refrigerator.
[0083] (5) Add 0.1g of acid-washed glass beads to the sample and shake for 10 min.
[0084] (6) Add 70 µL of solution B, shake slightly, and place in a 100℃ water bath for 1 min.
[0085] (7) Take 10 µL of the extract and store it in a -20℃ refrigerator.
[0086] SDS-PAGE gel electrophoresis of the extracted protein samples showed that the recombinant protein expression level was highest at 48 h of induction, indicating that 48 h is the optimal time for recombinant protein induction.
[0087] Example 5: Staining analysis of lipid content in transgenic Saccharomyces cerevisiae
[0088] (1) Take 0.5 mL of the induced bacterial culture and centrifuge at 12000 rpm for 2 min;
[0089] (2) After resuspending the bacterial cells in 50 μL of 1×PBS buffer, add 2 μL of 1 mg / mL Nile Red for staining;
[0090] (3) Vortex mix for 1 min, then place in the dark for 10 min;
[0091] (4) Prepare slides and observe under a fluorescence microscope;
[0092] Nile red staining analysis of yeast cells yielded the following results: Figure 5 As shown: Saccharomyces cerevisiae cells without recombinant vector (A-1) and those with recombinant vector but not induced (A-2) were taken as controls. After 48 h of induction, the number of oil droplets in yeast cells (Figure A-3) increased and the density increased compared with the control group, indicating that the oil content in yeast cells increased after CePLPP1-5 gene overexpression.
[0093] Example 6: Detection of TAG and DAG content in transgenic Saccharomyces cerevisiae
[0094] (1) Take 3 L of induced bacterial cells, centrifuge at 6000 rpm for 15 min, and collect the bacterial cell precipitate;
[0095] (2) After freeze-drying the collected bacterial cells for 48 h, grind them thoroughly;
[0096] (3) Add 10 mL of 4 mol / L HCl to each 1 g of bacterial cells, mix thoroughly, let stand at room temperature for 10 min, boil in 100℃ water for 3 min, and immediately cool at -20℃.
[0097] (4) Add 3 times the volume of (chloroform:methanol=1:1), mix well, centrifuge at 4000 rpm for 25 min, take the lower chloroform solution, add an equal volume of 0.15% NaCl solution, mix well, centrifuge again, and separate the lower chloroform solution into a 10 mL centrifuge tube that has been weighed.
[0098] (5) Evaporate chloroform at room temperature for 36 h. Calculate the total oil content (%) using the following formula:
[0099] W = (W2 - W1) / W0 × 100%
[0100] In the formula, W is the oil content in yeast (%), W1 is the weight of the centrifuge tube (mg), W2 is the total weight of the centrifuge tube and oil (mg), and W0 is the weight of the yeast cells;
[0101] (6) Empty vector bacterial suspension and uninduced bacterial suspension were taken as negative control groups, and the experimental groups were bacterial suspensions induced with 2% galactose for 24 h, 36 h, 48 h, 60 h, 72 h and 84 h respectively.
[0102] (7) Take 20 mL of each of the above bacterial solutions, centrifuge at 12000 rpm for 6 min, resuspend the obtained bacterial cells, freeze and thaw repeatedly, centrifuge at 5000 rpm for 10 min, collect the supernatant, and label them respectively.
[0103] (8) Use the ELISA kit provided by Shanghai Keaibo Biotechnology Co., Ltd. to detect DAG content, such as... Figure 6 As shown, the contents of TAG and DAG were highest 48 hours after induction compared to the control.
[0104] Example 7: Construction of the pCAMBIA3301-CePLPP1-5 recombinant vector and its transformation with Agrobacterium.
[0105] Recombinant primers were designed using the upstream and downstream sequences of the Bgl II and Pml I restriction sites in the pCAMBIA3301 vector and the CePLPP1-5 gene cloning primers.
[0106] Recombinant primers:
[0107] GA AGATCT ATGGCACTGGGGAAGCTGG
[0108] C CACGTG TCACATTTTTTTGGCCAAAAT
[0109] The vector was double-digested using the two enzymes mentioned above, and the products were recovered by gel electrophoresis. The target fragment was ligated to the linearized vector. 5 μL of the ligation product was transferred to 100 μL of competent *E. coli* cells, gently vortexed to mix, and incubated on ice for 30 min. The cells were then subjected to a 42°C water bath for 30 s heat shock, followed by another 2 min on ice. 400 μL of *E. coli* liquid culture medium was added, and the mixture was incubated at 37°C for 1 h using a shaker at 200 rpm. The mixture was then centrifuged at 8000 rpm for 1 min, and approximately 100 μL of supernatant was reserved to resuspend the bacterial pellet. The resuspended pellet was plated onto LB / k+ solid medium and incubated at 37°C for 12 h. Single clones were picked and cultured for colony PCR identification. The target band was 1266 bp in size and bright, confirming successful construction of the expression vector. The vector was named pCAMBIA3301-CePLPP1-5 and transformed into *Agrobacterium*. The specific transformation steps are as follows:
[0110] (1) Take 50 μL of EHA105 competent cells and 1 μg of recombinant plasmid, and add them sequentially to a sterile centrifuge tube. Mix well by pipetting.
[0111] (2) Ice bath for 30 min, liquid nitrogen pre-cooling for 5 min, heat shock at 37℃ for 5 min, ice bath again for 5 min;
[0112] (3) Add 1000 μL of YEP liquid culture medium (without resistance) to the centrifuge tube and incubate at 28°C for 2 h in a constant temperature shaker.
[0113] (4) Centrifuge at 5000 rpm for 1 min;
[0114] (5) Discard the supernatant and reserve about 100 μL of supernatant to resuspend the bacterial cells;
[0115] (6) Apply the entire bacterial solution to YEP / Rif+K + Incubate on the culture medium at 28°C, inverted for 2 days;
[0116] (7) Pick a single colony from the culture medium and inoculate it into resistant YEP liquid medium. Incubate overnight at 28°C and 180 rpm.
[0117] (8) Perform PCR amplification and detection on the bacterial culture. After PCR, analyze the culture by 1% agarose gel electrophoresis, select the bacterial culture with the correct target fragment size, store it in glycerol, label it and store it in a -80℃ refrigerator.
[0118] Example 8: Transformation diagram of CePLPP1-5 gene in tiger nuts and determination of oil content in transgenic seeds
[0119] The constructed pCAMBIA3301-CePLPP1-5 recombinant expression vector was transformed into Arabidopsis thaliana via inflorescence infection. T3 generation seeds were obtained through Basta screening, and their oil content was determined by collecting T3 seeds. The specific method for oil content determination is as follows:
[0120] (1) Take plump T3 generation transgenic Arabidopsis thaliana and wild-type Arabidopsis thaliana seeds and dry them in an oven at 50℃ until constant weight. Then crush the seeds to obtain Arabidopsis thaliana seed powder.
[0121] (2) Weigh 1 g of Arabidopsis thaliana seed powder into a 50 mL beaker, add 30 mL of n-hexane organic reagent, place it in an ultrasonic machine with a power of 100 W, an instrument temperature of 70℃, and an extraction time of 1.5 h.
[0122] (3) After extraction, the remaining extract was transferred to a test tube for rotary evaporation (temperature 50℃, vacuum degree 0.05~0.06 MPa, time about 30 min), the solvent was recovered, and finally dried to constant weight to obtain Arabidopsis seed oil. The oil yield was calculated by weighing.
[0123] (4) Each group of experiments was repeated 3 times and the average value was taken.
[0124] (5) The extraction rate of oil from Arabidopsis thaliana seeds is calculated using the following formula:
[0125] W = (W2 - W1) / W0 × 100%
[0126] In the formula, W is the oil extraction rate (%), W2 is the total weight of the test tube and oil (mg), W1 is the weight of the test tube (mg), and W0 is the sample weight.
[0127] The results are as follows Figure 7 As shown, the oil content in the seeds of all six Arabidopsis thaliana lines overexpressing the CePLPP1-5 gene was significantly increased, and significantly higher than that of the wild-type Arabidopsis thaliana lines. These experimental results indicate that the CePLPP1-5 gene is beneficial for increasing the oil content in eukaryotic yeast and plants.
Claims
1. The CePLPP1-5 gene of tiger nuts, whose nucleotide sequence is shown in SEQ ID NO.1 of the sequence listing.
2. A method for preparing the CePLPP1-5 gene from tiger nuts, characterized in that: RNA from tiger nut tubers was reverse transcribed into cDNA. Using the cDNA as a template, primers were then applied. CePLPP1-5F: ATGGCACTGGGGAAGCTGG CePLPP1-5R: TCACATTTTTTTGGCCAAAAT Obtained by PCR amplification.
3. A recombinant yeast expression vector, wherein the gene shown in SEQ ID NO.1 is inserted into the yeast expression vector.
4. The recombinant yeast expression vector according to claim 3, characterized in that: The yeast expression vector is pESC-URA.
5. A recombinant plant expression vector, wherein the gene shown in SEQ ID NO.1 is inserted into a plant expression vector.
6. The recombinant plant expression vector according to claim 5, characterized in that: The plant expression vector is pCAMBIA3301.
7. The application of the CePLPP1-5 gene of tiger nuts as described in claim 1 in increasing plant oil yield, wherein the plant is tiger nut or Arabidopsis thaliana.
8. The application of the CePLPP1-5 gene of tiger nuts as described in claim 1 in increasing the oil yield of yeast.
9. The application of the CePLPP1-5 gene of tiger nuts as described in claim 1 in increasing the DAG and TAG content in yeast.
Citation Information
Patent Citations
Breeding method of new high-yield and saline-alkaline tolerant cyperus esculentus variety
CN115005021A
Engineering lipids in vegetative tissues of plants
WO2010088426A1