A diagnostic biomarker for active SLE and its application

Abstract

This invention provides the use of VSTM1 expression levels or the degree of oxidation modification of its ligand Galectin-1, or the degree of interaction between the two, in the diagnosis of active SLE. This invention verified by flow cytometry that neutrophil ROS levels are increased in SLE patients, and that SLE patient serum significantly promotes increased neutrophil ROS formation and cell death. In neutrophils of active SLE patients, VSTM1 expression levels at both mRNA and protein levels were significantly lower than in healthy controls. Simultaneously, the binding of VSTM1 to its serum ligand Galectin-1 inhibited neutrophil ROS formation and cell death. In active SLE patients, the binding degree of VSTM1 to Galectin-1 was significantly reduced. The degree of Galectin-1 oxidation in SLE serum was higher than in healthy controls, and oxidized Galectin-1 could not bind to the receptor VSTM1, resulting in increased neutrophil ROS and cell death. These results indicate that the expression of receptor VSTM1, the oxidation of ligand Galectin-1, and the binding of receptor VSTM1 and ligand Galectin-1 can all serve as diagnostic markers for patients with active SLE.

Description

Technical Field

[0001] This invention belongs to the field of biological detection, specifically relating to a diagnostic biomarker for active SLE and its application. Background Technology

[0002] Systemic lupus erythematosus (SLE) is a severe autoimmune disease that commonly affects multiple organs and systems. Its main clinical feature is the deposition of various autoantibodies and immune complexes in the serum. SLE exhibits high heterogeneity, affecting a wide range of tissues and organs. Joint, skin, and mucous membrane lesions are the most common manifestations of SLE, but it also frequently involves vital organs such as the kidneys and nervous system. These factors severely impact patient prognosis, resulting in high rates of disability and mortality. Even though the affected population is predominantly young women, the 15-year cumulative mortality rate remains as high as 20%. Furthermore, the treatment costs and loss of earning capacity caused by the disease place a heavy economic burden on individuals, families, and the national healthcare system.

[0003] Lupus nephritis (SLE) presents significant challenges to clinical diagnosis due to its complexity and heterogeneity. Currently, there is a lack of sensitive and specific biomarkers for SLE diagnosis, leading to a high misdiagnosis rate. As early as 1982, anti-double-stranded DNA (dsDNA) antibodies were used as a diagnostic and etiological standard for SLE, exhibiting high specificity (95%) but relatively low sensitivity (52%). Decreased complement C3 and C4 levels are also common serum markers in SLE; simultaneous decreases in both C3 and C4 have a sensitivity of 45% and a specificity ranging from 88% to 96%. In addition, urinary sediment and proteinuria are widely used in the diagnosis of lupus nephritis. However, these diagnostic markers mostly appear after organ damage and disease progression, making early diagnosis of SLE impossible. Therefore, in-depth research into the pathogenesis of SLE and the search for novel and effective diagnostic biomarkers and therapeutic targets, especially early-stage diagnostic biomarkers, are crucial for improving the diagnosis and treatment of SLE.

[0004] Abnormal immune regulation and loss of autoimmune tolerance are among the main immunopathological mechanisms of SLE, with both intrinsic and adaptive immune dysregulation participating in the disease's development. Most current research focuses on the role of B lymphocytes, T lymphocytes, and dendritic cells in the pathogenesis of systemic lupus erythematosus. However, with further research, it has been discovered that neutrophils are involved in SLE pathogenesis, potentially exhibiting abnormalities in the early stages of the disease. Neutrophils are the primary source of autoantigens in SLE patients. In SLE patients, autoantibodies activate neutrophils, causing them to release a network containing DNA and antimicrobial peptide complexes, known as neutrophil extracellular traps (NETs). NETs that cannot be cleared in time become a major source of autoantigens. Neutrophil death caused by NETs release is called NETosis, a unique mode of neutrophil death. SLE patients experience abnormal cell death through multiple pathways, including NETosis, apoptosis, and ferroptosis, resulting in a significantly lower neutrophil count than healthy individuals, while simultaneously releasing large amounts of autoantigens, triggering an autoimmune response. Regardless of the mode of cell death, the massive production of ROS is an indispensable condition. One of the most prominent characteristics of neutrophils after activation is a powerful oxygen burst, during which a large amount of oxygen is consumed and converted into ROS.

[0005] In maintaining neutrophil ROS homeostasis, the intracellular redox system plays a direct regulatory role. On the other hand, cells can also inhibit ROS production by negatively regulating ROS-related signaling pathways through immunosuppressive receptors. A common characteristic of immunosuppressive receptors is the presence of one or more conserved immunoreceptor tyrosine-based inhibitory motifs (ITIMs) in their intracellular domains. After binding to ligands, these immunosuppressive receptors can phosphorylate ITIMs, recruiting downstream phosphatases such as SHP1 and SHP2 to exert immunosuppressive effects. V-set and transmembrane domain-containing protein 1 (VSTM1) is a novel immunosuppressive receptor containing two intracellular immunoreceptor tyrosine inhibitory motifs (ITIMs) that can recruit the phosphatase SHP-1 to transmit inhibitory signals. VSTM1 is a novel gene encoding immune regulation. This gene, located on chromosome 19q13.42, consists of 11 exons and 10 introns, and has five splice variants: VSTM1-v1, v2, v3, v4, and v5, with v1 and v2 being the most prevalent. VSTM1-v1, with 236 amino acids, is a type I transmembrane protein containing two intracellular ITIM motifs and is a novel immunosuppressive receptor. Studies have shown that VSTM1-activated antibodies can inhibit phagocytic Fc receptor-mediated ROS production by suppressing the MEK-ERK signaling pathway and inhibit NET formation induced spontaneously by SLE neutrophils, by antibody stimulation, or by sodium urate crystal stimulation. However, whether VSTM1 is directly related to the occurrence of SLE, and through what mechanism it participates in SLE pathogenesis, remains unclear. The ligand of VSTM1 in its physiological state is unknown; identifying its physiological ligand is crucial for clarifying the mechanism by which VSTM1 exerts its physiological function in vivo. Our study is the first to discover that serum galectin-1 is its physiological ligand. Galectin-1 is a member of the galactose lectin family. It has a sugar recognition domain that recognizes and binds to β-galactose and participates in a variety of physiological and pathological processes, including cell adhesion, apoptosis, and immune responses.

[0006] Cellular oxidative homeostasis plays a crucial role in various diseases, including SLE. However, due to the difficulty in measuring and assessing cellular oxidative state, no redox-related substances have yet been developed as disease biomarkers. Researching the role of ligand-receptor pairs regulating cellular ROS in the pathogenesis of SLE will not only deepen our understanding of the disease but also have significant clinical implications for the development of novel diagnostic biomarkers. Summary of the Invention

[0007] To address the above problems, this invention provides a diagnostic biomarker for active SLE and its application.

[0008] This invention first provides the use of anti-V-set and transmembrane domain protein 1, namely VSTM1 antibody and / or anti-Galectin-1 antibody in the preparation of reagents for diagnosing patients with active SLE.

[0009] In one specific embodiment of the invention, the diagnosis includes measuring the VSTM-1 level in a biological sample presenting with active SLE by enzyme-linked immunosorbent assay (ELISA); comparing the VSTM-1 level in the biological sample with control data, wherein a significant decrease in VSTM-1 in the sample relative to the control data indicates the likelihood of having active SLE.

[0010] In one specific embodiment of the invention, the diagnosis includes: measuring the level of VSTM-1 and ligand Galectin-1 conjugates in a biological sample presenting with active SLE; comparing the level of VSTM-1 and ligand Galectin-1 conjugates in the biological sample with control data, wherein a significant reduction in VSTM-1 and ligand Galectin-1 conjugates in the sample relative to the control data indicates the likelihood of having active SLE.

[0011] In one specific embodiment of the invention, the diagnosis includes: measuring the level of reduced Galectin-1 protein in a biological sample presenting with active SLE; comparing the level of reduced Galectin-1 protein in the biological sample with control data, wherein a significant reduction in reduced Galectin-1 protein in the sample relative to the control data indicates the likelihood of having active SLE.

[0012] The level of the VSTM-1-Galectin-1 conjugate was determined by the following steps:

[0013] The anti-VSTM1 antibody was incubated with neutrophil protein of the sample to be tested. After enriching an equal amount of VSTM1 protein, it was co-incubated with serum protein. The enriched Galectin-1 protein content was detected by enzyme-linked immunosorbent assay (ELISA) using anti-Galectin-1 antibody.

[0014] The reduced Galectin-1 protein was determined using the following steps:

[0015] Serum samples were incubated with biotin-conjugated indole-3-acetamide (IAM) to bind to reduced thiol sites in proteins. Proteins containing reduced thiol sites were then enriched using streptavidin magnetic beads. The content of reduced Galectin-1 protein in the enriched reduced proteins was detected by enzyme-linked immunosorbent assay (ELISA) using an anti-Galectin-1 antibody. Compared with healthy control data, a significant decrease in reduced Galectin-1 protein in serum indicated the likelihood of having active SLE.

[0016] The level of VSTM1 is measured through the following steps:

[0017] a. Contact the antibody with a biological sample from the patient;

[0018] b. An antibody-protein complex is formed between VSTM1 present in the biological sample and the antibody;

[0019] c. Washing to remove any unbound antibodies;

[0020] d. Add labeled detection antibodies that are reactive to antibodies from biological samples;

[0021] e. Washing to remove any unbound labeled detection antibodies;

[0022] f. Convert the marker of the detection antibody into a detectable signal.

[0023] The detection antibody is labeled by covalently linking to an enzyme, a marker having a fluorescent compound or a metal, or a marker having a chemiluminescent compound.

[0024] The biological sample is neutrophils isolated from serum or peripheral blood.

[0025] The specific methods for detecting the content of reduced Galectin-1 protein in the enriched reduced protein using enzyme-linked immunosorbent assay (ELISA) with anti-Galectin-1 antibody, and for detecting the content of enriched Galectin-1 protein using anti-Galectin-1 antibody via ELISA, are well known in the art. For example, the aforementioned method for detecting VSTM1 content using anti-VSTM1 antibody can be referred to.

[0026] The present invention also provides the use of anti-VSTM1 antibody in detecting Galectin-1 content. Specifically, the anti-VSTM1 antibody is incubated with neutrophil protein of the sample to be tested, and after enrichment to an equal amount of VSTM1 protein, it is co-incubated with serum protein. The enriched Galectin-1 protein content is detected by enzyme-linked immunosorbent assay (ELISA) using the anti-Galectin-1 antibody.

[0027] The present invention also provides a method for detecting Galectin-1 content, comprising incubating an anti-VSTM1 antibody with neutrophil protein of a sample to be tested, and then co-incubating it with serum protein after enriching an equal amount of VSTM1 protein, and detecting the enriched Galectin-1 protein content by enzyme-linked immunosorbent assay (ELISA) using an anti-Galectin-1 antibody.

[0028] The present invention also provides the use of the VSTM1 gene in the preparation of reagents for diagnosing patients with active SLE.

[0029] The diagnosis includes: measuring the expression level of the VSTM1 gene in biological samples obtained from patients presenting with active SLE; optionally,

[0030] The expression level of the VSTM1 gene in the biological sample was compared with control data, wherein a detectable decrease in the expression level of the VSTM1 gene in the sample relative to the control data indicates the likelihood of having active SLE.

[0031] The biological sample is neutrophils isolated from serum or peripheral blood.

[0032] The expression level of the VSTM1 gene was measured using the following steps: reverse transcription PCR, Real-Time PCR, and / or Northern Blotting.

[0033] The present invention also provides a detection kit for active SLE, comprising an antibody reactive to VSTM1 or Galectin-1 or fragments thereof, or a primer pair for amplifying the VSTM1 gene.

[0034] In embodiments of the present invention, the primer pairs are all primer pairs that can be used to amplify the gene, and may be one or more pairs. In one specific embodiment, the primer pair sequences are shown in SEQ ID No. 1 and SEQ ID No. 2.

[0035] This invention demonstrates that the expression levels of VSTM1, both at the mRNA and protein levels, are significantly lower in neutrophils of patients with active SLE compared to healthy controls. The protein content of Galectin-1, the ligand that binds to VSTM1, is also significantly lower in SLE patients than in healthy controls. Furthermore, the proportion of reduced Galectin-1 in the serum of SLE patients is significantly lower than in healthy controls, and this reduction is correlated with disease activity; the higher the disease activity, the more severe the reduction. These results suggest that VSTM1 and its ligand, reduced Galectin-1, can serve as diagnostic biomarkers for patients with active SLE. Attached Figure Description

[0036] Figure 1 The figure shows the ROS content of neutrophils in SLE patients and the correlation between ROS content and SLEDAI score, neutrophil count, and neutrophil viability.

[0037] Figure 2 The image shows the effect of VSTM1 on ROS production and cell viability in neutrophils.

[0038] Figure 3 The image shows a comparison of VSTM1 protein content on the surface of neutrophil membranes in SLE and HC cells.

[0039] Figure 4 The image shows a comparison of the VSTM1 membrane protein splice variant v1 mRNA content in SLE and HC neutrophils.

[0040] Figure 5 The diagram shows that Galectin-1 is a ligand of VSTM1.

[0041] Figure 6 The binding degree of VSTM1 to Galectin-1 differs between SLE and HC.

[0042] Figure 7 The comparison of Galectin-1 oxidation levels in serum of SLE and HC patients is shown.

[0043] Figure 8 The degree of oxidation of Galectin-1 shown affects its binding with VSTM1. Detailed Implementation

[0044] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention.

[0045] SLE patients treated at the Department of Rheumatology and Immunology, Peking Union Medical College Hospital, were selected. All diagnoses met the new ACR SLE classification criteria revised by SLICC in 2009, excluding patients with serious underlying diseases such as infectious diseases, acute heart failure, leukemia, and malignant tumors. Healthy controls, matched to the patients in terms of sex and age, were drawn from a voluntary research population. The study was approved by the Ethics Committee of Peking Union Medical College Hospital, and all healthy controls and enrolled patients signed informed consent forms. Experimental methods not explicitly described in the examples are standard procedures in the field.

[0046] Example 1: Increased ROS levels in neutrophils of SLE patients, regulated by the immunosuppressive receptor VSTM1.

[0047] Peripheral venous blood was collected from SLE patients and healthy controls using K2E (EDTA) tubes. Following the Ficoll-Hypaque instructions, the blood was layered on the separation medium and subjected to density gradient centrifugation. The peripheral blood neutrophil layer was collected, and the red blood cells were lysed with lysis buffer (BD) to obtain high-purity neutrophils.

[0048] The content of ROS in neutrophils of SLE patients was detected by flow cytometry. Freshly isolated neutrophils were stained with DCFH-DA fluorescent probe and incubated at 37°C for 20 minutes. After washing the cells three times, the fluorescence intensity of the FITC channel was detected using a BD FACSCelesta flow cytometer. The results showed that the mean fluorescence intensity of ROS in neutrophils of SLE patients was significantly higher than that in healthy controls. Figure 1 A).

[0049] Clinical information of SLE patients was collected, and the SLEDAI score was calculated. The SLEDAI scoring criteria were as follows: 8 points for each of the following symptoms: seizures, psychiatric symptoms, organic brain disease, visual impairment, cranial nerve abnormalities, lupus headache, cerebrovascular accident, vasculitis; 4 points for each of the following symptoms: arthritis, myositis, cylindruria, hematuria, proteinuria, pyuria; 2 points for each of the following symptoms: hair loss, new skin rash, mucosal ulcers, pleurisy; 1 point for each of the following symptoms: fever, thrombocytopenia, leukopenia. A positive correlation was found between neutrophil ROS levels and disease activity in SLE patients. Figure 1 B), negatively correlated with clinically detected neutrophil count ( Figure 1 C). Neutrophil viability was detected using the BD Annexin V-PE / 7-AAD apoptosis detection kit, and a negative correlation was found between neutrophil viability and cellular ROS content. Figure 1 D).

[0050] Neutrophils were incubated with an anti-VSTM1 antibody (1A5) capable of activating VSTM1 function, and changes in neutrophil ROS and cell viability were detected. It was found that the VSTM1 antibody could inhibit neutrophil ROS levels and increase neutrophil viability in serum-free and SLE-treated conditions. Figure 2 ).

[0051] Example 2: Low expression of the immunosuppressive receptor VSTM1 in neutrophils of SLE patients

[0052] 1. Neutrophil membrane proteins were isolated using a cell membrane and cytoplasmic protein extraction kit (Beyotime) according to the instructions. Protein concentrations were determined using a BCA protein assay kit (Solepro) according to the instructions. The membrane protein solution was boiled with SDS at 100°C for 5 minutes, followed by 12% SDS-PAGE and wet transfer to a PVDF membrane (Biorad). After blocking, the membrane was incubated overnight at 4°C with anti-VSTM1 (1:1000) and anti-Na-K-ATP (1:1000) antibodies. The membrane was washed and incubated with anti-rabbit IgG-HRP (1:2000) at room temperature for 1 hour. Protein bands were visualized using a Tanon-5200 (Bio-Tanon) Western blot detection system. This demonstrated that the VSTM1 protein content on the neutrophil membrane surface of SLE patients was lower than that of healthy individuals. Figure 3 A).

[0053] 2. Adjust the volume of neutrophils to 10 g using Staining Buffer. 6 Add 200 μl of anti-VSTM1-FITC or isotype control at a ratio of 100:1, mix well, and incubate at 4°C in the dark for 30 min. Wash twice, resuspend in PBS for flow cytometry or fix with 4% paraformaldehyde. Analyze the results using Flowjo software within 24 h. This demonstrates that the VSTM1 protein content on the neutrophil membrane surface of SLE patients is significantly lower than that of healthy individuals. Figure 3 B).

[0054] 3. Total RNA was extracted using TRIzol (Invitrogen) and converted to cDNA using PrimeScript™ RT Master Mix (RR036A, Takara Bio). Real-time quantitative PCR was performed using SYBR Premix Ex Taq™ II (RR820A, Takara Bio) with Applied Biosystems 7500, with GAPDH as an internal reference gene. The sequence is shown below.

[0055] Gene name Primer sequence (Forward) Primer sequence (Reverse) GAPDH GAACGGGAAGCTCACTGG GCCTGCTTCACCACCTTCT VSTM1 CCAGAACCATCTTTGTCGCC CTGTGCTGGCTGCATCTGTA

[0056] The results are as follows Figure 4As shown, this demonstrates that the mRNA level of the VSTM1 membrane receptor-form spliceosome v1 is lower in neutrophils of SLE patients than in healthy individuals.

[0057] Example 3: The binding degree of the immunosuppressive receptor VSTM1 to its ligand Galectin-1 in SLE patients is lower than that in healthy individuals.

[0058] Immunoprecipitation experiments were performed using an immunoprecipitation kit (Thermo) according to the instructions to demonstrate the interaction between VSTM1 and Galectin-1 protein. Figure 5 A and B). The intermolecular forces between purified proteins VSTM1 and Galectin-1 were detected using the Octet molecular interaction analyzer via biolayer interferometry (BLI). Data fitting results showed an affinity KD of 1.288E-07 between the two proteins, demonstrating a direct interaction between them. Figure 5 C). Neutrophils were incubated with Galectin-1 protein to detect changes in neutrophil ROS and cell viability. It was found that Galectin-1 could inhibit neutrophil ROS levels and increase neutrophil viability under serum-free and SLE serum conditions. Figure 5 (DG). The above results demonstrate that Galectin-1 is a physiological ligand of the immunosuppressive receptor VSTM1.

[0059] Immunoprecipitation assays were performed using an immunoprecipitation kit (Thermo) according to the instructions. Beads conjugated with VSTM1 antibody were first incubated with neutrophil protein. After enriching an equal amount of VSTM1 protein, they were then co-incubated with serum protein. The enriched Galectin-1 protein content was measured. It was found that the Galectin-1 protein enriched in SLE neutrophils and SLE serum was significantly less than that in healthy controls. Figure 6 A) Immunofluorescence staining of neutrophils from SLE patients and healthy individuals revealed that the levels of VSTM1 and Galectin-1 co-localized on the neutrophil membrane surface were significantly lower in SLE patients than in healthy individuals. These results demonstrate that the binding of VSTM1 and Galectin-1 is reduced in SLE patients.

[0060] Example 4: The level of Galectin-1 oxidation in the serum of SLE patients was higher than that in healthy individuals.

[0061] High-abundance proteins were removed from serum using a Top14 high-abundance protein removal column (thermo) according to the instructions. The serum after high-abundance protein removal was then analyzed by mass spectrometry to detect the content of non-oxidized Galectin-1 protein. Samples and Galectin-1 protein standards were directly added to 50 mM IAA and incubated at room temperature in the dark for 30 min to alkylate the reduced thiol groups. In-solution enzymatic digestion with mass spectrometry-grade trypsin (Promega) was then performed, followed by detection using the PRM method on an Orbitrap Fusion mass spectrometer. Results showed that the reduced content of Galectin-1 protein (Cys61 site) in SLE serum was significantly lower than that in healthy individuals. Figure 7 A).

[0062] The content of reduced Galectin-1 protein in serum can be detected by enrichment followed by Western blot analysis. After removing high-abundance proteins from serum, reduced thiol groups were labeled with biotin-labeled IAM (BIAM). Serum samples were then incubated with 20 μM BIAM, catalase (200 U), and 1% Triton X100 at room temperature in the dark for 1 hour. BIAM-labeled proteins were then enriched using streptavidin beads. 50 μL of streptavidin beads were incubated with the sample at 4°C for 4 hours. The beads were washed three times, and the eluted protein was the enriched reduced protein. After gel electrophoresis, the sample was incubated with Galectin-1 protein antibody for color development, and the grayscale values ​​were analyzed using ImageJ software. The results showed that the content of reduced Galectin-1 protein in the serum of SLE patients was significantly lower than that in healthy individuals. Figure 7 B and C). Total protein was analyzed by denaturing non-reducing gel electrophoresis, which preserved the polymeric morphology resulting from disulfide bond formation. Results showed that SLE patients had more Galectin-1 protein polymers in their serum due to disulfide bond formation. Figure 7 B). Pearson correlation analysis showed that the ratio of reduced Galectin-1 protein to total Galectin-1 protein was positively correlated with neutrophil count and negatively correlated with the SLE disease activity index SLEDAI. Figure 7 (D and E). The above results demonstrate that the proportion of reduced Galectin-1 protein in the serum of SLE patients is reduced, and the degree of reduction is related to disease activity.

[0063] Intermolecular forces between purified protein VSTM1 and oxidized Galectin-1 (oxGalectin-1) were detected using the Octet molecular interaction analyzer. The results showed that there was no interaction between the two proteins. Figure 8A). Reduced and oxidized Galectin-1 were labeled with APC fluorescence, and then the APC-labeled protein was incubated with neutrophils. Flow cytometry was used to detect the binding of Galectin-1 protein to neutrophils. The results showed that reduced Galectin-1 protein could bind to neutrophils, while oxidized Galectin-1 protein could not bind to neutrophils. Figure 8 B). The above results demonstrate that Galectin-1 protein in SLE serum undergoes oxidative modification, and therefore cannot bind to VSTM1 protein on the surface of neutrophils.

[0064] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the technical principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Use of a reagent for detecting the ratio of reduced Galectin-1 protein and Galectin-1 total protein in the manufacture of a reagent for diagnosing an active SLE patient, said diagnosis comprising: The levels of reduced Galectin-1 protein and total Galectin-1 protein were determined in biological samples obtained from patients exhibiting active SLE. The ratio of reduced Galectin-1 protein to total Galectin-1 protein was negatively correlated with the SLE disease activity index SLEDAI. The reagents used to detect the ratio of reduced Galectin-1 protein and total Galectin-1 protein included anti-Galectin-1 antibody and biotin-labeled IAM.

2. Use according to claim 1, characterized in that, Reduced Galectin-1 protein was determined using the following steps: Biotin-conjugated IAM was incubated with serum samples to bind to reduced thiol sites in proteins. Proteins containing reduced thiol sites were then enriched using streptavidin magnetic beads. The content of reduced Galectin-1 protein in the enriched reduced proteins was detected by enzyme-linked immunosorbent assay (ELISA) using an anti-Galectin-1 antibody.

Images