Bacitracin engineering strain with amtR gene knocked out and preparation method and application thereof
By knocking out the amtR gene in Bacillus licheniformis DW2, a recombinant strain of Bacillus licheniformis DW2△amtR was constructed, which solved the problem of unclear function of transcription factor AmtR and achieved a significant increase in bacitracin production.
Patent Information
- Application Number
- CN202311128270.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-09-04
- Publication Date
- 2025-11-28
- Estimated Expiration
- 2043-09-04
AI Technical Summary
In existing technologies, the role of transcription factor AmtR in bacitracin synthesis is unclear, and the relationship between ammonium utilization efficiency and amino acid synthesis level is unknown, resulting in limited strategies for increasing bacitracin yield.
By knocking out the amtR gene of Bacillus licheniformis using genetic engineering, a recombinant strain of Bacillus licheniformis DW2△amtR was constructed, thereby increasing the production of bacitracin.
The yield of bacitracin increased by more than 18%, providing an effective strategy for high-yield bacitracin production.
Smart Images

Figure CN117143900B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the fields of genetic engineering and fermentation engineering, in particular to an engineered bacitracin-producing strain with a knocked-out amtR gene, and a preparation method and application thereof. BACKGROUND
[0002] Bacillus licheniformis is an internationally recognized industrial microbial strain with biological safety (GRAS), which has the advantages of clear genetic background, strong robustness, stable traits, etc., and is widely used in the fermentation production of biological chemical products such as poly-γ-glutamic acid, licheniformin, phenylethanol, bacitracin, etc.
[0003] Bacitracin is a kind of polypeptide antibiotic synthesized by Bacillus subtilis and Bacillus licheniformis, which can strongly inhibit the growth of gram-positive bacteria and part of gram-negative bacteria, and has a synergistic effect when combined with other antibiotics, so it is widely used in feed additives and veterinary industry. The structure of bacitracin includes 11 kinds of amino acids, ornithine (Orn), D-phenylalanine (D-Phe), histidine (His), D-aspartic acid (D-Asp), asparagine (Asn), lysine (Lys), D-glutamic acid (D-Glu), cysteine (Cys), leucine (Leu), isoleucine (Ile) and valine (Val). In recent years, the strategies for high-yield bacitracin mainly focus on enhancing the supply level of bacitracin precursor amino acids; there are also reports of improving bacitracin yield by modifying transcriptional regulators (such as PhoP, KipR, Lrps), but the mechanism of action of PhoP, KipR, Lrps transcription factors in bacteria is not clear, and there is no relevant report on the correlation between these transcription factors and transcription factor AmtR (including transcription factor AmtR, the coding gene of AmtR and the regulatory object of AmtR).
[0004] Moreover, transcription factor AmtR is encoded by amtR and belongs to the TetR family member, which mainly participates in the regulation of nitrogen metabolism in bacteria, including ammonium utilization, urea metabolism, signal transduction, etc. However, the relationship between the utilization efficiency of ammonium salt and the level of amino acid synthesis is still unknown, and since there are many types of bacitracin precursor amino acids, the amino acid metabolism of Bacillus has a strict and complex regulation mechanism, and there is no evidence to prove that there is a close correlation between ammonium utilization and amino acid synthesis, bacitracin yield. In addition, there is no report that AmtR can regulate the growth of bacteria. Therefore, the relationship between transcription factor AmtR and bacitracin synthesis level is still unclear and unpredictable. SUMMARY
[0005] One of the purposes of the present application is to provide a method for preparing bacitracin engineering bacteria by knocking out amtR gene, which has stronger ability of bacitracin fermentation production.
[0006] A method for preparing bacitracin engineering bacteria by knocking out amtR gene, which is knocking out the amtR gene in the genome of Bacillus licheniformis by genetic engineering means, obtaining the recombinant strain after knocking out the amtR gene (i.e. the bacitracin engineering bacteria), and the nucleotide sequence of the amtR gene is shown in SEQ ID NO. 1.
[0007] The present application successfully knocks out the coding gene of transcriptional regulator AmtR, i.e. the amtR gene, in the genome of Bacillus licheniformis by genetic engineering method, and provides a new strategy for improving bacitracin production.
[0008] Preferably, the Bacillus licheniformis is Bacillus licheniformis DW2 (Bacillus licheniformis DW2), which has been preserved in the China Center for Type Culture Collection in Wuhan on October 12, 2011, and the preservation number is CCTCC NO: M2011344. Bacillus licheniformis DW2 is a high-yield bacitracin strain, and the recombinant strain obtained therefrom has higher bacitracin yield.
[0009] Preferably, the method for knocking out the amtR gene in the genome of Bacillus licheniformis by genetic engineering means comprises the following steps:
[0010] (1) Taking the genome of Bacillus licheniformis DW2 as a template, the upstream homologous arm and the downstream homologous arm of the amtR gene are amplified by PCR;
[0011] (2) The upstream homologous arm and the downstream homologous arm of step (1) are connected together by overlap extension PCR to obtain a homologous arm fusion fragment;
[0012] (3) The homologous arm fusion fragment obtained in step (2) is double digested by restriction endonuclease BamHI and XbaI to obtain a digested fusion fragment A; meanwhile, plasmid T2(2)-ori is double digested by BamHI and XbaI to obtain a linear
[0013] plasmid fragment after digestion;
[0014] (4) The digested fusion fragment A and the linear plasmid fragment obtained in step (3) are connected by T4-DNA ligase, and the ligation product is transformed into Escherichia coli DH5α by calcium chloride transformation method, kanamycin is used as a resistance screening marker, and positive transformants are obtained by colony PCR, and the knocking out plasmid T2(2)-ori-amtR of the amtR gene is obtained by sequencing.
[0015] (5) The T2(2)-ori-amtR constructed in step (4) is transformed into Bacillus licheniformis DW2, and positive transformants are obtained through kanamycin resistance screening;
[0016] (6) The positive transformants verified correctly through colony PCR in step (5) are subcultured for several times, and colony PCR detection is performed, so that a positive single exchange recombinant strain in which the upstream arm of the amtR gene or the downstream arm of the amtR gene is subjected to single exchange with the genomic DNA of Bacillus licheniformis DW2 is screened;
[0017] (7) The positive single exchange recombinant strain obtained in step (6) is subcultured for several times, and PCR screening is performed, so that Bacillus licheniformis in which the amtR gene is knocked out is screened, and is named as DW2△amtR.
[0018] The second object of the present application is to provide a bacitracin engineering strain in which the amtR gene is knocked out, which is a recombinant strain constructed by the method for preparing the bacitracin engineering strain in which the amtR gene is knocked out according to the first object of the present application.
[0019] The third object of the present application is to provide the application of the bacitracin engineering strain according to the second object of the present application in bacitracin production, including seed culture and fermentation culture.
[0020] In the above-mentioned application, the fermentation medium used in the fermentation culture is 60-100 g / L soybean meal, 30-50 g / L corn starch, 4-8 g / L calcium carbonate and 0.5-2 g / L ammonium sulfate.
[0021] Compared with the prior art, the present application has the following technical effects:
[0022] The present application firstly improves the bacitracin yield by knocking out the amtR gene in Bacillus licheniformis, and provides a new strategy for high bacitracin yield. Compared with Bacillus licheniformis DW2, the bacitracin yield of the Bacillus licheniformis recombinant strain DW2△amtR constructed by the present application is increased by more than 18%. The research results of the present application show that knocking out the amtR gene to improve the bacitracin yield is a very effective and feasible method. BRIEF DESCRIPTION OF DRAWINGS
[0023] Figure 1 The agarose gel electrophoresis diagram of the upstream homologous arm of the amtR gene and the downstream homologous arm of the amtR gene obtained in step (1) is shown, wherein lane M is a DNA marker, lane 1 is the upstream homologous arm of the amtR gene, and lane 2 is the downstream homologous arm of the amtR gene;
[0024] Figure 2An agarose gel electrophoresis map of the homologous arm fusion fragment obtained in step (2), wherein lane M is a DNA marker, and lane 1 is the homologous arm fusion fragment;
[0025] Figure 3 A colony PCR verification map of the knockout vector T2(2)-ori-amtR obtained in step (4), wherein lane M is a DNA marker, and lane 1 is a band of the colony PCR verification of the knockout vector T2(2)-ori-amtR;
[0026] Figure 4 A colony PCR verification map of the positive transformant strain obtained in step (5), wherein lane M is a DNA marker, and lane 1 is a band of the positive transformant strain;
[0027] Figure 5 A verification band of the B. licheniformis DW2△amtR with the knocked-out amtR gene obtained in step (7), wherein lane M is a DNA marker, and lane 1 is a verification band of the B. licheniformis DW2△amtR;
[0028] In the above DNA marker lane, the bands from top to bottom correspond to the molecular weights of 5000 bp, 3000 bp, 2000 bp, 1500 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp, respectively. DETAILED DESCRIPTION
[0029] The following examples are further illustrations of the present application and are not intended to limit the present application. The technical solutions described in the present application are conventional solutions in the art unless otherwise specified. The reagents or materials described are from commercial channels unless otherwise specified. Example 1
[0030] A method for preparing a bacitracin-producing engineering strain by knocking out an amtR gene, which comprises knocking out the amtR gene in the genome of B. licheniformis by genetic engineering to obtain a recombinant strain with the knocked-out amtR gene, i.e., the bacitracin-producing engineering strain, and the nucleotide sequence of the amtR gene is shown in SEQ ID NO. 1. The B. licheniformis is B. licheniformis DW2, which has been deposited in the China Center of Type Culture Collection in Wuhan on October 12, 2011, and the deposit number is CCTCC NO: M2011344. The specific steps for knocking out the amtR gene in the genome of B. licheniformis by genetic engineering are as follows:
[0031] (1) According to the gene sequence of the amtR gene in the genomic DNA sequence of Bacillus licheniformis DW2, upstream homologous arm primers (amtR-F1, amtR-R1) and downstream homologous arm primers (amtR-F2, amtR-R2) of the amtR gene are designed; and the genomic DNA of Bacillus licheniformis DW2 is used as a template, and the upstream homologous arm primers and the downstream homologous arm primers of the amtR gene are used for PCR amplification to obtain the upstream homologous arm fragment of the amtR gene and the downstream homologous arm fragment of the amtR gene (as shown in Figure 1 , the upstream homologous arm fragment of the amtR gene is 582 bp, and the downstream homologous arm fragment of the amtR gene is 585 bp);
[0032] Among them, the sequences of amtR-F1, amtR-R1, amtR-F2 and amtR-R2 are:
[0033] amtR-F1: CGGGATCC TTTCTCATCCTTTGACCACG
[0034] amtR-R: CATCAGAAATCCCCCTTTTGATCATCATTCCTTTTC
[0035] amtR-F2: GAAAAGGAATGATGATCAAAAGGGGGATTTCTGATG
[0036] amtR-R2: GCTCTAGA ATGTAACGGGATCTGCCG
[0037] (2) The upstream homologous arm fragment of the amtR gene and the downstream homologous arm fragment of the amtR gene are used as templates, and the upstream homologous arm primer amtR-F1 and the downstream homologous arm primer amtR-R2 are used as primers to connect the upstream homologous arm of the amtR gene and the downstream homologous arm of the amtR gene together by overlap extension PCR to obtain a homologous arm fusion fragment (as shown in Figure 2 , the homologous arm fusion fragment is 1247 bp);
[0038] (3) The homologous arm fusion fragment in step (2) is double digested by XbaI and BamHI restriction endonucleases to obtain a digested fusion fragment;
[0039] (4) Prepare plasmid T2(2)-ori (wherein, the construction method of plasmid T2(2)-ori is: 194-ori from pE194 plasmid, kanamycin resistance gene from pDG780 plasmid, pUC-ori from plasmid pBluescript II SK(+)-X52328 are amplified by PCR reaction, and recovered and enzyme-digested. According to the order of 194-ori, kanamycin resistance gene, pUC-ori. The construction method is referred to the following documents: Guo Xinghua, Xiong Zhan, et al. (1991). Construction of a B. subtilis-E. coli multifunctional shuttle vector [J]. Acta Biochimica Sinica. 7(3): 224-22 and Peng Qingzhong, Zhang Weicai, et al. (2002). Construction of a B. pumilus-E. coli shuttle secretion expression vector [J]. Acta Biochimica Sinica. 18(4): 438-441), and the linear plasmid fragment (4250 bp) is obtained by double enzyme digestion of plasmid T2(2)-ori using XbaI and BamHI restriction endonucleases, wherein the XbaI and BamHI restriction endonucleases are both purchased from Beijing Quanshi Gold Biotechnology Co., Ltd.;
[0040] (5) The enzyme-digested gene fragment of step (3) and the linear plasmid fragment of step (4) are connected by T4 DNA ligase to obtain a connection product; the connection product is transformed into E. coli DH5α by calcium chloride transformation method, and the transformant is screened by a culture medium containing kanamycin at 37°C. The transformant is verified by colony PCR using primers T2-F and T2-R (the primers used are: T2-F and T2-R). The PCR verification result of the transformant is: an electrophoresis band appears at 1535 bp (as shown in Figure 3 ), which indicates that the knockout vector is successfully constructed, and is named: knockout vector T2(2)-ori-amtR;
[0041] Wherein, the sequences of T2-F and T2-R are:
[0042] T2-F: ATGTGATAACTCGGCGTA,
[0043] T2-R: GCAAGCAGCAGATTACGC;
[0044] (6) The knockout vector T2(2)-ori-amtR is transformed into B. licheniformis DW2 by the method of electroporation, and the transformants are screened on a medium containing kanamycin at 37°C. The transformants are verified by colony PCR using primers T2-F and T2-R. If the PCR verification result of the transformants is that an electrophoresis band appears at 1535 bp, it is proved that the knockout vector T2(2)-ori-kipR is successfully transformed into B. licheniformis DW2, and the transformants are positive transformants;
[0045] (7) The positive transformants obtained in step (6) are subcultured three times at 45°C on a medium containing kanamycin, each time for 12 h, and the single crossover strains are verified by colony PCR using primers T2-F and amtR-KYR (or using primers T2-R and amtR-KYF). If the electrophoresis band size is 1479 bp or 2094 bp, it is proved that the strain is a single crossover successful strain (as shown in Figure 4 ).
[0046] The sequences of the primers amtR-KYF and amtR-KYR are as follows:
[0047] amtR-KYF: GACGCCGTTGTCGGAAGC
[0048] amtR-KYR: TGATTTGCGGAGCGGACT
[0049] (8) The single crossover strains obtained in step (7) are inoculated in a medium without kanamycin at 37°C and subcultured for 3-6 times, and the transformants are verified by colony PCR (using primers amtR-KYF and amtR-KYR). If the PCR verification result of the transformants is that an electrophoresis band appears at 1993 bp, it is proved that a gene back mutation occurs, and the transformants are B. licheniformis DW2; if an electrophoresis band appears at 1378 bp, it is proved that the amtR gene is successfully knocked out in B. licheniformis DW2, and the transformants are positive transformants (as shown in Figure 5 ). Then, the positive transformants are further sequenced and verified, and B. licheniformis DW2△amtR with the amtR gene knocked out is obtained.
[0050] Then, the applicant also uses the above-constructed B. licheniformis DW2△amtR to ferment bacitracin. The application of B. licheniformis DW2△amtR in the production of bacitracin includes seed culture and fermentation culture.
[0051] The specific steps of the seed fermentation are as follows: first, the bacillus licheniformis DW2△amtR is activated, that is, 1% (volume percentage) of the bacillus licheniformis DW2△amtR is inoculated into a 5 mL LB culture medium, and then the culture is cultured at 230 r / min and 37°C for 12 hours; then, the activated bacillus licheniformis DW2△amtR is inoculated into a seed culture medium at a volume percentage of 1%, and then the culture is cultured at 230 r / min and 37°C for 12 hours, so as to obtain a seed culture solution (the formula of the seed culture medium is as follows: 10 g / L of peptone, 5 g / L of yeast extract, 10 g / L of sodium chloride, and pH 7.2).
[0052] The specific steps of the fermentation culture are as follows: 20 mL of the fermentation culture medium with different formulas (see Table 1) is added into a 250 mL triangular flask, and then the seed culture solution is inoculated at a volume percentage of 3% (volume percentage), the rotation speed is 230 r / min, the temperature is 37°C, and the fermentation culture is performed for 48 hours, so as to obtain a fermentation solution.
[0053] The inventors of the present application use a high performance liquid chromatography (HPLC) method to determine the bacillomycin yield in the fermentation solution produced in the above examples. The determination conditions are as follows: an Agilent 1200 liquid chromatograph is used for detection; the chromatographic column is Hypersil BDS C18 (5 μm, 4.6 mm x 250 mm); the mobile phase is A:B = 35:65 (A phase: 100 mL of pH 6.0 phosphate buffer is uniformly mixed with 300 mL of water; B phase: 520 mL of methanol is uniformly mixed with 40 mL of acetonitrile); the flow rate is 1.0 mL / min; the column temperature is 30°C; the ultraviolet detector wavelength is 254 nm; and the injection amount is 20 μL. The bacillomycin yield in the fermentation solution produced is calculated according to a standard curve of a bacillomycin standard (see Table 2).
[0054] Table 1
[0055]
[0056] Table 2
[0057]
[0058] As can be seen from Table 2, under the same fermentation conditions, the bacillomycin yield in the fermentation solution of the bacillus licheniformis DW2△amtR of the present application is obviously improved (increased by more than 18%) compared with the bacillus licheniformis DW2 of the prior art, which indicates that the technical scheme of the present application has important application value in improving the bacillomycin yield of the bacillus licheniformis.
[0059] Any simple derivations or replacements made by those skilled in the art without departing from the concept of the present application shall be considered as falling within the protection scope of the present application.
Claims
1. A method for preparing bacitracin-producing engineered bacteria by knocking out the amtR gene, characterized in that, The amtR gene in the genome of Bacillus licheniformis was knocked out using genetic engineering techniques, and a recombinant strain with the amtR gene knocked out was obtained, namely the bacitracin-producing engineered bacterium. The nucleotide sequence of the amtR gene is shown in SEQ ID NO.
1.
2. The method for preparing bacitracin-producing engineered bacteria by knocking out the amtR gene according to claim 1, characterized in that, The Bacillus licheniformis is Bacillus licheniformis ( Bacillus licheniformis DW2 was deposited on October 12, 2011, at the China Center for Type Culture Collection in Wuhan, with accession number CCTCC NO: M2011344.
3. The method for preparing bacitracin-producing engineered bacteria by knocking out the amtR gene according to claim 2, characterized in that, The method of knocking out the amtR gene in the genome of Bacillus licheniformis using genetic engineering techniques specifically includes the following steps: (1) Using the genome of Bacillus licheniformis DW2 as a template, the upstream and downstream homologous arms of the amtR gene were amplified by PCR. (2) The upstream and downstream homologous arms from step (1) were joined together by overlapping extension PCR to obtain the homologous arm fusion fragment; (3) The homologous arm fusion fragment obtained in step (2) was double-digested with restriction endonucleases BamHI and XbaI to obtain the digested fusion fragment A; at the same time, plasmid T2(2)-ori was double-digested with BamHI and XbaI to obtain the digested linear plasmid fragment. (4) The enzyme-digested fusion fragment A and the linear plasmid fragment obtained in step (3) were ligated by T4-DNA ligase. The ligation product was transformed into Escherichia coli DH5α by calcium chloride conversion method. Kanamycin was used as the resistance selection marker, and positive transformants were obtained by colony PCR. The knockout plasmid T2(2)-ori-amtR of the amtR gene was obtained by sequencing. (5) Transform the T2(2)-ori-amtR constructed in step (4) into Bacillus licheniformis DW2, and obtain positive transformants by kanamycin resistance screening; (6) The positive transformants that were verified by colony PCR in step (5) were cultured through several transfers and colony PCR detection to screen out positive single exchange binder strains that had a single exchange between the upstream arm of the amtR gene or the downstream arm of the amtR gene and the genomic DNA of Bacillus licheniformis DW2. (7) The positive single exchanger strain obtained in step (6) was cultured through several transfers and screened by PCR to obtain Bacillus licheniformis with the amtR gene knocked out, namely Bacillus licheniformis DW2△amtR.
4. A bacitracin-producing engineered bacterium with the amtR gene knocked out, which is a recombinant strain constructed by the method for preparing bacitracin-producing engineered bacteria by knocking out the amtR gene as described in any one of claims 1 to 3.
5. The application of the bacitracin-producing engineered bacteria with the amtR gene knocked out as described in claim 4 in bacitracin production, including seed culture and fermentation culture.
6. The application of the bacitracin-producing engineered bacteria with the amtR gene knocked out according to claim 5 in bacitracin production, characterized in that: The fermentation medium used in the fermentation culture consists of 60-100 g / L soybean meal, 30-50 g / L corn starch, 4-8 g / L calcium carbonate, and 0.5-2 g / L ammonium sulfate.
Citation Information
Patent Citations
Bacitracin-producing engineering bacterium with kipR gene knocked out as well as preparation method and application of bacitracin-producing engineering bacterium
CN115948319A
Novel Polynucleotides
US20020197605A1