Application of ZmVAMP726 gene in regulating pollen stress resistance of plants

Overexpression of the ZmVAMP726 gene enhances the stress resistance of maize pollen, solves the problem of decreased maize pollen viability under high temperature and ultraviolet radiation, and improves maize seed setting and breeding efficiency.

CN117143902BActive Publication Date: 2026-03-20HENAN UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311025680.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-08-15
Publication Date
2026-03-20
Estimated Expiration
2043-08-15

AI Technical Summary

Technical Problem

Corn pollen viability decreases under high temperature and ultraviolet radiation, resulting in poor corn seed setting. Current technologies lack effective genetic resources and molecular mechanisms to improve the heat resistance and survival rate of pollen.

Method used

Overexpression of the ZmVAMP726 gene can enhance the resistance of plant pollen to high temperature and ultraviolet radiation. This is achieved by transferring the ZmVAMP726 gene or biological materials containing the gene into the target plant, thereby enhancing the stress resistance of the pollen.

Benefits of technology

It improved the plant pollen's resistance to high temperatures and ultraviolet radiation, enhanced the corn's grain filling ability, helped it adapt to extreme climate changes, and improved breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117143902B_ABST
    Figure CN117143902B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of genetic engineering, and particularly relates to application of ZmVAMP726 gene in regulation of pollen stress resistance of plants, wherein the nucleotide sequence of the ZmVAMP726 gene is shown as SEQ ID NO:1. Research finds that deletion of the gene leads to sensitivity of Arabidopsis pollen to high temperature and ultraviolet radiation, and overexpression of the gene improves the resistance of plants to high temperature and ultraviolet radiation. The application provides a new strategy for subsequent identification and cloning of more corn pollen stress resistance related genes, and breeding of corn.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic engineering, and particularly relates to application of ZmVAMP726 gene in regulation of pollen stress resistance of plants. BACKGROUND

[0002] With the intensification of the greenhouse effect, extreme weather such as continuous high temperature and high-intensity ultraviolet radiation in summer occurs frequently, and high-temperature heat damage has become one of the most important environmental factors restricting agricultural production. Corn is the largest crop in terms of planting area and total yield in China, and is the main source of important food crops, feed and industrial raw materials in China, and plays an important supporting role in ensuring the development of China's national economy. Its yield is seriously affected by high-temperature heat damage. Studies have shown that for every 1℃ increase in global temperature, the average yield of corn will decrease by 7.4%.

[0003] The period before and after pollen shedding is one of the most sensitive periods of corn to high temperature stress, and high temperature will lead to a decrease in the number and viability of pollen, seriously affecting the fertilization process. In recent years, high-temperature weather during the corn growing season has led to a decrease in corn pollen viability, so poor corn setting, flower grain, and bare tips often occur in production, ultimately leading to a decrease in corn yield or even no yield. In the process of corn parent seed propagation and hybrid corn seed production, artificial pollination is often needed. Corn flowering and pollination period is often high in temperature, and under high-temperature and dry conditions, corn pollen will lose all viability about 1 hour after anther shedding, and has a short survival time. Improving pollen heat tolerance and viability is expected to greatly improve the efficiency of artificial pollination.

[0004] Spores are an important component of pollen exine, and are a kind of biological polymer composed of aliphatic units and aromatic units. Because of its strong chemical inertness, spores are considered to be an important component of protecting male gametes from environmental stress. However, the exact chemical composition of spores and the key genes of the corresponding regulation process still need further research and exploration.

[0005] At present, the molecular mechanism of corn heat tolerance is still rarely analyzed. In breeding practice, available corn pollen heat-tolerant germplasm and gene resources are still very scarce, so fully exploring excellent gene resources of corn pollen heat tolerance is of great significance for breeding heat-tolerant corn germplasm, improving corn breeding efficiency, adapting to future climate change, and ensuring high and stable yield of corn.

[0006] Phenylpropanoids are widely present in plants as secondary metabolites, and are important regulators in plant growth and development. They are also crucial for plant resistance to environmental stress. In recent years, with the development of mass spectrometry and nuclear magnetic resonance technology, and the optimization of degradation methods, scientists have used thioacidolysis to degrade sporopollenin, and combined liquid chromatography-mass spectrometry-mass spectrometry and nuclear magnetic resonance technology to analyze the chemical composition of Pinus rigida and Lilium brownii sporopollenin. A variety of phenylpropanoids, including p-hydroxybenzoate (p-BA), p-coumarate (p-CA), ferulate (FA), and G (guaiacyl) type lignin monomers, were found to be components of sporopollenin and could help pollen resist UV radiation. However, the composition of phenylpropanoids in maize sporopollenin has not been analyzed, and the regulatory role of phenylpropanoids in maize pollen resistance is not clear. The genes involved in this process have not been discovered. SUMMARY

[0007] The present application aims to provide the application of ZmVAMP726 gene in regulating the resistance of plant pollen, and the overexpression of the gene can improve the resistance of maize pollen to high temperature and ultraviolet radiation.

[0008] To solve the above technical problems, the technical scheme is adopted in the present application.

[0009] The first aspect of the present application provides the application of ZmVAMP726 gene in regulating the resistance of plant pollen, and the nucleotide sequence of the ZmVAMP726 gene is shown in SEQ ID NO: 1.

[0010] In some embodiments of the present application, the amino acid sequence encoded by the ZmVAMP726 gene is shown in SEQ ID NO: 2.

[0011] In some embodiments of the present application, the resistance is high temperature tolerance and ultraviolet radiation resistance.

[0012] In some embodiments of the present application, the resistance of plant pollen to high temperature and ultraviolet radiation is improved by increasing the expression of the ZmVAMP726 gene in the target plant.

[0013] In some embodiments of the present application, the step of increasing the expression of the ZmVAMP726 gene in the target plant includes: introducing the ZmVAMP726 gene or biological material containing the ZmVAMP726 gene into the target plant.

[0014] In some embodiments of the present application, the biological material comprises an expression vector, a recombinant bacterium or a cell line containing the ZmVAMP726 gene.

[0015] In some embodiments of the present application, the expression vector is pMDC32.

[0016] In some embodiments of the present application, the host bacterium of the recombinant bacterium is GV3101.

[0017] In some embodiments of the present application, the plant comprises corn.

[0018] Compared with the prior art, the present application has the following beneficial effects: the present application provides a gene involved in lignin synthesis, and mutation of the gene will lead to a decrease in the content of lignin in corn; in addition, the present application finds that deletion of the gene will lead to sensitivity of Arabidopsis pollen to high temperature and ultraviolet radiation, and overexpression of the gene will improve the resistance of plants to high temperature and ultraviolet radiation. The present application provides a new strategy for subsequent identification and cloning of more corn pollen stress-related genes, and breeding of corn. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 Manhattan plot generated from the genome-wide association analysis of total lignin monomer content.

[0020] Figure 2 Lignin monomer content in spore pollen of wild-type corn B73 and corn mutant Zmvamp726.

[0021] Figure 3 Effect of high temperature and ultraviolet radiation on wild-type corn B73 and corn mutant Zmvamp726; wherein, Figure 3 A represents the pollen staining result of wild-type corn B73 and corn mutant Zmvamp726 under high temperature conditions; Figure 3 B represents the pollen staining result of wild-type corn B73 and corn mutant Zmvamp726 under ultraviolet radiation conditions; Figure 3 C represents the pollen inactivation rate of wild-type corn B73 and corn mutant Zmvamp726 under high temperature conditions; Figure 3 D represents the pollen inactivation rate of wild-type corn B73 and corn mutant Zmvamp726 under ultraviolet radiation conditions.

[0022] Figure 4 Restoration of the resistance of Arabidopsis mutant Atvamp726 pollen to high temperature and ultraviolet radiation by complementation of the ZmVAMP726 gene; wherein, Figure 4 A represents the germination rate of corn and Arabidopsis pollen in different treatment groups under high temperature conditions; Figure 4B represents the germination rate of maize and Arabidopsis pollen under different treatment groups under ultraviolet radiation. DETAILED DESCRIPTION

[0023] The application will be described in detail below with reference to the drawings and specific examples, but should not be understood as limiting the application. If not specifically stated, the technical means used in the following examples are conventional means known to those skilled in the art, and the materials, reagents, etc. used in the following examples, if not specifically stated, can be obtained from commercial channels.

[0024] Example 1 Discovery, identification and cloning of a gene regulating lignin synthesis

[0025] The material used in this study is a correlation population consisting of 117 representative maize core inbred lines, of which 65 are from tropical / subtropical regions and 52 are from temperate regions. In 2020, they were planted in Kaifeng City, Henan Province, China, with a row length of 3 meters, a plant spacing of 0.22 meters, and a row spacing of 0.6 meters.

[0026] At the stage of dehiscence and powdering, mature pollen was collected every morning. Pollen from the same inbred line was collected together and dried in an oven at 50°C. The dried pollen can be stored in a dry box.

[0027] Preparation of pollen wall: 0.15 g of pollen was weighed and ground into fine powder using a powder mill and dried overnight at 50°C. The next day, 1.5 mL of 70% ethanol was added and vortexed thoroughly until there was no obvious blocky precipitate. It was placed in a 65°C oven for 1 h, the supernatant was discarded, and the process was repeated 3 times. It was then washed with 1.5 mL of chloroform:methanol (1:1) and 1.5 mL of acetone, vortexed thoroughly, shaken for 10 min, and left to stand at room temperature for 1 h. The supernatant was discarded, and the process was repeated three times with each solution. The resulting precipitate was thoroughly dried. 0.1 g of the precipitate was resuspended in 1.5 mL of 0.1 M sodium acetate (pH = 5.0), heated at 80°C for 20 min, and then placed on ice to cool completely. 35 μL of 0.01% sodium azide, 35 μL of 50 μg / mL amylase, and 17 μL of 50 μg / mL pullulanase were added, and incubated overnight at 37°C. The overnight incubation sample was heated at 100°C for 10 min to terminate the reaction, and the supernatant was discarded by centrifugation. The resulting precipitate was washed with distilled water and acetone, three times with each solvent.

[0028] Lignin content determination: 10 mg of pollen wall was weighed and added to 1 mL of freshly prepared reaction buffer (25 μL of boron trifluoride, 100 μL of ethanethiol, 875 μL of dioxane), and incubated in a 95 °C metal bath for 4 h, with manual shaking every hour. The reaction was stopped by placing the samples on ice for 15 min. About 300 μL of 0.4 M sodium bicarbonate was added to bring the pH to between 3 and 4. 2 mL of distilled water and 1 mL of dichloromethane (containing internal standard 4,4'-ethylenebisphenol (Aldrich, Cat. No. E156401, 0.1 mg / mL) were added. After vortexing for 1 min, the samples were left to stand for 30 min, and this was repeated three times. The organic phase was filtered through anhydrous sodium sulfate into a new centrifuge tube, and the organic solvent was evaporated at 50 °C. The dried sample was resuspended in 50 μL of pyridine and 50 μL of N,O-bis(trimethylsilyl)trifluoroacetamide (Solarbio, Cat. No. B8810) and incubated at room temperature for 5 h or more. The sample was filtered through a 0.22 μm filter into an injection vial, and analyzed by GC-MS. The calculation formula was: C (μmol / g) = AS / AIS x 0.467 x K x 100, where AS: target peak area; AIS: internal standard peak area; K is the relative correction coefficient of different substances to the internal standard, KHunit = 1.24; KGunit = 1.56; KSunit = 1.91.

[0029] Genome-wide association analysis: By integrating several genotyping platforms, including Illumina MaizeSNP50 BeadChip, RNA sequencing, Affymetrix Axiom Maize 600K DNA Chip and GBS genotyping, a total of 55 million SNPs with a minor allele frequency (MAF) of 0.05 were obtained (http: / / www.maizego.org / Resources.html). The Q+K model (considering population structure and kinship) was used in the TASSEL 3.0 software to determine whether there was a statistically significant association between genotype and phenotype. At the same time, considering that many SNPs are in a state of high linkage disequilibrium, the effective number of markers for this set of markers has been calculated in previous studies using the GEC software, and the recommended P value given by the software is 2.04 x 10 -6 (1 / effective number of markers), which was used as the threshold to control the genome-wide type I error rate. The P value of each SNP obtained by the TASSEL 3.0 software was used to construct the Manhattan plot of the cob and bract tissue arsenic content (as shown in FIG. 2). Figure 1

[0030] ​According to the maize B73 reference genome sequence (RefGen_V2), the maize gene list was downloaded from MaizeGDB database (http: / / www.maizegdb.org) for identifying possible candidate genes within each locus. The function of the candidate genes was annotated according to the InterProScan website (http: / / www.ebi.ac.uk / interpro / scan.html). Previous studies have evaluated the LD of this population using 550,000 SNPs, and found that the average decay distance of the whole genome was 50 kb when r 2 = 0.1, therefore, the interval of 50 kb upstream and downstream of the peak SNP (peakSNP) was defined as a QTL. There were 6 candidate genes within the QTL, and the homologous gene of gene ID GRMZM2G075588 in the model plant Arabidopsis thaliana was reported to encode a membrane protein related to vesicle transport, so the gene was named ZmVAMP726 (the nucleotide sequence of which is shown as SEQ ID NO: 1, and the amino acid sequence of the protein encoded by the gene is shown as SEQ ID NO: 2). The gene is specifically expressed in the anthers at the tasseling and silking stage, and is predicted to be involved in the synthesis of corn pollen.

[0031] To verify the function of the gene, a mutant Zmvamp726 with mutation of the gene was obtained from the maize EMS mutant library (https: / / elabcaas.cn / memd / public / index.html / # / ), mature pollen was collected at the tasseling and silking stage, and the content of lignin monomers in the pollen was detected according to the above method. The results are shown in Figure 2 Compared with wild type B73, the content of lignin monomers in the pollen of mutant Zmvamp726 was reduced.

[0032] Example 2 Effect of ZmVAMP726 gene on the ability of corn to resist high temperature and ultraviolet radiation

[0033] To determine the resistance of the pollen of mutant Zmvamp726 to high temperature and ultraviolet radiation, fresh mature pollen of B73 and mutant Zmvamp726 was collected in a 2 mL centrifuge tube, heated at 37°C or irradiated with UV, and dyed with 2,3,5-chlorinated triphenyl tetrazolium (TTC) dye at 0, 30, 90 minutes, respectively, 35°C, 5 minutes; the dyed pollen was observed under a microscope and the percentage of inactivated pollen was calculated. The results are shown in Figure 3 As shown in A, B, C and D of

[0034] Example 3 ZmVAMP726 gene is conserved in function in monocotyledonous plant corn and dicotyledonous plant Arabidopsis thaliana

[0035] The homologous gene AtVAMP726 of ZmVAMP726 was knocked out in Arabidopsis thaliana by using CRISPR / Cas9 technology to obtain Atvamp726-gr1; according to the B73 genome reference sequence, specific primers were designed by using Primer3, the sequences of the upstream and downstream primers are shown in Table 1, and the coding region (CDS) of the gene was amplified by PCR, and the CDS sequence was introduced into the expression vector pMDC32 vector by DNA recombination technology to construct the expression vector of the gene: p35S::ZmVAMP726; the expression vector of AtVAMP726 gene was constructed in the same way: p35S::AtVAMP726. The above two expression vectors were respectively transformed into two Agrobacterium GV3101. Using Arabidopsis thaliana flower dipping method, the functional complementation of transgenic materials was prepared with Atvamp726-gr1 as the background.

[0036] Table 1 PCR primers

[0037] Primer Primer sequence Sequence number ZmVAMP726F ATGGGGCAACAACGCACGTTG SEQ ID NO: 3 ZmVAMP726R GCAATTCAAGTCCTTGCAAACTGT SEQ ID NO: 4

[0038] The pollen viability of Arabidopsis thaliana was detected by in vitro germination experiment: fresh open Arabidopsis thaliana flowers were taken, and the pollen was lightly coated on the germination medium (1 mM potassium chloride, 10 mM calcium chloride, 0.8 mM magnesium sulfate, 1.5 mM boric acid, 18% sucrose, 10 μg / mL inositol, 5 mM MES, Tris was adjusted to pH 5.8; 1% agarose was added to prepare pollen germination solid medium), and after heating at 37°C or UV irradiation for 0, 30, 60 minutes; placed in 100% humidity, 28°C for 6h. Microscope observation and photography were taken to count the germination rate. As shown in A and B of Figure 4 As shown in A and B of FIG. 10, the deletion of Arabidopsis thaliana AtVAMP726 gene leads to the sensitivity of pollen to high temperature and ultraviolet radiation, while the complementation of AtVAMP726 gene or ZmVAMP726 gene can restore the resistance of Arabidopsis thaliana pollen to high temperature and ultraviolet radiation.

[0039] Although preferred embodiments of the present application have been described, those skilled in the art, once aware of the basic inventive concept, can make additional changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications falling within the scope of the present application.

[0040] Obviously, those skilled in the art can make various modifications and variations to the present application without departing from the spirit and scope of the present application. Thus, if these modifications and variations of the present application fall within the scope of the claims of the present application and their equivalents, the present application also intends to include these modifications and variations.

Claims

1. ZmVAMP726 The application of genes in regulating plant pollen stress resistance is characterized by, The ZmVAMP726 The nucleotide sequence of the gene is shown in SEQ ID NO:1; the stress resistance is high temperature resistance; by making the... ZmVAMP726 The gene is expressed at higher levels in the target plant, which enhances the plant pollen's resistance to high temperatures; the plant is Arabidopsis thaliana or maize.

2. The application as described in claim 1, characterized in that, Make the ZmVAMP726 The steps for increasing gene expression in the target plant include: […]. ZmVAMP726 Genes are transferred into the target plant.

3. The application as described in claim 1, characterized in that, Make the ZmVAMP726 The steps for increasing gene expression in the target plant include: [the following steps are described in the original text, but are not directly related to the steps described in the original text.] ZmVAMP726 Genetic biological material is transferred into the target plant.

4. The application as described in claim 3, characterized in that, The biomaterial includes the following components: ZmVAMP726 Gene expression vectors, recombinant bacteria, or cell lines.

5. The application as described in claim 4, characterized in that, The expression vector is pMDC32.

6. The application as described in claim 4, characterized in that, The host strain of the recombinant bacteria is GV3101.