Application of fish vdac2 gene in resisting inflammation induced by aquatic virus
By targeting the fish VDAC2 gene and using VDAC2 inhibitors to suppress the inflammatory response induced by SVCV, the problem of severe inflammatory response in aquatic viral infections was solved, the survival rate of fish was significantly improved, and an effective prevention and control method was provided.
Patent Information
- Application Number
- CN202311120956.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-08-30
- Publication Date
- 2026-04-07
- Estimated Expiration
- 2043-08-30
AI Technical Summary
In the current technology, the research on VDAC2 in fish induced inflammatory responses by aquatic viruses has not been fully explored, resulting in severe inflammatory responses and high mortality rates caused by aquatic virus infections such as carp spring viremia (SVC), and a lack of effective prevention and control measures.
By using the fish VDAC2 gene as a target, and by using VDAC2 inhibitors such as Dids or Morpholino sequences to inhibit the expression or activity of VDAC2, thereby suppressing the inflammatory response induced by SVCV, drugs against aquatic virus-induced infections can be developed.
It significantly inhibited the inflammatory response induced by SVCV, reduced organ pathological damage, and improved the survival rate of fish, especially showing significant prevention and treatment effects on spring viremia in carp.
Smart Images

Figure CN117180433B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of aquatic animal genetic engineering technology, specifically relating to the application of a voltage-dependent anion channel 2 (VDAC2) in the preparation of drugs against aquatic virus-induced inflammatory responses. Background Technology
[0002] Spring viremia of carp (SVC) is an acute, highly lethal infectious disease caused by spring viremia virus (SVCV), and has been listed as a disease requiring mandatory reporting by the World Organisation for Animal Health (OIE). The main pathological symptoms in infected fish include hemorrhage in the liver, spleen, and kidneys, severe peritonitis, and hemorrhagic enteritis. According to the "Analysis of Important Aquatic Animal Diseases in my country in 2022," monitoring results from 2005 to 2021 showed that SVC is widely distributed in my country, mainly in Liaoning and Heilongjiang in Northeast China; Tianjin, Hebei, and Inner Mongolia in North China; Shaanxi, Ningxia, and Xinjiang in Northwest China; and Henan, Hubei, and Hunan in Central China. Hubei has reported SVCV-positive samples for five consecutive years. Approximately 10 hatcheries nationwide test positive for SVCV annually. Among the positive samples, carp accounted for 70.7%, koi 12.0%, goldfish 8.0%, crucian carp 5.2%, grass carp 1.8%, silver carp 1.4%, bighead carp 0.2%, and other species 0.7%.
[0003] Voltage-dependent anion channels (VDACs) are channel proteins located on the outer mitochondrial membrane, with three isoforms: VDAC1, VDAC2, and VDAC3. In mammals, the three VDAC isoforms share 75% sequence similarity. Comparison of their protein sequences revealed a unique 11-12 amino acid extension at the N-terminus of mammalian VDAC2. However, this extension is not conserved in other chordates; for example, fish VDAC2 lacks this amino acid extension. Therefore, the N-terminal extension may only play a crucial role in certain functions in mammals. Furthermore, compared to the other two isoforms, VDAC2 has more cysteine (C) residues, concentrated in the connective tissue between transmembrane domains. These residues may play roles in redox regulation, protein-protein interactions, and may also influence the stability of the β-sheet and the interaction of VDAC2 with the lipid environment. Studies of the three-dimensional structure of the VDAC family revealed that VDACs are transmembrane channels formed by β-barrels, each consisting of a helix and multiple β-sheets. The earliest crystallographic study of VDAC was on zebrafish VDAC2 (zfVDAC2), which showed that zfVDAC2 was also a β barrel consisting of 19 β plates and an α-helix at the N end.
[0004] The primary role of VDACs is in solute transport across the outer mitochondrial membrane (OMM). This function is central to mitochondrial bioenergetics and cellular metabolism. Although highly similar, each isoform involves different functions. Studies have shown that mice with VDAC1, VDAC3, or double knockout of VDAC1 / VDAC3 exhibit mild phenotypes, while mice with systemic VDAC2 knockout die during embryonic development. Conditional knockout of VDAC2 in the heart and thymus is also produced. Heart-specific VDAC2 knockout manifests as cardiomyopathy and dysfunction of the apoptosis pathway, ultimately leading to early death. Therefore, VDAC2 plays a crucial role in development and survival. Studies have shown that VDAC2, like VDAC1, is voltage-dependent, and VDAC2 maintains normal calcium levels in cardiomyocytes. 2+ Circulation plays a crucial role in maintaining cardiac contractile activity. Furthermore, VDAC plays a vital role in regulating apoptosis. Bcl-xL interacts with VDAC1, inhibiting mitochondrial calcium metabolism. 2+ VDAC1 promotes apoptosis; Bcl-2 also interacts with VDAC1 through its N-terminus, inhibiting cytochrome c release and apoptosis; other studies have shown that VDAC1 interacts with Bax, exerting a pro-apoptotic effect. Notably, VDAC's involvement in apoptosis is also influenced by other interacting substances. For example, hexokinase 1 / 2 has been shown to exert anti-apoptotic effects through interaction with VDAC. Literature indicates that VDAC1 is a target of hexokinase, and recently it was found that the anti-apoptotic activity of hexokinase 2 is also related to VDAC2 / 3. In addition to these functions, recent studies have found that VDAC also plays an important role in regulating inflammation. VDAC can regulate the release of various stimulating factors such as Ox-mtDNA and ROS, which can further activate the NLRP3 inflammasome, thereby inducing a strong inflammatory response. Furthermore, VDAC's own oligomerization also promotes the assembly and activation of the NLRP3 inflammasome. Therefore, VDAC also plays an important role in regulating the body's inflammatory response. However, research on VDAC2 in aquatic viral infections in fish has not yet been reported. Summary of the Invention
[0005] The inventors have discovered for the first time that fish VDAC2 regulates the inflammatory response in SVCV infection. Therefore, this invention aims to provide the application of the fish VDAC2 gene as a target in the development and preparation of drugs that resist aquatic virus-induced inflammatory responses.
[0006] In the applications described in this invention, the aquatic virus includes, but is not limited to, SVCV.
[0007] In the application described in this invention, one of the active ingredients of the drug is a VDAC2 inhibitor; it is understood that the inhibitor includes, but is not limited to, shRNA, siRNA, dsRNA, miRNA, cDNA, antisense RNA / DNA, Morpholino sequences, low molecular weight compounds, peptides, antibodies, etc.
[0008] In some specific embodiments of the present invention, the VDAC2 inhibitor is specifically the compound 4,4′-diisothiocyanostilbene-2,2′-disulfonic acid (Dids), the structural formula of which is shown below:
[0009]
[0010] Existing technologies have shown that Dids is an inhibitor of VDAC2 and has anti-apoptotic and neuroprotective effects. In vivo and in vitro experiments of this invention show that Dids can significantly inhibit the inflammatory response caused by SVCV in fish both in vivo and in vitro, and reduce pathological damage to organs, thereby significantly improving the survival rate of fish infected with the virus; the organs include the brain, liver, intestines and kidneys.
[0011] In another embodiment of the present invention, the VDAC2 inhibitor is the Morpholino sequence. That is, knocking down VDAC2 in fish through the MO sequence can also significantly inhibit the inflammatory response caused by SVCV and significantly improve the survival rate of fish after infection with the virus.
[0012] In the applications described in this invention, the drug also includes pharmaceutically acceptable excipients, and the drug can be administered to an individual in an effective dose via oral administration, feeding with feed, or injection.
[0013] In addition, it should be noted that drugs with VDAC2 gene inhibitors as one of their active ingredients, and used to prevent and treat aquatic viruses (especially SVCV), are also within the scope of protection of this invention.
[0014] The beneficial effects of this invention are as follows: The experimental data of this invention show that Dids or knockdown of VDAC2 can significantly inhibit the inflammatory response caused by carp spring viremia virus and effectively improve the survival rate of fish infected with SVCV. Therefore, VDAC2 can be used as a target for the development of drugs for the prevention and control of viruses in the aquatic field, which is of great significance for the prevention and control of aquatic viruses (especially SVCV). Attached Figure Description
[0015] Figure 1 The results of testing the cytotoxicity of different concentrations of Dids on EPC cells in Example 1 are shown.
[0016] Figure 2This illustrates the inhibitory effect of different concentrations of Dids on the inflammatory response induced by SVCV infection in EPC cells in Example 1.
[0017] Figure 3 The results of the effect of Dids on the survival rate of SVCV infection in zebrafish in Example 2;
[0018] Figure 4 This refers to the inhibitory effect of Dids on the IL-1β transcriptional levels in various organs of zebrafish after SVCV infection, as shown in Example 2.
[0019] Figure 5 This demonstrates the positive effects of Dids on organ damage following SVCV infection in zebrafish, as shown in Example 2.
[0020] Figure 6 This illustrates the effect of knocking down VDAC2 in zebrafish using the Morpholino sequence in Example 3.
[0021] Figure 7 This refers to the inhibitory effect of VDAC2 knockdown in zebrafish on the inflammatory response induced by SVCV infection, as described in Example 3.
[0022] Figure 8 The results of Example 3 show the effect of VDAC2 knockdown on the survival rate of SVCV infection in zebrafish. Detailed Implementation
[0023] To make the technical problems, technical solutions, and beneficial effects of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. Obviously, the described embodiments are only some embodiments of this invention, and not all embodiments.
[0024] Unless otherwise specified, the methods described in the following examples are conventional; the reagents and materials described are commercially available unless otherwise specified.
[0025] Example 1: Inhibitory effect of Dids on inflammatory response induced by SVCV infection
[0026] In this study, the VDAC2 inhibitor Dids was used to verify in vitro the inhibitory effect of VDAC2 on the inflammatory response induced by SVCV infection. The specific procedure is as follows:
[0027] (1) Dods toxicity experiment on cells.
[0028] In this example, the MTT assay was used to detect the toxicity of Dids. The specific method was as follows: Epithelioma Papulosum Cyprini (EPC) cells in the logarithmic growth phase were collected, the cell suspension concentration was adjusted, and the cells were added to 96-well plates. 200 μL of culture medium was added to each well, and the cell density was 1000-5000 / well. The edge wells were filled with sterile PBS. After incubation at 28°C with 5% CO2 until the cells adhered (about 6-8 h), a concentration gradient of Dids was added, with 6 replicates for each gradient. The cells were incubated for another 48 h, and the cell status was observed under an inverted microscope. 20 μL of MTT solution (5 mg / ml, i.e., 0.5% MTT) was added to each well, and the cells were cultured for another 4 h before the culture was terminated. The culture medium in the wells was carefully aspirated. 150 μL of dimethyl sulfoxide was added to each well, and the plates were placed on a decolorizing shaker and shaken at low speed for 10 min to fully dissolve the crystals. The absorbance of each well was measured at OD490 nm using an ELISA reader, and the cell viability was calculated.
[0029] This experiment also included zeroing wells (culture medium, MTT, dimethyl sulfoxide) and control wells (cells, solvent of the corresponding concentration, culture medium, MTT, dimethyl sulfoxide).
[0030] The results are as follows Figure 1 As shown, the cell viability of EPC cells treated with various concentrations of Dids for 48 hours did not change significantly compared with the control group, indicating that the concentrations of Dids used had no toxic effect on EPC cells.
[0031] (2) Dids inhibit the inflammatory response caused by SVCV infection.
[0032] Interleukin-1β (IL-1β) is an important pro-inflammatory cytokine in fish, closely related to inflammatory responses, and often used as an indicator of inflammation levels. This study investigated the effect of different concentrations of dids on IL-1β gene expression levels. The specific procedure is as follows:
[0033] EPC cells were seeded in 12-well plates. After reaching 70-80% confluence, the culture medium was discarded, and cells were adsorbed with 1 mL of 0.1 MOI SVCV. The plates were incubated at 28°C for 1 h, and the free virus was washed away. Complete culture medium containing 25 μM, 5 μM Dids, and PBS was added, and the plates were incubated at 28°C with 5% CO2 for another 24 h (three independent replicates were set up for each concentration treatment). After 24 h, total RNA was extracted from the cells, and the expression level of IL-1β gene was detected by reverse transcription and quantitative real-time fluorescence detection. The primer pair sequence for quantitative detection of IL-1β gene was GACTTCGCAGCACAAAA / GGCACTGAATCCACCAC.
[0034] The results are as follows Figure 2As shown, compared with the SVCV infection group, the expression level of IL-1β was significantly reduced when the concentration of Dids was 5 μM and 25 μM (P < 0.0001), downregulated by 39.20% and 54.71% respectively compared with the SVCV infection group, indicating that Dids can inhibit the expression level of IL-1β in a concentration-dependent manner.
[0035] Example 2: Inhibitory effect of Dids on inflammatory response induced by SVCV infection in zebrafish
[0036] This example uses zebrafish to investigate the effect of intraperitoneal injection of Dids on SVCV infection in fish. The method is as follows:
[0037] Adult zebrafish aged three months were purchased from the National Zebrafish Resource Center and acclimatized for two weeks at 28℃, fed with brine shrimp twice daily (morning and evening). After the acclimatization period, healthy, disease-free zebrafish of similar size and uniformity were selected. The selected zebrafish were then cooled by 1℃ daily, gradually decreasing the water temperature from 28℃ to 16℃ and maintaining it at 16℃ for subsequent experiments. Dissolved oxygen levels in the culture water were maintained at 6-14 mg / L using an air pump, and the pH was controlled between 6.8 and 7.8. The zebrafish were divided into a control group and a Dids injection group (50 μg / g), with the control group receiving the same volume of DMSO as a control. SVCV virus suspension was injected into the infected zebrafish along the base of the pelvic fins, and survival was observed and recorded over 14 days.
[0038] See results Figure 3 The survival rate of zebrafish infected with SVCV was 26.67%, while the addition of Dids significantly increased the survival rate of zebrafish infected with SVCV to 80%, indicating that Dids can improve the survival rate of zebrafish infected with SVCV.
[0039] On day 7 of infection, the heart, spleen, liver, intestine, kidney, and brain of the zebrafish in the above experiment were taken, and total RNA was extracted. After reverse transcription, relative IL-1β was detected by fluorescence quantitative analysis.
[0040] See results Figure 4 The results indicate that Dids significantly reduced the IL-1β transcription levels in the heart, spleen, liver, intestine, kidney, and brain of zebrafish infected with SVCV.
[0041] Liver, intestine, brain, and kidney of zebrafish uninfected with SVCV and zebrafish infected with SVCV for 5 days were fixed in 4% paraformaldehyde, then dehydrated, cleared, embedded in paraffin, sectioned, and stained with H&E to observe changes in the tissue structure of the organs.
[0042] See results Figure 5 Compared with the control group, the organs of zebrafish treated with Dids were normal and there was no difference, indicating that Dids treatment was not toxic to zebrafish. Compared with the SVCV infection group, the pathological damage caused by the virus infection in the organs of zebrafish infected with SVCV was significantly reduced after Dids treatment, indicating that Dids significantly reduced the pathogenicity of SVCV infection in zebrafish.
[0043] Example 3: Inhibitory effect of VDAC2 knockdown in vivo on SVCV infection-induced inflammatory response
[0044] This example uses zebrafish to verify the inhibitory effect of in vivo knockdown of VDAC2 (gene sequence shown in SEQ ID NO.1 (NM_199585.2), amino acid sequence shown in SEQ ID NO.2 (NP_955879.1)) on the inflammatory response induced by SVCV infection. The specific experimental procedure in this example is as follows:
[0045] (1) VDAC2 knockdown.
[0046] The Morpholino sequence of VDAC2 was injected into embryos at approximately 1-4 cell stage. A small number of these embryos were harvested 24 hpf later, and total RNA was extracted and reverse transcribed for RT-PCR to detect inhibition efficiency. The specific procedure is as follows:
[0047] First, 300 nmol of morpholinooligo (VDAC2-MO) of the VDAC2 gene was ordered from Gene Tools, LLC (Philomath, OR). Then, 100 μL of sterile water was added to prepare a 3 mM stock solution. The solution was aliquoted and stored at -20°C. On the day of injection, the morpholino solution was heated at 65°C for 5 minutes. It was immediately cooled on ice and vortexed. The working solution was maintained at room temperature. Under a dissecting microscope, the droplet diameter was measured, and the injection time and pressure were adjusted to ensure that the diameter of the microinjected droplets was 0.15 mm (approximately 1.76 nL). Zebrafish were randomly mated in the morning, and 1-cell stage embryos were collected and placed in 1x E3 medium. Using a 3 ml pipette, the embryos were arranged along the wedge-shaped groove of the microinjection chamber plate. The medium was removed, leaving the embryos slightly submerged, not submerged. The micropipette was used to penetrate the chorionic membrane, followed by the yolk, to inject the embryos. After microinjection, the embryos were placed in E3 medium dishes and incubated at 28.5°C. A small number of embryos were taken after injection at 24 hpf, and total RNA was extracted and reverse transcribed for RT-PCR to detect the inhibition efficiency.
[0048] The MO sequence information used in this example is as follows:
[0049] vdac2-201 e3i3 / -202e2i2 Morpholino oligo sequence:
[0050] vdac2-MO: CAAAATTGAGTCTCACCACTCCACT,
[0051] RC: AGTGGAGTGGTGAGACTCAATTTTG;
[0052] vdac2-201 e5i5 / -202e4i4 Morpholino oligo sequence:
[0053] vdac2-MO:TGTGAGAAATTAATATAACCCTGTGT,
[0054] RC: ACACAGGGTATATTAATTTCTCACA;
[0055] vdac2-201 e7i7 / -202e6i6 Morpholino oligo sequence:
[0056] vdac2-MO:AAAACGTGCGTTTACTCACACTGA,
[0057] RC:TCAGTGTGAGTAAACGGCACGTTTT;
[0058] Control MO: CCTCTTACCTCAGTTACAATTTATA.
[0059] The results are as follows Figure 6 As shown, the VDAC2 transcription level in the VDAC2-MO injection group was significantly lower than that in the control group (P < 0.0001), indicating that VDAC2 was successfully knocked down in vivo.
[0060] (2) Knockdown of VDAC2 inhibits the inflammatory response caused by SVCV infection.
[0061] This step examined the effect of VDAC2 knockdown on IL-1β gene expression levels in vivo. The specific procedure is as follows:
[0062] The Morpholino sequence of VDAC2 was injected into embryos at approximately 1-4 cell stage using the microinjection method described above. Zebrafish larvae hatched at 3 days post-exposure (dpf). On day 3, the larvae were infected with SVCV (2 × 10⁻⁶). 6Survival rates were calculated, and a suitable amount of zebrafish juveniles were collected 24 hours after infection. Total RNA was extracted and reverse transcribed for RT-PCR detection of the expression level of the pro-inflammatory factor IL-1β gene.
[0063] The results are as follows Figure 7 As shown, compared with the SVCV infection group, the expression level of IL-1β was significantly reduced after VDAC2 knockdown (P<0.0001), downregulated by 91.80% compared with the SVCV infection group. Knockdown of VDAC2 can inhibit the expression level of IL-1β gene.
[0064] At the same time, such as Figure 8 As shown, compared with the control group, knocking down VDAC2 can increase the survival rate of juvenile fish by nearly 53.33%, indicating that knocking down VDAC2 in vivo can improve the survival rate of zebrafish infected with SVCV.
[0065] In summary, VDAC2 inhibitors (Dids) or VDAC2 knockdown can effectively suppress the inflammatory response induced by carp spring viremia virus and significantly improve the survival rate of fish infected with SVCV. Therefore, VDAC2, as a target, can be used to develop drugs for virus control in aquaculture, which is of great significance for the prevention and control of aquatic viruses.
[0066] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any changes or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in the present invention should be included within the scope of protection of the present invention.
Claims
1. Application of VDAC2 gene inhibitor in the preparation of drugs for the prevention and treatment of fish diseases caused by carp spring viremia virus (SVCV); The inhibitor is at least one of the Morpholino sequence and 4,4′-diisothiocyanostilbene-2,2′-disulfonic acid; The Morpholino sequence is vdac2-MO: CAAAATTGAGTCTCACCACTCCACT.
2. The application according to claim 1, characterized in that, The drug also includes pharmaceutically acceptable excipients.
3. The application according to any one of claims 1-2, characterized in that, The drug is administered orally, by feeding with feed, or by injection, and is given to an individual at an effective dose.