A naked eye visualization method for mycobacterium tuberculosis detection
By constructing a gold nanoparticle colorimetric biosensor with a toehold-containing three-way junction (TWJ) and CRISPR/Cas14a-assisted magnetic separation, the problems of long detection time, expensive equipment, and insufficient sensitivity of Mycobacterium tuberculosis were solved, realizing rapid, simple, and sensitive nucleic acid detection, which is applicable to a variety of nucleic acid samples.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- 重庆医科大学国际体外诊断研究院
- Filing Date
- 2023-08-24
- Publication Date
- 2026-07-03
AI Technical Summary
Existing technologies for detecting Mycobacterium tuberculosis suffer from problems such as long detection time, the need for expensive equipment and professional personnel, limited applicability, and insufficient sensitivity, making them particularly unsuitable for areas with limited medical resources.
A toehold-containing three-way junction (TWJ)-mediated multi-cycle exponential amplification and CRISPR/Cas14a-assisted magnetic separation enhances the gold nanoparticle colorimetric biosensor. The TWJ is formed through target DNA hybridization, triggering multi-cycle exponential amplification. The trans-cleavage activity of CRISPR/Cas14a is used to release the gold nanoparticle probe, and the magnetic bead separation enables naked-eye visual detection.
It enables rapid, simple, and sensitive nucleic acid detection of Mycobacterium tuberculosis, is applicable to a variety of nucleic acid samples, and has high sensitivity and specificity, making it suitable for medical environments with limited resources.
Smart Images

Figure CN117210538B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of rapid visualization detection technology, and relates to a method and kit for the visualization detection of Mycobacterium tuberculosis by recognizing target nucleic acids to form three-way knots (TWJ) containing toeholds and inducing multi-cycle exponential amplification, cascading CRISPR / Cas14a magnetic separation to enhance gold nanoparticle colorimetry. Background Technology
[0002] Tuberculosis (TB), caused by Mycobacterium tuberculosis (MTB), is an infectious disease and one of the leading causes of death worldwide. The gold standard for detecting Mycobacterium tuberculosis is microscopic examination after bacterial culture, with a detection time of approximately 4-6 weeks. Biomolecular detection is an important tool for early diagnosis, treatment, prognosis, and pathogen screening. Xpert MTB / RIF (Cepheid, Sunnyvale, USA) is a WHO-approved PCR method for clinical use, capable of detecting Mycobacterium tuberculosis and rifampicin-resistant strains within 2 hours. However, it requires expensive laboratory equipment and highly trained personnel, making it unsuitable for areas with limited medical resources. Therefore, there is still a need to develop a simple, convenient, sensitive, and rapid method for detecting Mycobacterium tuberculosis.
[0003] Many isothermal amplification-based methods have been developed for the detection of Mycobacterium tuberculosis, including ligase chain reaction (LCR), loop-mediated isothermal amplification (LAMP), and rolling loop amplification (RCA). EXPAR technology is widely used due to its high amplification efficiency (~10⁸-fold), short reaction time, and simple procedure [Angewandte Chemie (International ed. in English) 2018, 57(37), 11856-11866; SensorsandActuatorsB-Chemical2021,346]. However, the target nucleic acid in EXPAR reactions is limited to a short sequence or a 3' end sequence that needs to be released after enzyme digestion, which to some extent limits the applicability of EXPAR technology. Three-way knots (TWJs) use a pair of adjacent probes as primers and templates, specifically recognizing and binding to the target to form a TWJ, with the primers amplifying along the template. TWJ is used for nucleic acid detection without being limited by nucleic acid length [Nucleic acids research 2001, 29(11), E54-4; Biosensors & bioelectronics 2020, 167, 112474].
[0004] The CRISPR / Cas system is a powerful gene editing tool that can accurately identify and manipulate nucleic acids. In addition to its gene editing function, based on the specific recognition of nucleic acid sequences by CRISPR RNA (crRNA) and the non-specific trans-cleavage activity of Cas protein, the CRISPR / Cas system has shown great potential in nucleic acid detection [Cell 2014, 157(6), 1262-1278; Science advances 2021, 7(5)]. A series of detection platforms have been built using different CRISPR-Cas systems, such as Cas12a and Cas13a. In 2018, Jennifer's research group discovered a novel Cas nuclease, Cas14a, in uncultured archaea. Cas14a is the smallest Cas protein discovered to date. In the absence of a PAM sequence, CRISPR / Cas14a is activated by recognizing ssDNA targets via guide RNA (sgRNA), achieving non-specific trans-cleavage of ssDNA reporter genes [Science (New York, NY) 2018, 362(6416), 839-842]. Furthermore, CRISPR / Cas14a can recognize single-base mutations with high fidelity. Due to these unique advantages, Cas14a holds great potential for DNA detection.
[0005] AuNPs, with their high molar absorption coefficient of 10⁷–9 L / mol·cm, are widely used in visual detection. Magnetic beads are commonly used in capture and separation processes to reduce background signal interference.
[0006] This invention constructs a toehold-containing three-dimensional junction-mediated multi-cycle exponential amplification and CRISPR / Cas14-assisted magnetic separation enhanced AuNP colorimetric biosensor, which can conveniently, quickly and reliably realize a new method for naked-eye visual nucleic acid detection of Mycobacterium tuberculosis 16S rDNA. Summary of the Invention
[0007] A naked-eye visualization method for detecting Mycobacterium tuberculosis, the process and principle of which are as follows:
[0008] The target DNA hybridizes to form a three-way junction (TWJ) containing a toehold, initiating toehold-mediated multicycle exponential amplification. The amplification product activates the CRISPR / Cas14 lateral cleavage of the substrate oligonucleotide chain S1, releasing the gold nanoprobe AuNP-S2, which can be captured by the magnetic bead complex MB-S1 through the S1 chain. The supernatant gold nanoprobe appears as a naked-eye visible red color, thus allowing the determination of the target DNA.
[0009] The oligonucleotide chain S1 is both a trans-cleavage substrate for CRISPR / Cas14 and a trapping strand for the gold nanoparticle probe AuNP-S2.
[0010] The magnetic bead complex MB-S1 is a complex of biotinylated trapping chain S1 and streptavidin magnetic beads.
[0011] The gold nanoprobe AuNP-S2 is a gold nanomaterial immobilized with the oligonucleotide chain S2.
[0012] Preferred: Contains the following characteristic components:
[0013] 1) Primers and template of TWJ: The TWJ template has a 5'-YSMXY-3' structure, consisting of the primer recognition region (M), the target-specific recognition region (X), the NtBstNBI restriction enzyme recognition sequence and cleavage site (5'-N↓NNNNGACTC-3') (S); the 3' end of the template is phosphorylated; the template contains the same sequence (Y) at the 3'-end and 5'-end, which can form TWJ containing toeholdY; the primer mainly consists of the target recognition region and the template complementary sequence, which is as short as 7-10 bp;
[0014] 2) The CRISPR / Cas14a guide sgRNA sequence has a variable region that binds complementary to the amplified product strand.
[0015] The sequence is: 5'-GCUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUGAAAGAAUGAAGGAAUGCAACAACUAUACAACCUACUACCUCA-3';
[0016] The Cas14a trans-shearing substrate S1 has the sequence: 5'-TATTATTTGCTTTTGTTGTG-3', with biotin modified at the 5' end, which can be immobilized on streptavidin-modified magnetic beads to form the magnetic bead-immobilized complex MB-S1.
[0017] The oligonucleotide chain AuNP-S2 modified with gold nanoparticles, with the S2 sequence being 5'-AAAAAAAAAAACACAACAAAAGCAAAT-3', can achieve magnetic pull-down of gold nanoparticles by complementary binding with the biotin-S1 probe.
[0018] The remaining components include Vent (exo-) DNA polymerase, Nt.BstNBI cleavage enzyme, dNTB, CRISPR / Cas14a, streptavidin beads, RNase-free water, and the optimal buffer for the enzyme.
[0019] The applicable polymerases include, but are not limited to, phi29, KlenowFragment, KlenowFragment(exo-), vent(exo-), and BstDNA polymerase, and the applicable cleavage enzymes include, but are not limited to, Nt.BstNBI, Nt.BspQI, Nt.BspQI, Nt.BsmAI, Nt.BsmI, Nb.BsmI, Nb.BsrDI, and Nb.BbvCI cleavage enzymes.
[0020] Preferred TWJ primer and template sequences for Mycobacterium tuberculosis 16S rDNA are:
[0021] TWJ primers:
[0022] 5'-GTCCCGCCGATCTCGTCCAGCGCCGTTGTATTAG-3'
[0023] TWJ Template:
[0024] 5-AACTATACAACCTACTACCTCAAACAGACTCTTTTTCATAATCCTTCGGACCACCAGCACCTAACCTTTTTAACTATACAACCTACTACCTCA-P-3', 3' terminal phosphate group modification.
[0025] Preferred formulations and typical steps are as follows:
[0026] 1) TWJ formation and multiplex exponential amplification process: The reaction system contains 5-10 times diluted nucleic acid sample to be tested, 0.5×NEBr3.1 buffer, TWJ primers, TWJ template, dNTPs, and is incubated at 95℃ for 5 min. The temperature is then slowly reduced to 55℃ at a rate of 0.1℃ / s and maintained for 5-10 min to allow it to form a stable triaxial structure. Subsequently, Vent (exo-) DNA polymerase, Nt.BstNBI nicking enzyme at 10-15 times the amount of polymerase, 1×ThermoPol buffer, and a certain amount of RNase-free water are added. The reaction is carried out at 45-65℃ for 10-60 min, preferably at 55℃ for 20 min.
[0027] 2) CRISPR / Cas14a activation and trans cleavage of substrate biotin-S1: Pre-incubate Cas14a1 buffer, Cas14a1, and sgRNA for 10-30 min, add substrate biotin-S1 and a certain amount of the above-obtained TWJ amplification product solution (diluted 5-10 times), and react at 37℃ for 10-60 min, preferably 30 min;
[0028] 3) Magnetic separation enhanced colorimetric detection: Dilute the optimized amount of streptavidin magnetic beads 3-5 times with buffer A, add the above Cas14a1 shearing product, and bind at room temperature for 15 min; after magnetic separation, add AuNP-S2 probe solution and incubate at room temperature for 5 min. After magnetic separation, measure the UV-Vis absorbance of the supernatant at 520 nm or observe and analyze it with the naked eye;
[0029] The preferred buffer A is: 10 mM Tris-HCl, 1.0 mM EDTA, 1.0 M NaCl, 0.02% Tween-20, pH 7.4.
[0030] Preferred reaction conditions are:
[0031] 1) TWJ-triggered multiplex exponential amplification: The total volume is 20 µl, so that the final concentration of TWJ primer reaction is 1~20 nM, preferably 5 nM; the final concentration of TWJ template reaction is 10~100 nM, preferably 20 nM; the final concentration of Vent (exo-) DNA polymerase reaction is 0.1~0.5 U / µl, preferably 0.2 U / µl; the final concentration of Nt.BstNBI nicking enzyme reaction is 1~5 U / µl, preferably 3 U / µl;
[0032] 2) Preparation of DNA-functionalized gold nanoparticles (AuNP-S2): AuNP gold nanoparticles and thiolized DNA (SH-S2) were cryo-coupled at 20°C. After thawing, the mixture was centrifuged at 12,000 rpm for 20 min, washed three times with buffer I, and centrifuged again at 12,000 rpm for 20 min at 4°C. The AuNP-S2 conjugate was redispersed in buffer I and stored at 4°C.
[0033] Buffer I is a 0.1M sodium chloride, 0.01M phosphate buffer, pH 7.4;
[0034] The final concentration of SH-S2 is 3~10µM, preferably 5µM; the final concentration of AuNP is 5nM; the molar ratio of SH-S2 to AuNP is preferably 1000:1; AuNP and SH-S2 are frozen and coupled at -20℃ for 0.5~8h, preferably 2h.
[0035] 3) Cascaded CRISPR / Cas14a magnetic separation enhanced colorimetric detection: The total reaction volume is 20 µl, so that the final concentration of Cas14a1 is 100~1000 nM, preferably 250 nM; the final concentration of sgRNA is 100~1000 nM, preferably 500 nM; the final concentration of biotin-S1 is 50~500 nM, preferably 200 nM; the CRISPR / Cas14a enzyme activation and cleavage reaction is carried out at 37℃ for 30 min.
[0036] 4) The preferred amount of streptavidin magnetic beads added is 120µg, with a final concentration of 1.2µg / µl; bind with an appropriate amount of the above Cas14a shearing product for 10-30 min.
[0037] Preferred: Applicable to DNA and RNA samples, including but not limited to bacterial DNA genes such as Mycobacterium tuberculosis, Escherichia coli, Klebsiella pneumoniae, Streptococcus, and Staphylococcus aureus, and RNA genes such as SARS virus, MERS virus, HIV virus, hepatitis C virus, and Coxsackie virus. Attached Figure Description
[0038] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.
[0039] Appendix Figure 1 The reaction mechanism of toehold-containing three-dimensional junction-initiated multi-cycle exponential amplification and CRISPR / Cas14a-assisted magnetic separation to enhance visual detection of Mycobacterium tuberculosis.
[0040] Appendix Figure 2 The formation of TWJ and PAGE analysis of TWJ induced amplification.
[0041] Appendix Figure 3 Feasibility of CRISPR / Cas14a-assisted magnetic pull-down AuNP-S2.
[0042] Appendix Figure 4 UV absorption spectrum response of Mycobacterium tuberculosis 16S rDNA at different concentrations.
[0043] Appendix Figure 5 Visualization results of different concentrations of Mycobacterium tuberculosis 16S rDNA.
[0044] Appendix Figure 6 Linear relationship between absorbance (A520) and logarithmic concentration of Mycobacterium tuberculosis 16S rDNA.
[0045] Appendix Figure 7 Method specificity.
[0046] Appendix Figure 8 Clinical sample testing. Detailed Implementation
[0047] This invention relates to a toehold-initiated TWJ-driven multi-cycle exponential amplification and CRISPR / Cas14-assisted magnetic separation enhanced AuNP colorimetric biosensor and formulation for naked-eye visualization detection of Mycobacterium tuberculosis 16S rDNA.
[0048] Example 1: Preparation and characterization of DNA-functionalized AuNPs:
[0049] The final concentration of the SH-S2 probe was 5 µM, and the final concentration of AuNP was 5 nM. After thawing, the sample was centrifuged at 12,000 rpm for 30 min, the supernatant was discarded, and the sample was washed three times with buffer I (0.1 M sodium chloride, 0.01 M phosphate buffer, pH 7.4). Finally, the AuNP-S2 conjugate was redispersed in buffer I and stored in the dark at 4 °C for later use.
[0050] Example 2: Feasibility verification based on TWJ formation and TWJ-induced amplification:
[0051] 12% polyacrylamide gel electrophoresis (PAGE) was used to demonstrate the formation of TWJ and the feasibility of TWJ-induced amplification. M: DNA marker; Lane 1: 16S rDNA fragment (final concentration 200 nM); Lane 2: TWJ substrate (final concentration 200 nM); Lane 3: TWJ template (final concentration 200 nM); Lane 4: TWJ primer + TWJ template (both final concentrations 200 nM); Lane 5: Triple-stranded structure formed by 16S rDNA + TWJ primer + TWJ template (both final concentrations 200 nM); Lane 6: 16S rDNA + TWJ primer + TWJ template + Vent (external) DNA polymerase (nucleic acid strands added to a final concentration of 200 nM, polymerase added 0.4 U, incubated at 55°C for 10 minutes). (min), Lane 7: 16S rDNA + TWJ primer + TWJ template + Vent (exo-) DNA polymerase + Nt. BstNBI cutting enzyme (add 16S rDNA final concentration 5nM, primer final concentration 5nM, template final concentration 50nM, add polymerase 0.4U, cutting enzyme 6U, incubate at 55℃ for 10min), Lane 8: TWJ primer + TWJ template + Vent (exo-) DNA polymerase + Nt. BstNBI cutting enzyme (add primer final concentration 10nM, template final concentration 50nM, add polymerase 0.4U, cutting enzyme 6U, incubate at 55℃ for 10min). Take 10 μl of the reaction product and add 2 μl of 6× loading buffer. After mixing, add the mixture to each electrophoresis channel. Electrophoresis is performed at a constant voltage of 120 V for 50 min in 1× TBE buffer (2 mM EDTA, 89 mM triboric acid, pH 8.3), followed by 4S GelRed staining for 20 min. Finally, the gel is visualized using a gel imaging system.
[0052] As attached Figure 2 As can be seen, compared with adding target DNA, TWJ primers, and TWJ template separately (lanes 1-3), the bright band with high molecular weight in lane 5 indicates the formation of TWJ complex I in the presence of target DNA, primers, and template; the addition of polymerase triggered the extension of TWJ primers, producing TWJ complex II with a larger molecular weight (lane 6); the addition of polymerase and cleavage enzyme generated ssDNA amplification products (lane 8), and no amplification product band was observed in lane 7 (no target). The results demonstrate the feasibility of TWJ formation and TWJ-induced amplification in the presence of target DNA.
[0053] The polymerase can be replaced with phi29, KlenowFragment, KlenowFragment(exo-) or BstDNA polymerase, and the cleavage enzyme can be replaced with Nt.BstNBI, Nt.BspQI, Nt.BspQI, Nt.BsmAI, Nt.BsmI, Nb.BsmI, Nb.BsrDI and Nb.BbvCI cleavage enzymes, and the reaction should be carried out under the optimal conditions of the corresponding enzymes. Experimental procedure: omitted.
[0054] Example 3: Detection of Mycobacterium tuberculosis 16S rDNA concentration response based on the detection strategy proposed in this invention:
[0055] Add 2 µl of different concentrations of Mycobacterium tuberculosis 16S rDNA (500 pM, 200 pM, 100 pM, 50 pM, 20 pM, 5 pM, 2 pM, 1 pM, 500 fM) (2 µl of TE buffer was added to the blank control group), 0.5 × NEBr 3.1 buffer, TWJ primers (2 µl, 50 nM), TWJ template (2 µl, 20 nM), and dNTPs (2 µl, 5 mM). Incubate at 95 °C for 5 min, then slowly decrease to 55 °C (0.1 °C / s) and hold for 5 min to form a stable tri-dimensional structure. Then add 0.4 UVent (exo-) DNA polymerase, 6 UNt. BstNBI nicking enzyme, and 1 × ThermoPol buffer, and add a certain amount of RNase-free water to make a total volume of 20 µl. Incubate at 55 °C for 20 min. Take 4 µl of the amplification product and add 1×Cas14a1 buffer, 250 nM Cas14a1, 500 nM sgRNA, and 200 nM biotin-S1. Incubate at 37 °C for 30 min. Place 30 µl of magnetic beads on a magnetic rack for magnetic separation. Discard the supernatant, resuspend in buffer 1 to 80 µl, add 20 µl of the above Cas14a1 reaction product, and bind at room temperature for 15 min. After magnetic separation of the supernatant, add 70 µl of AuNP-S2 probe solution (5 nM) and incubate at room temperature for 5 min. Finally, use the supernatant after magnetic separation to measure the UV-Vis absorbance at 520 nm for quantitative analysis and visual visualization.
[0056] The results are attached. Figure 4 As the concentration of the target 16S rDNA increases, the biosensor exhibits varying degrees of color change after magnetic separation, with the color change induced by the 50 fM target clearly distinguishable to the naked eye. Quantitative detection was performed by measuring the UV-Vis absorption peak at 520 nM (results are attached). Figure 5 Within the range of 50 fM to 5 pM, the absorbance showed a good linear relationship with the logarithm of the target concentration (results are attached). Figure 6 The equation is as follows: Y = 0.46lgC + 6.38, with R² = 0.993. The LOD value of this biosensor is 20.71 fM. The detection strategy proposed in this invention has high sensitivity.
[0057] Example 4: Detection specificity analysis based on the detection strategy proposed in this invention:
[0058] A DNA fragment of the same length but different sequence as the target 16S rDNA fragment was synthesized as a non-target sequence control: CCACCAGCACCTAACCGGCTGTGGGTAGTAGACCTCACCTATGTGTCGACC, and compared with the target sequence at a concentration of 10 pM. EP tubes were filled with 2 μl of different samples (100 pM 16S rDNA, 100 pM non-target sequence, TE buffer), followed by 0.5×NEBr3.1 buffer, TWJ primers (2 µl, 50 nM), TWJ template (2 µl, 20 nM), and dNTPs (2 µl, 5 mM). The tubes were incubated at 95 °C for 5 min, then slowly cooled to 55 °C (0.1 °C / s) and held for 5 min to form a stable three-dimensional structure. Subsequently, 0.4 μL UVent (exo-) DNA polymerase, 6 μL UNt. BstNBI nicking enzyme, and 1 × ThermoPol buffer were added, along with a certain amount of RNase-free water to bring the total volume to 20 µL. The mixture was incubated at 55 °C for 20 min. 4 µL of the amplification product was then removed and further incubated with 1 × Cas14a1 buffer, 250 nM Cas14a1, 500 nM sgRNA, and 200 nM biotin-S1, and incubated at 37 °C for 30 min. 30 µL of magnetic beads were placed on a magnetic rack for magnetic separation. The supernatant was discarded, and the mixture was resuspended in buffer 1 to 80 µL. 20 µL of the Cas14a1 reaction product was added, and the mixture was allowed to bind at room temperature for 15 min. After magnetic separation of the supernatant, 70 µL of AuNP-S2 probe solution (5 nM) was added, and the mixture was incubated at room temperature for 5 min. Finally, the absorbance of the magnetically separated supernatant was measured at 520 nm for quantitative analysis and visual visualization.
[0059] The results are attached. Figure 7 The solution turned red only when the target sequence 16S rDNA was added; otherwise, it remained colorless, consistent with the color of the blank group (with added TE buffer). This suggests that the magnetic separation-enhanced colorimetric method based on a TWJ single template and the CRISPR / Cas14a biosensor using AuNP as a signal reporter gene designed in this invention exhibit high specificity for Mycobacterium tuberculosis 16S rDNA.
[0060] Example 5: Application of the detection strategy proposed in this invention to clinical sample testing:
[0061] Clinical isolates (P1-P5) from sputum samples of five tuberculosis patients were detected, with sputum samples from healthy individuals serving as controls (N1-N2). One to two volumes of 4% sodium hydroxide were added to the sputum samples, and the mixture was liquefied for 15 min. After liquefaction, 45 ml of sterile phosphate buffer (pH 6.8) was added to the test tubes, and the mixture was thoroughly mixed. The tubes were centrifuged at 8000 rpm for 15 min, and the supernatant was discarded. Genomic DNA was extracted and purified using the TaKaRaMiniBEST Bacteria Genomic DNA Extraction Kit Ver. 3.0. 2 μl of genomic DNA from different samples (P1-P5, NI-N2) was added to each EP tube, along with 0.5×NEBr3.1 buffer, TWJ primers (2 µl, 50 nM), TWJ template (2 µl, 20 nM), and dNTPs (2 µl, 5 mM). The tubes were incubated at 95°C for 5 min, then slowly cooled to 55°C (0.1°C / s) and held for 5 min to form a stable three-dimensional structure. Subsequently, 0.4 μL UVent (exo-) DNA polymerase, 6 μL UNt. BstNBI nicking enzyme, and 1 × ThermoPol buffer were added, along with a certain amount of RNase-free water to bring the total volume to 20 µL. The mixture was incubated at 55 °C for 20 min. 4 µL of the amplification product was then removed and further incubated with 1 × Cas14a1 buffer, 250 nM Cas14a1, 500 nM sgRNA, and 200 nM biotin-S1, and incubated at 37 °C for 30 min. 30 µL of magnetic beads were placed on a magnetic rack for magnetic separation. The supernatant was discarded, and the mixture was resuspended in buffer 1 to 80 µL. 20 µL of the Cas14a1 reaction product was added, and the mixture was allowed to bind at room temperature for 15 min. After magnetic separation of the supernatant, 70 µL of AuNP-S2 probe solution (5 nM) was added, and the mixture was incubated at room temperature for 5 min. Finally, the absorbance of the magnetically separated supernatant was measured at 520 nm for quantitative analysis.
[0062] The results are attached. Figure 8 Compared with samples from healthy individuals, samples P1 to P5 all tested positive. These results indicate that the magnetic separation-enhanced colorimetric method based on a TWJ single template and the CRISPR / Cas14a biosensor using AuNP as a signal reporter gene designed in this invention have clinical application potential.
Claims
1. A naked-eye visualization method for detecting Mycobacterium tuberculosis for non-diagnostic and therapeutic purposes, characterized in that, The process and principle are as follows: The target DNA hybridizes to form a three-way junction TWJ containing toehold, which initiates toehold-mediated multicycle exponential amplification. The amplification product activates the CRISPR / Cas14 lateral cleavage of the substrate oligonucleotide chain S1, releasing the gold nanoprobe AuNP-S2 that can be captured by the magnetic bead complex MB-S1 through the S1 chain. The gold nanoprobe in the supernatant is visible to the naked eye as red, thus determining the target DNA. The oligonucleotide chain S1 is both a trans-cleavage substrate of CRISPR / Cas14 and a capture chain of the gold nanoparticle probe AuNP-S2. The magnetic bead complex MB-S1 is a complex of biotinylated trapping chain S1 and streptavidin magnetic beads. The gold nanoprobe AuNP-S2 is a gold nanomaterial with an immobilized oligonucleotide chain S2. in: 1) The TWJ primer and template sequences for Mycobacterium tuberculosis 16S rDNA are as follows: TWJ primers: 5'-GTCCCGCCGATCTCGTCCAGCGCCGTTGTATTAG-3' TWJ template: 5'-AACTATACAACCTACTACCTCAAACAGACTCTTTTTCATAATCCTTCGGACCACCAGCACCTAACCTTTTTAACTATACAACCTACTACCTCA-P-3', 3' terminal phosphate group modification; 2) The CRISPR / Cas14a guide sgRNA sequence has a variable region that binds complementary to the amplified product strand. The sgRNA sequence is as follows: 5'-GCUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUGAAAGAAUGAAGGAAUGCAACAACUAUACAACCUACUACCUCA-3' 3) Cas14a trans-shearing substrate S1, the S1 sequence is: 5'-TATTATTTGCTTTTGTTGTG-3', the 5' end is modified with biotin, which can be immobilized on streptavidin-modified magnetic beads to form a magnetic bead immobilized complex MB-S1; 4) AuNP-S2 oligonucleotide chain modified with gold nanoparticles, the S2 sequence of which is: 5'-AAAAAAAAAAACACAACAAAAGCAAAT-3' can be complementaryly bound to the biotin-S1 probe to achieve magnetic pull-down gold nanoparticles.
2. The naked-eye visual detection method for Mycobacterium tuberculosis for non-diagnostic and therapeutic purposes as described in claim 1, characterized in that, It contains the following characteristic components: The remaining components include Ventexo-DNA polymerase, Nt.BstNBI cleavage enzyme, dNTPs, CRISPR / Cas14a, streptavidin beads, RNase-free water, and the enzyme's optimal buffer; suitable polymerases include phi29, Klenow Fragment, Klenow Fragment exo-, vent exo-, and BstDNA polymerase, and suitable cleavage enzymes include Nt.BstNBI, BspQI, Nt.BspQI, BsmAI, BsmI, Nb.BsmI, Nb.BsrDI, and Nb.BbvCI cleavage enzymes.
3. The method for visually detecting Mycobacterium tuberculosis without eye contact for non-diagnostic or therapeutic purposes as described in claim 1, characterized in that... The formula and typical steps are as follows: 1) TWJ formation and multiplex exponential amplification process: The reaction system contains 5-10 times diluted nucleic acid sample to be tested, 0.5×NEBr3.1 buffer, TWJ primers, TWJ template, dNTPs, and is incubated at 95℃ for 5 min. The temperature is then slowly reduced to 55℃ at a rate of 0.1℃ / s and maintained for 5-10 min to allow it to form a stable triaxial structure. Subsequently, Vent exo-DNA polymerase, Nt.BstNBI cleavage enzyme at 10-15 times the amount of polymerase, 1×ThermoPol buffer, and a certain amount of RNase-free water are added, and the reaction is carried out at 45-65℃ for 10-60 min. 2) CRISPR / Cas14a activation and trans-cleavage of the substrate biotin-S1: Cas14a1 buffer, Cas14a1, Pre-incubate sgRNA for 10-30 min, add substrate biotin-S1 and a certain amount of the above-obtained TWJ amplification product solution to dilute it 5-10 times, and react at 37℃ for 10-60 min. 3) Magnetic separation enhanced colorimetric detection: Dilute the optimized amount of streptavidin magnetic beads 3-5 times with buffer A, add the above Cas14a1 shearing product, and bind at room temperature for 15 min; after magnetic separation, add AuNP-S2 probe solution and incubate at room temperature for 5 min; after magnetic separation, detect the UV-Vis absorbance of the supernatant at 520 nm or observe and analyze it with the naked eye; The buffer solution A is: 10 mM Tris-HCl, 1.0 mM EDTA, 1.0 M NaCl, 0.02% Tween-20, pH 7.
4.
4. The naked-eye visual detection method for Mycobacterium tuberculosis for non-diagnostic and therapeutic purposes as described in claim 3, characterized in that, The reaction conditions are: 1) TWJ-triggered multiplex exponential amplification: The total volume is 20µL, with the final concentration of TWJ primers being 1~20nM; the final concentration of TWJ templates being 10~100nM; the final concentration of Vent exo-DNA polymerase being 0.1~0.5U / µL; and the final concentration of Nt.BstNBI cleavage enzyme being 1~5U / µL. 2) Preparation of DNA-functionalized gold nanoparticles AuNP-S2: Gold nanoparticles AuNP and thiolized DNA SH-S2 were cryo-coupled at 20℃; after thawing, the mixture was centrifuged at 12000rpm for 20min, washed 3 times with buffer I, and centrifuged at 12000rpm for 20min at 4℃; the AuNP-S2 conjugate was redispersed in buffer I and stored at 4℃. The buffer solution I is a 0.1M sodium chloride, 0.01M phosphate buffer solution with a pH of 7.
4. The final concentration of SH-S2 is 3~10µM; the final concentration of AuNP is 5nM; the molar ratio of SH-S2 to AuNP is 1000:1; and AuNP and SH-S2 are frozen and coupled at -20℃ for 0.5~8h. 3) Cascaded CRISPR / Cas14a magnetic separation enhanced colorimetric detection: The total reaction volume was 20 µL, so that the final concentration of Cas14a1 was 100~1000 nM; the final concentration of sgRNA was 100~1000 nM; the final concentration of biotin-S1 was 50~500 nM; the CRISPR / Cas14a enzyme activation and cleavage reaction time was 37℃ for 30 min. 4) The amount of streptavidin magnetic beads added is 120µg, and the final concentration is 1.2µg / µL; bind with an appropriate amount of the above Cas14a shearing product for 10-30 min.
Citation Information
Patent Citations
Primers, probes, method and kit for detecting mycobacterium tuberculosis specific gene
CN107841568A
Methods for detecting and sequencing a target nucleic acid
US20210269858A1