Development method and application of KASP markers for chrysanthemum with osmanthus flower type

Abstract

The present invention discloses a method for developing KASP markers of chrysanthemum receptacle osmanthus type and its application. The present invention rapidly identifies chrysanthemum receptacle osmanthus type associated loci through BSA-seq based on whole-genome resequencing, and converts SNP and InDel associated loci into KASP markers. Compared with traditional PCR- and electrophoresis-based molecular markers, KASP markers have obvious advantages such as high conversion success rate, accurate genotyping, low development cost, strong flexibility, and easy automation. The developed KASP-Chr6__179207697-G / A has an identification accuracy rate of 76-85%, and can complete the screening of a large number of materials for receptacle osmanthus type in a short time, avoiding cumbersome field phenotyping observations during the flowering period and reducing the influence of environmental factors on phenotypic identification, thus greatly shortening the breeding cycle. The present invention lays an important foundation for realizing early large-scale, high-throughput, and automated detection and screening of chrysanthemum receptacle osmanthus type, and has important theoretical and practical significance for MAS breeding of chrysanthemum flower type.

Description

Technical Field

[0001] The present invention relates to a method for developing chrysanthemum tuoguihua-type KASP markers and its application, belonging to the field of plant molecular marker-assisted breeding. Background Art

[0002] Flowers are unique reproductive structures of angiosperms and are also the focus of research on their classification, systematics, and evolution. As one of the most important ornamental parts of ornamental plants, flowers directly affect their ornamental quality and commercial value. Chrysanthemum originated in China and is one of the top ten traditional famous flowers in China and one of the four major cut flowers in the world, occupying an important position in the flower industry. It has a wide variety of cultivars and different forms, and is known as a miracle in the history of world horticultural breeding (Su et al., 2019). Chrysanthemum has a typical capitulum of Compositae plants, which is composed of two types of florets: unisexual ligulate florets on the outer whorl and bisexual tubular florets in the middle. The petal types of chrysanthemum can usually be divided into flat petals, spoon-shaped petals, tubular petals, osmanthus petals, and abnormal petals. Different petal sizes, numbers, shapes, and arrangement combinations form various flower types. Among them, the tuoguihua type is popular among consumers because of the elongation and high degree of petalization of the tubular florets, the apical part of the corolla is split into osmanthus-like (i.e., osmanthus petals), and the tubular florets have rich colors and a relatively long flowering duration. Therefore, tuogui has become one of the important directions in chrysanthemum flower type breeding.

[0003] Currently, traditional cross-breeding is still the main method for cultivating new chrysanthemum varieties. However, traditional breeding methods have limitations such as long cycle, low efficiency, and non-directionality, and are easily affected by environmental factors and breeders' experience. Molecular marker-assisted selection (MAS) breeding technology uses molecular markers linked to target trait loci or genes to select superior individuals, without the need for a large number of field phenotypic identifications, with high breeding efficiency, not affected by environmental factors and the interaction between genotype and environment, and can accurately guide the polymerization of multiple genes, thus achieving the efficient improvement of comprehensive traits such as crop yield, quality, and resistance (Hasan et al., 2021). Studies have found that there are continuous variations and significant differences in the tuogui degree of different tuogui chrysanthemum varieties, showing typical quantitative genetic characteristics (Zhu Wenying et al., 2012; Tang Haiqiang, 2014; Yang Xiaodong, 2020). Since the flower type traits of chrysanthemum can only be manifested during the flowering period, it is urgent to establish a MAS breeding system for the tuoguihua type to achieve early selection of superior tuogui individuals.

[0004] BSA-seq is a gene mapping strategy that combines bulked segregant analysis (BSA) with next-generation sequencing technology. The main idea is to select individuals with extreme traits in the offspring population to construct DNA pools, and combine with whole-genome resequencing. By comparing the allele frequency differences of polymorphic sites SNPs (Single-nucleotide polymorphism) or InDels (Insertions and deletions) between the two pools, the genes or markers related to the target trait are further mapped through significantly different sites. Compared with traditional QTL mapping, this method has a short cycle, accurate mapping, and high cost performance, and has been successfully applied in crops such as wheat, tomato, Chinese cabbage, and cucumber (Li and Xu, 2021).

[0005] The marker type directly determines the genotype detection cost and is one of the important factors restricting the selection efficiency of MAS. Yang et al. (2019) developed a SCAR168 marker that can effectively distinguish between the anemone and non-anemone flower types in chrysanthemum, and the accuracy rates reached 92.50% and 87.86% respectively in two F 1 populations. However, SCAR markers based on PCR amplification require fragment separation by agarose gel or polyacrylamide gel electrophoresis, which is time-consuming and laborious, and it is not easy to achieve high-throughput and automated detection of a large number of samples. KASP (Kompetitive allele specific PCR) marker technology is one of the mainstream genotyping methods at home and abroad. This technology is based on the specific matching of the base at the end of the primer to accurately determine the bialleles of SNP or InDel sites, and has obvious advantages such as simplicity, flexibility, high accuracy, low cost, and high throughput, and can achieve high-throughput breeding platform detection (Semagn et al., 2014). At present, KASP genotyping technology has been successfully applied to the analysis of plant germplasm resource diversity, fingerprint map construction, gene mapping, etc., and there are few reports on the application of KASP markers in the MAS breeding of chrysanthemum flower types. Summary of the Invention

[0006] Objectives of the Invention: The first objective of the present invention is to provide a KASP marker for the anemone flower type of chrysanthemum. The second objective of the present invention is to provide a method for developing the above KASP marker for the anemone flower type of chrysanthemum. The third objective of the present invention is to provide the application of the above KASP marker for the anemone flower type of chrysanthemum in the early identification of the anemone flower type of chrysanthemum. The fourth objective of the present invention is to provide a method for early identification of the anemone flower type of chrysanthemum.

[0007] Technical solution: The present invention provides a chrysanthemum receptacle osmanthus type KASP marker, and the KASP marker is an SNP locus at position 179207697 on chrysanthemum chromosome 6, and this locus mutates from G to A.

[0008] The sequence of 200 bp flanking the SNP mutation site is: ATATGATTCTGAACATCCTCATTTTCATCTCATGAAAACTTAATAAATTGGTAAAATAAACTTCCCAACGAAAAATTCTTGCGGTAACCGAATAGCTCG[G / A]GATGCTCCGGATTTTGAACATGATTCTGAACAGCTCGTGTAACTCTCGAAATAAATTGGTCCGGAATAGAGTGTTTTTCCATACTAGAATCCTGTGTGAA.

[0009] The present invention also provides a method for developing the above chrysanthemum receptacle osmanthus type KASP marker, comprising the following steps:

[0010] (1) Hybridize two different chrysanthemum varieties as parents to obtain an F 1 hybrid offspring population; at least one of the parents is a receptacle osmanthus chrysanthemum variety, and the size n of the F 1 population > 150;

[0011] (2) Select multiple receptacle osmanthus lines and non-receptacle osmanthus lines from the F 1 hybrid offspring population as a marker development population, extract the DNA of the two parents and the receptacle osmanthus lines and non-receptacle osmanthus lines, and use it to construct extreme mixed pools of receptacle osmanthus type and non-receptacle osmanthus type; then select multiple receptacle osmanthus lines and non-receptacle osmanthus lines different from the development population from the F 1 hybrid offspring population as a validation population; perform genome re-sequencing on the two parents and the two extreme mixed pools;

[0012] (3) Align the clean reads sequences of the two parents, the receptacle osmanthus pool and the non-receptacle osmanthus pool with the chrysanthemum reference genome and perform variant detection;

[0013] (4) Perform BSA-seq analysis on the variant sites detected in step (3), and use two methods of Δ(SNP / InDel-index) and Euclidean distance ED to determine the significantly associated sites of chrysanthemum receptacle osmanthus type;

[0014] (5) Select |Δ(SNP / InDel-index)| and ED on the chromosome 2For the largest number of variant sites, use the "bedtools getfasta" program to extract 200bp flanking sequences for each site, and screen the sequences that meet the criteria as the associated sites of the chrysanthemum receptacle osmanthus type suitable for developing KASP markers;

[0015] (6) Design corresponding KASP primer sets according to the chrysanthemum receptacle osmanthus type associated sites obtained in step (5) and perform KASP-PCR amplification;

[0016] (7) Read the fluorescence signals of each associated site and convert them into base genotypes, perform sample SNP or InDel genotyping according to the principles of clear genotyping and no specific amplification in negative control samples, and visualize the genotyping results through SNPviewer TM software; finally determine that the KASP marker described in claim 1 can be used for early identification of the chrysanthemum receptacle osmanthus type.

[0017] Furthermore, the female parent described in step (1) is 'Nannong Xuefeng' and the male parent is 'Mengbai'.

[0018] Furthermore, the number of plant lines used to construct each extreme pool in step (2) is 10% - 20% of the population size; all DNA of the anemone-flowered offspring or all non-anemone-flowered offspring in the development population are mixed at equal concentrations to construct the anemone-flowered pool (BA) and the non-anemone-flowered pool (BS) respectively.

[0019] Furthermore, the specific steps of step (3) include: removing adapters and low-quality sequences from the original sequencing data of the two parents, the anemone-flowered pool BA and the non-anemone-flowered pool BS to obtain high-quality sequences, using the BWA software to align the high-quality sequences to the chrysanthemum reference genome, and after removing duplicate sequences from the alignment results using the SAMtools software, using the SAMtools software and the HaplotypeCaller module of the GATK software to perform SNP and InDel variant detection for multiple samples respectively, filtering out low-quality variants, and selecting the sites jointly detected by the two software for the next analysis.

[0020] Furthermore, the chrysanthemum reference genome described in step (3) is the genome of the cultivated chrysanthemum variety 'Zhongshan Zigui'.

[0021] Furthermore, the quality filtering criteria for the SNP and InDel variant sites are "QD < 2.0 || FS > 60.0 || MQ < 40.0" and "QD < 2.0 || FS > 200.0 || MQ < 40.0" respectively.

[0022] Furthermore, step (4) also includes a filtering process for variant sites, with the specific requirements as follows: 1) When the phenotypes of the two parents are the same, remove the sites where the two parents are homozygous and inconsistent, that is, the segregation form conforms to aa×bb; 2) When the phenotypes of the two parents are different, remove the sites where the two parents are homozygous and consistent; 3) There are no missing genotypes in the parental and offspring mixed pools; 4) The sequencing depth of the four samples should be greater than 10× and less than 500×, and the genotype quality value GQ should not be less than 30; 5) The SNP-index of at least one offspring pool is greater than 0.3; 6) The SNP-index of at least one offspring pool is less than 0.7.

[0023] Furthermore, the screening criteria for step (5) are as follows: 1) Among the 200bp sequences upstream and downstream, except for the target SNP or InDel site, the number of other variant sites does not exceed 3; 2) The number of similar sequences of this fragment in the chrysanthemum genome does not exceed 3, that is, when performing blast alignment analysis, the fewer the number of sequences obtained when simultaneously meeting the sequence alignment identity percentage identity>95% and coverage>80% is better; 3) The GC content of the sequence should not be higher than 65%.

[0024] Furthermore, the primer set described in step (6) includes 2 allele-specific forward primers and 1 reverse universal primer. FAM fluorescent adapters and VIC fluorescent adapters are added to the 5' ends of the 2 forward specific primers respectively, and the 3' ends are the allelic variant bases of the SNP or InDel site.

[0025] Furthermore, the reaction system of the KASP-PCR reaction in step (6) is 2×KASP Mastermix 0.8μL, Primer Mix 0.024μL (concentration of forward primer F1 is 12μM, concentration of forward primer F2 is 12μM, concentration of reverse universal primer is 30μM), ddH 2 O 0.776μL.

[0026] Furthermore, the KASP-PCR reaction in step (6) is amplified by the Touchdown method, and the amplification program is pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing and extension at 55-65°C for 60 s, and the annealing and extension temperature is reduced by 1.0°C for each cycle, for a total of 10 cycles; denaturation at 95°C for 20 s, annealing and extension at 55°C for 60 s, for 20 cycles.

[0027] The present invention also provides an application of the above KASP marker in the early identification of the chrysanthemum tuoguihua type. If the detected genotype is G:G, it is the tuoguihua type; if the detected genotype is A:A, it is the non-tuoguihua type; if the detected genotype is heterozygous A:G, it is probably the tuoguihua type, and it is further confirmed by combining the field phenotype.

[0028] The present invention also provides a method for early identification of the anemone-flowered type of chrysanthemum, comprising the following steps: extracting the DNA of a sample to be tested at the seedling stage, performing KASP-PCR amplification and genotyping on the above-mentioned KASP markers. If the detected genotype is G:G, it is the anemone-flowered type; if the detected genotype is A:A, it is the non-anemone-flowered type; if the detected genotype is the heterozygous A:G, it is probably the anemone-flowered type, and it can be further confirmed in combination with the field phenotype.

[0029] Furthermore, the amplification primers of the above-mentioned KASP markers include two competitive forward primers with nucleotide sequences shown in SEQ ID NO.1 to 2 and a reverse universal primer shown in SEQ ID NO.3.

[0030] Beneficial effects: Compared with the prior art, the present invention has the following prominent and significant advantages: The present invention quickly identifies the anemone-flowered type associated loci of chrysanthemum by BSA-seq based on whole-genome resequencing, and converts the SNP and InDel associated loci into KASP markers. Compared with traditional PCR- and electrophoresis-based molecular markers, KASP markers have obvious advantages such as high conversion success rate, accurate genotyping, low development cost, strong flexibility, and easy automation. The developed KASP-Chr6__179207697-G / A has an identification accuracy rate of 76-85%, and can complete the screening of the anemone-flowered type of a large number of materials in a relatively short time, avoiding the cumbersome field flower phenotype observation during the flowering period, reducing the influence of the environment on phenotype identification, and thus greatly shortening the breeding cycle. The present invention lays an important foundation for realizing the early large-scale, high-throughput, and automated detection and screening of the anemone-flowered type of chrysanthemum, and has important theoretical and practical significance for the MAS breeding of chrysanthemum flower types. Description of the Drawings

[0031] Figure 1 Flower traits of chrysanthemum cultivars 'Nannong Xuefeng' (XF) and 'Mengbai' (MB) and 28 anemone-flowered F 1 plant lines (a) of the anemone-flowered pool BA and 20 anemone-flowered F 1 plant lines (b) of the non-anemone-flowered pool BS; the scale bar is 1 cm.

[0032] Figure 2 BSA-seq mapping results of the anemone-flowered type of chrysanthemum based on two algorithms of Δ(SNP / InDel-index) (a) and Euclidean distance ED (b). Each point represents a SNP or InDel variant site. The red broken line is the mean value of |Δ(SNP / InDel-index)| and ED calculated by using a 500 kb window and a 50 kb step sliding window strategy for each window. 2 Mean value.

[0033] Figure 3Genotyping results of 56 ligulate-flowered and 38 non-ligulate-flowered materials using KASP markers KASP-Chr5__3560844-AGA / -(a), KASP-Chr5__120149012-G / A(b), KASP-Chr6__33961007-T / A(c) and KASP-Chr6__179207697-G / A(d). Detailed implementation manners

[0034] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0035] Example 1 Obtaining of ligulate-flowered associated loci in chrysanthemum

[0036] (1) Population construction and flower type phenotype observation

[0037] Using the ligulate-flowered chrysanthemum cultivar 'Nannong Xuefeng' (XF) as the female parent and 'Monalisa' (MB) as the male parent for hybridization to obtain an F 1 population (n = 167). All materials are stored in the "China National Chrysanthemum Germplasm Resource Conservation Center" at Nanjing Agricultural University, and those skilled in the art can obtain the above germplasms from the "China National Chrysanthemum Germplasm Resource Conservation Center". Record the flower types of each F 1 progeny during the autumn flowering period, and it is found that the segregation ratio of ligulate-flowered to non-ligulate-flowered in this population is 3:1, indicating that the ligulate-flowered type in chrysanthemum is controlled by a dominant gene.

[0038] (2) Construction of extreme pools and high-throughput sequencing

[0039] In the autumn of 2021, select 28 typical ligulate-flowered lines and 20 non-ligulate-flowered lines from the F 1 population of 'Nannong Xuefeng' × 'Monalisa'( Figure 1 ; Table 1), collect 3-4 ligulate flower petals of each of the above lines and two parental materials in centrifuge tubes, freeze and grind them in liquid nitrogen, and extract DNA using the CTAB method. Use a ONE Drop TM OD-1000 nucleic acid analyzer to detect the concentration and purity of DNA, and detect the integrity by 1% agarose gel electrophoresis. Mix the DNA of the 28 ligulate-flowered progeny and the DNA of the 20 non-ligulate-flowered progeny at equal concentrations, respectively construct a ligulate-flowered pool (BA) and a non-ligulate-flowered pool (BS), and send the two parental DNA samples together with the two pools to Beijing Novogene Bioinformatics Technology Co., Ltd. for library construction, and use the IIIumina NovaSeq6000 platform for whole-genome resequencing. In addition, select another 26 ligulate-flowered lines and 18 non-ligulate-flowered lines from this population for verification of KASP markers (Table 1).

[0040] Table 1 Numbers and flower type information of 94 tested materials

[0041]

[0042] Note: A and S are the single-petal and non-single-petal progeny lines used to verify the KASP markers, respectively.

[0043] (3) Sequence alignment and variant detection

[0044] After removing adapters and low-quality sequences from the original sequencing data, the obtained effective sequencing data are shown in Table 2. The high-quality sequences were aligned to the reference genome of the cultivated chrysanthemum cultivar 'Zhongshan Zigui' (https: / / doi.org / 10.6084 / m9.figshare.21655364.v2) using the BWA software (parameters: mem -t 4 -k 32 -M). The alignment rates of the four samples XF, MB, BA, and BS were 99.29%, 99.20%, 99.17%, and 99.15% respectively, the percentage of 1× coverage was above 89.25%, and the average depth of pooled sequencing was 20.97×, indicating sufficient sample data volume and normal sequencing. After removing duplicate sequences using the SAMtools software from the alignment results, the SAMtools software and the HaplotypeCaller module of the GATK software were used to detect SNP and InDel variants in multiple samples respectively. The original SNP and InDel sites detected by the GATK software were filtered to remove low-quality variants according to the filtering criteria of "QD < 2.0 || FS > 60.0 || MQ < 40.0" and "QD < 2.0 || FS > 200.0 || MQ < 40.0" respectively. Then, the reliable sites jointly detected by the two software were selected for the next analysis.

[0045] Table 2 Statistics of BSA-seq sequencing data

[0046]

[0047] (4) Marker screening

[0048] Before performing BSA-seq analysis, to minimize background noise as much as possible, SNP / Indel site filtering was carried out according to the following criteria: 1) When the phenotypes of the two parents are consistent, the sites where the two parents are homozygous and inconsistent are removed, that is, the segregation pattern conforms to aa×bb; 2) When the phenotypes of the two parents are inconsistent, the sites where the two parents are homozygous and consistent are removed; 3) There are no genotype deletions in the parental and offspring pooled samples; 4) The sequencing depth of the four samples should be greater than 10× and less than 500×, and the genotype quality value GQ is not less than 30; 5) The SNP-index of at least one offspring pool is greater than 0.3; 6) The SNP-index of at least one offspring pool is less than 0.7. Since both 'Nannong Xuefeng' and 'Mengbai' are tuoguihua type in this example, after removing the sites where the two parents are homozygous and inconsistent and then filtering according to the other above criteria, 15,783,313 SNPs and 1,546,200 InDels obtained were used for subsequent BSA-seq analysis.

[0049] (5)BSA-seq analysis

[0050] Two methods, Δ(SNP / InDel-index) and Euclidean distance ED, were used to determine significantly associated sites. Calculate the proportion of the number of reads of the mutant sites among all reads at these sites for the SNPs and InDels that meet the above conditions in the two pooled samples, that is, the SNP-index value. Calculate the absolute value of the difference in SNP frequencies between the two pooled samples according to the formula |Δ(SNP / InDel-index)| = |SNP-index(BA) - SNP-index(BS)|. Estimate the square root of the sum of the squared differences in the depths of the four bases at the SNPs and InDels sites between the two pooled samples according to the Euclidean distance ED calculation formula.

[0051]

[0052] Where A mut is the frequency of base A in the mutant pooled sample, A wt is the frequency of base A in the wild-type pooled sample; C mut is the frequency of base C in the mutant pooled sample, C wt is the frequency of base C in the wild-type pooled sample; G mut is the frequency of base G in the mutant pooled sample, G wt is the frequency of base G in the wild-type pooled sample; T mut is the frequency of base T in the mutant pooled sample, T wt is the frequency of base T in the wild-type pooled sample. To reduce background noise, the square of the ED value was used as the association value of each site with the trait in the Euclidean distance analysis. |Δ(SNP / InDel-index)| and ED 2The larger the value, the more associated the site is with the target trait. The analysis results of the two algorithms were compared to obtain the final chrysanthemum osmanthus type associated site. Figure 2 As shown, the loci controlling the traits of Chrysanthemum chrysantha are mainly located in the homologous chromosome groups Chr4-Chr5-Chr6.

[0053] Example 2 Development of KASP markers for osmanthus-type chrysanthemum receptacle and its breeding application

[0054] (1) Screening of associated sites suitable for developing KASP markers

[0055] Select |Δ(SNP / InDel-index)| and ED on chromosomes Chr4, Chr5 and Chr6 2 The largest 35 variable sites were extracted using the "bedtools getfasta" program to extract the 200bp flanking sequence of each site. The following criteria were met for the development of KASP markers: 1) In addition to the target SNP or InDel site, the number of other variable sites in the upstream and downstream 200bp sequences did not exceed 3; 2) The number of similar sequences in the chrysanthemum genome did not exceed 3, that is, the fewer the number of sequences obtained when the sequence alignment consistency percentage identity>95% and coverage>80% were satisfied during blast analysis, the better; 3) The GC content of the sequence should not be higher than 65%. Finally, 11 SNP sites and 1 InDel site were screened for KASP marker development (Table 3).

[0056] Table 3 Information on 12 SNP / InDel variant sites used to develop KASP markers

[0057]

[0058] (2) Primer design and KASP-PCR amplification

[0059] For the above 12 sequences, KASP marker primers were designed using Primer Primer 5.0 software. Each marker contained two allele-specific forward primers and one reverse universal primer Com-R. FAM fluorescent linkers (GAAGGTGACCAAGTTCATGCT) and VIC fluorescent linkers (GAAGGTCGGAGTCAACGGATT) were added to the 5' ends of the two forward specific primers, and the 3' ends were SNP or InDel site allele variant bases. The primers were synthesized by Beijing Zhongyujin Biotechnology Co., Ltd. (http: / / www.cgmb.com.cn). The primer sequences are shown in Table 4.

[0060] Table 4 Primer information of 12 KASP markers

[0061]

[0062]

[0063]

[0064] Note: The underlined part is the FAM fluorescence sequence tag; the double underlined part is the VIC fluorescence sequence tag.

[0065] The naming principle of KASP markers is: KASP + mutation site position + genotyping result. For example, KASP-Chr4__178343862-T / C indicates that the detection site is the SNP mutation site Chr4__178343862 located on chromosome 4, and the wild and mutant genotypes of this site are T and C respectively; KASP-Chr5__3560844-AGA / - indicates that the detection site is the InDel mutation site Chr5__3560844 located on chromosome 5, and the wild and mutant genotypes of this site are AGA and - respectively.

[0066] Dilute the DNA samples of two parents and 92 extreme lines (development population and validation population) to 100 ng·μL –1 . The KASP-PCR reaction was carried out on the Douglas Array Tape genotyping platform. Add 1.6 μL of the dissolved DNA sample to the bottom of a 96-well PCR reaction plate and dry it. The reaction system is 1.6 μL: 2×KASP Mastermix 0.8 μL, Primer Mix 0.024 μL (forward primer F1 concentration 12 μM, forward primer F2 concentration 12 μM, reverse universal primer concentration 30 μM), ddH 2 O 0.776 μL. At least one negative control without DNA template (NTC) was set.

[0067] The Touchdown method was used for PCR amplification: pre-denaturation at 94 °C for 15 min; denaturation at 94 °C for 20 s, annealing and extension at 55 - 65 °C for 60 s, and the annealing and extension temperature was reduced by 1.0 °C for each cycle, with a total of 10 cycles; denaturation at 95 °C for 20 s, annealing and extension at 55 °C for 60 s, for 20 cycles.

[0068] (3) KASP genotyping and accuracy calculation

[0069] After the KASP-PCR reaction, use the ARAYA fluorescence scanner to read the fluorescence signal and convert it into a base genotype. According to the principle of clear genotyping and no specific amplification of NTC (negative control without sample), perform SNP or InDel genotyping of the samples, and visualize the genotyping results through the SNPviewer TM software.

[0070] Furthermore, for the 4 KASP markers with clear genotyping and consistent parental genotyping results and variant detection results, the accuracy rates were calculated in the development population and the validation population respectively ( Figure 3 ; Table 5).

[0071] For the marker KASP-Chr5__3560844-AGA / -, if the detected locus is -:AGA, it is the tuoguihua type, and if it is AGA:AGA, it is the non-tuoguihua type. The average accuracy rates in the pooled population and the validation population were 54.17% and 43.31% respectively.

[0072] For the marker KASP-Chr5__120149012-G / A, if the detected locus is G:G, it is the tuoguihua type, and if it is A:A, it is the non-tuoguihua type. The average accuracy rates in the pooled population and the validation population were 65.91% and 60.76% respectively.

[0073] For the marker KASP-Chr6__33961007-T / A, if the detected locus is A:A or A:T, it is the tuoguihua type, and if it is T:T, it is the non-tuoguihua type. The average accuracy rates in the pooled population and the validation population were 78.10% and 75.56% respectively.

[0074] For the marker KASP-Chr6__179207697-G / A, if the detected locus is A:G or G:G, it is the tuoguihua type, and if it is A:A, it is the non-tuoguihua type. The average accuracy rates in the pooled population and the validation population were 73.73% and 77.51% respectively.

[0075] In summary, among the four KASP markers, the genotyping clustering of KASP-Chr6__179207697-G / A is the clearest ( Figure 3 ), and the proportion of heterozygous sites is low. Without considering heterozygous sites, 95.00% of the individuals carrying the G:G genotype in the pooled population are of the tuoguihua type, and 83.33% of the individuals carrying the A:A genotype are of the non-tuoguihua type; in the validation population, 100.00% of the individuals carrying the G:G genotype are of the tuoguihua type, and 61.11% of the individuals carrying the A:A genotype are of the non-tuoguihua type. That is, the average accuracy rates of KASP-Chr6__179207697-G / A in the two populations can reach 89.17% and 80.56%. Therefore, KASP-Chr6__179207697-G / A can be applied to molecular marker-assisted breeding of chrysanthemum tuoguihua type with high efficiency and low cost.

[0076] Table 5 Identification accuracy of tuoguihua type of 4 KASP markers in the pooled population and the validation population

[0077]

[0078] Note: A and S are the numbers of anemoneform and non-anemoneform individuals, respectively.

[0079] (4) Application of KASP-Chr6__179207697-G / A in the early high-throughput identification of anemoneform flower type

[0080] Extract the DNA of the sample to be tested at the seedling stage and dilute it to 100 ng·μL –1 , and perform KASP-PCR amplification and genotyping with reference to steps (2) and (3). The sequences of the two competitive forward primers are GAAGGTGACCAAGTTCATGCT GCGGTAACCGAATAGCTCGG (the underlined part is the FAM fluorescence sequence) and GAAGGTCGGAGTCAACGGATT TTGCGGTAACCGAATAGCTCGA (the double-underlined part is the VIC fluorescence sequence). The sequence of the reverse universal primer is TTCAGAATCATGTTCAAAATCCGGAGCAT. If the detected genotype is G:G, it is an anemoneform flower type; if the detected genotype is A:A, it is a non-anemoneform flower type; if the detected genotype is the heterozygous A:G, it is probably an anemoneform flower type, and it can be further confirmed by combining the field phenotype.

Claims

1. Application of KASP marker in early identification of receptacle osmanthus type in chrysanthemum, characterized in that, the KASP marker is the SNP locus at position 179207697 on chrysanthemum chromosome 6. If the detected genotype is G:G, it is the receptacle osmanthus type; if the detected genotype is A:A, it is the non-receptacle osmanthus type; if the detected genotype is heterozygous A:G, it is probably the receptacle osmanthus type, and further confirmation is made by combining with the field phenotype; the sequence of 200bp flanking the SNP locus is: ATATGATTCTGAACATCCTCATTTTCATCTCATGAAAACTTAATAAATTGGTAAAATAAACTTCCCAACGAAAAATTCTTGCGGTAACCGAATAGCTCG[G / A]GATGCTCCGGATTTTGAACATGATTCTGAACAGCTCGTGTAACTCTCGAAATAAATTGGTCCGGAATAGAGTGTTTTTCCATACTAGAATCCTGTGTGAA.

2. A method for early identification of receptacle osmanthus type in chrysanthemum, characterized in that, it includes the following steps: Extract the DNA of the sample to be tested at the seedling stage, perform KASP-PCR amplification and genotyping on the KASP marker. The KASP marker is the SNP locus at position 179207697 on chrysanthemum chromosome 6. If the detected genotype is G:G, it is the receptacle osmanthus type; if the detected genotype is A:A, it is the non-receptacle osmanthus type; if the detected genotype is heterozygous A:G, it is probably the receptacle osmanthus type, and further confirmation can be made by combining with the field phenotype; the sequence of 200bp flanking the SNP locus is: ATATGATTCTGAACATCCTCATTTTCATCTCATGAAAACTTAATAAATTGGTAAAATAAACTTCCCAACGAAAAATTCTTGCGGTAACCGAATAGCTCG[G / A]GATGCTCCGGATTTTGAACATGATTCTGAACAGCTCGTGTAACTCTCGAAATAAATTGGTCCGGAATAGAGTGTTTTTCCATACTAGAATCCTGTGTGAA.

3. The method for early identification of receptacle osmanthus type in chrysanthemum according to claim 2, characterized in that, the amplification primers of the KASP marker include two competitive forward primers with nucleotide sequences shown in SEQ ID NO.1~2 and a reverse universal primer shown in SEQ ID NO.3.

Images