A genus of gomphidius fungi and application thereof
By isolating and identifying the BJ1 fungus from the roots of Bletilla striata, and using the seed re-inoculation method to co-germinate with Bletilla striata seeds, the problems of low seed germination rate and poor seedling adaptability of Bletilla striata seeds were solved, and efficient propagation and growth of Bletilla striata seedlings were achieved.
Patent Information
- Application Number
- CN202311079460.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-08-24
- Publication Date
- 2026-03-17
- Estimated Expiration
- 2043-08-24
AI Technical Summary
Bletilla striata seeds have a low germination rate, making natural propagation difficult. Artificial seedlings are difficult to adapt to the natural environment after transplanting, resulting in a high mortality rate. Existing technologies are insufficient to effectively promote the germination of Bletilla striata seeds and the growth of seedlings.
A novel fungus, BJ1, was isolated and identified from the roots of Bletilla striata. By using a seed re-inoculation method, it was found to promote the germination of Bletilla striata seeds and the growth of seedlings.
It significantly improved the seed germination rate and seedling growth rate of Bletilla striata, enhanced the environmental adaptability of seedlings, and promoted the industrialization and resource protection of Bletilla striata.
Smart Images

Figure CN117305119B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of microbial technology, and particularly relates to a fungus of the genus Tulasnella and application thereof. BACKGROUND
[0002] Bletilla striata (Thunb.) Reichb. f. is also called Baiji, Baijizi, which is a perennial herb of Orchidaceae and Bletilla. It is mainly distributed in Hubei, Hunan, Guizhou, Yunnan and coastal areas of China. As a traditional Chinese medicine, Bletilla striata is used for treating external hemorrhage, hemoptysis, skin chapping, swelling and ulcer, etc. with the dried tubers as the medicine and the effects of astringency, hemostasis, swelling and tissue regeneration. The seed germination rate of Bletilla striata in the natural state is low, and the natural reproduction is difficult. The main reproduction method is tuber reproduction, which not only has low reproduction rate, but also leads to disease degradation of varieties. At the same time, due to the overexploitation of people, the wild resources of Bletilla striata are close to exhaustion. At present, the resources of Bletilla striata are mainly satisfied by artificial reproduction technology to meet the actual production needs. Artificial breeding technology includes seed direct sowing technology by optimizing sexual reproduction, symbiotic germination technology by using fungi reproduction, tissue culture by asexual reproduction, artificial seed technology, etc. These technologies can realize the rapid propagation of Bletilla striata germplasm resources, can overcome the shortcomings of natural sexual reproduction of Bletilla striata, and are the best way to protect the wild resources of Bletilla striata, expand the production of Bletilla striata and meet the market demand. At present, people can quickly and massively reproduce Bletilla striata aseptic seedlings through artificial tissue culture technology, but the seedlings are difficult to adapt to the growth in the natural environment after being transplanted in the wild, and cannot establish good relationship with soil microorganisms, resulting in high seedling mortality. The symbiotic germination technology can improve the seed germination rate, the growth rate of seedlings and the environmental adaptability of seedlings after returning to the natural habitat. Therefore, obtaining effective symbiotic fungi for seed germination is the first step for the protection of rare and endangered orchid plants. Using seed ex-situ symbiotic germination technology to induce seed germination into protocorm and isolating symbiotic fungi in protocorm is the most efficient method to obtain effective strains for promoting seed germination.
[0003] Tulasnella sp. is the first symbiotic mycorrhizal fungi proved to be associated with orchid plants, belonging to Basidiomycota and Tulasnella sp. In temperate, tropical and subtropical orchid varieties, Tulasnella sp. is the most common mycorrhizal fungi. In 2012, Martos et al. investigated the mycorrhizal fungi of 77 orchid species on La Reunion Island (Indian Ocean) and found that Tulasnella sp. could be associated with 88% of orchids (Martos, 2012). Tulasnella sp. has a wide distribution and has been found in almost every ecosystem from tropical to temperate regions around the world. Many documents and patents have reported that Tulasnella sp. can promote the growth and germination of orchid seeds. Chinese patent document CN108048334A discloses a Tulasnella sp. with the accession number CGMCC No.14794, which can promote the germination of Pholidota imbricata and Cattleya seed. Chinese patent document CN105815002A discloses a Tulasnella sp. with the accession number CGMCC No.9551, which can promote the germination of Dendrobium loddigesii seed. Therefore, Tulasnella sp. is of great importance to the growth and development of orchid seeds.
[0004] To explore the mutualistic symbiotic relationship between mycorrhizal fungi and host plants, multiple strains of mycorrhizal fungi were isolated from the roots of medicinal plant Bletilla striata, and seed back inoculation technology was used to conduct experiments on Bletilla striata seed germination and protocorm growth. Finally, effective symbiotic fungi that can promote Bletilla striata seed germination to seedlings were screened out, which can provide necessary conditions for efficient production of mycorrhizal seedlings and lay a foundation for Bletilla striata seedling cultivation. Chinese patent document CN111100797A discloses a Sebacinasp. strain with the accession number CGMCC NO.15690, which can promote Bletilla striata seed germination to form seedlings. Guo Shunxing et al. found that four kinds of fungi such as Osmunda japonica can promote Bletilla striata seed germination and seedling growth. Xu Lingling et al. used four kinds of endophytic fungi to explore Bletilla striata seed germination and seedling growth and found that there were great differences in the symbiotic germination of different endophytic fungi and Bletilla striata. In summary, it is necessary to screen dominant strains to promote Bletilla striata seed germination and seedling growth and development, and to develop Bletilla striata industry. SUMMARY
[0005] The mycorrhizal fungus isolated and purified from the rhizosphere of Bletilla striata. by the fungus separation and purification technology is identified as a Tulasnella sp. fungus, named BJ1. The sequence of the Tulasnella sp. fungus collected from the reported literature and patents is subjected to molecular biology identification and species level comparison, which has low similarity with the reported Tulasnella sp. fungus at the species level, and is identified as a new species, which has not been reported yet. Seed germination experiment shows that the BJ1 strain has strong ability to promote seed germination and growth. Therefore, the BJ1 strain is used to promote seed germination of Bletilla striata, expand Bletilla striata cultivation, and improve the quality and yield of Bletilla striata medicinal materials, which has important practical significance and application value.
[0006] In one aspect, the application provides a Tulasnella sp. fungus, which is Tulasnella sp. fungus BJ1, and the preservation number is CGMCC No. 40773.
[0007] The collected Bletilla striata roots are subjected to surface sterilization in an ultraclean bench, and a small amount of sterile water is added in a culture dish. After the roots are placed in the sterile water and scraped with a scalpel, the mycorrhizal fungal mycelium in the roots is released into the sterile water. Under a dissection microscope, a single mycelium is sucked by a pipette gun and placed on a PDA culture medium for culture. When the mycelium grows, it is transferred to Bletilla striata seeds for symbiotic germination. The seed back transfer method is used to extract the mycorrhizal fungus for seed germination and growth of Bletilla striata again, and the fungus is transferred and cultured again and purified, so that a pure culture colony is finally obtained.
[0008] The Tulasnella sp. fungus (BJ1) has the following biological characteristics: the colony surface is white and sparse leather or film-like, grows in a divergent circular manner, and is closely attached to the culture medium. After 7 days of culture, the average growth rate is 0.11-0.13 mm·h -1 Under 400 times microscopic observation, part of the mycelium top can produce spherical sporangium groups, and the mycelium front part grows in a beaded manner. The scanning electron microscope results show that the strain contains oval pearl-shaped spores, and the branches are mostly at right angles or acute angles, and multiple mycelia are often found to be intertwined.
[0009] In another aspect, the application also provides the application of the Tulasnella sp. fungus in promoting seed germination or protocorm growth of Bletilla striata.
[0010] In another aspect, the application also provides the application of the Tulasnella sp. fungus in preparing a material for promoting seed germination or protocorm growth of Bletilla striata.
[0011] In another aspect, the application also provides a material for promoting seed germination or protocorm growth of Bletilla striata, wherein the active ingredient comprises the Tulasnella sp. fungus.
[0012] In another aspect, the present application also provides a method for preparing the material for promoting the germination of the Bletilla striata seeds or the growth of the protocorms, wherein the culture dish containing the mycelium of the Tulasnella sp. fungus is obtained after the Tulasnella sp. fungus is inoculated into an activated culture medium and cultured.
[0013] In another aspect, the present application also provides a method for promoting the germination of the Bletilla striata seeds or the growth of the protocorms, wherein the Tulasnella sp. fungus or the material is used for co-culturing with the Bletilla striata seeds.
[0014] The co-culturing condition is that the co-culturing is carried out at 25℃ under light for 2-4 weeks.
[0015] The present application isolates a mycorrhizal fungus BJ1 from the roots of the Bletilla striata, and the fungus is identified as a Tulasnella sp. fungus by morphological and molecular biological identification. The fungus can not only significantly promote the germination of the Bletilla striata seeds, but also has a certain positive effect on the growth of the subsequent seedlings of the Bletilla striata seeds. BRIEF DESCRIPTION OF DRAWINGS
[0016] Figure 1 Fig. 1 is the colony and fiber structure characteristics of the Tulasnella sp. fungus BJ1; wherein, Fig. 1A is the colony morphology of the BJ1 cultured for 8 days (scale bar = 1 cm); Fig. 1B is the mycelium and basidiospore morphology under a microscope, scale bar = 100 μm (10×40); Fig. 1C is the mycelium and spore morphology under a scanning electron microscope, scale bar = 50 μm; Fig. 1D is the mycelium interweaving and branching at right angles under a scanning electron microscope, scale bar = 50 μm.
[0017] Figure 2 Fig. 2 is the phylogenetic tree of the Tulasnella sp. fungus based on the ITS sequence analysis results.
[0018] Figure 3 Fig. 3 is the phylogenetic tree constructed by using four serial gene sequences ITS, C14436, C3304 and C4102.
[0019] Figure 4Figure 1. A, B. and C. A and B. The growth form of B.striata with and without symbiotic fungi. A. The growth form of B.striata with symbiotic and non-symbiotic protocorms. Scale bar = 500 pm. B. The length and width of symbiotic and non-symbiotic protocorms. Solid circles and triangles represent the length (L) and width (W) of the symbiotic group, respectively. Rectangles and inverted triangles represent the length (L) and width (W) of the non-symbiotic group, respectively. The t-test was used to compare the two groups, and * and ** indicate P < 0.05 and P < 0.01, respectively, indicating statistically significant differences. C. The weight of symbiotic and non-symbiotic B.striata protocorms. Error bars represent the standard error of the mean of 15 protocorms. The independent sample t-test was used to determine statistically significant differences in seed weight: * and ** indicate P < 0.05 and P < 0.01, respectively. DETAILED DESCRIPTION
[0020] Example 1: Isolation, culture and identification of B.striata mycorrhizal fungus Tuberaceae fungus BJ1
[0021] The B.striata used in the present application was collected in Qingyuan County, Lishui City, Zhejiang Province, China in June 2019.
[0022] (1) The roots and tubers of the non-wound and non-diseased B.striata were cut into three sections and then sliced, and the samples with mycelium colonization were selected and preserved for subsequent mycorrhizal fungus isolation.
[0023] (2) The roots with mycelium colonization determined by microscopy were surface sterilized in a clean bench, following the steps: soaking in 75% alcohol and then transferring to 1% NaClO (10% available chlorine) for 4 min, washing with sterile water multiple times, transferring to a sterile petri dish, scraping the epidermis with a sterile scalpel, rinsing with sterile water, and cutting the roots and tubers into thin slices for inoculation on PDA medium containing antibiotics (50 mg / L Ampicillin and Streptomycin sulfate), sealing and inverting, culturing in a 25°C constant temperature incubator, and observing every 2 days. When the mycelium grows, it is separated and purified using an inoculation needle.
[0024] (3) The obtained part of the mycorrhizal fungus was cultured in PDA liquid medium, and after 5-7 days of growth, the mycorrhizal fermentation broth was obtained and sprayed on the substrate soil containing substances conducive to the growth and germination of B.striata seeds, and finally B.striata seeds were scattered, and whether the effect of promoting the germination of B.striata seeds was observed. The effective B.striata protocorms were re-isolated and purified using the method of endophytic fungus isolation, and the mycorrhizal fungus BJ1 with high efficiency in promoting the growth and germination of B.striata seeds was obtained.
[0025] The strains are observed by naked eye, 400 times microscope and scanning electron microscope respectively. The strains are cultured in a culture box at 25±2℃ for 7-10 days, and then observed by naked eye. The colony surface is white and sparse leather or film-like, and grows in divergent circular shape and adheres to the culture medium. After 7 days of culture, the average growth speed is 0.11-0.13mm·h -1 The mycelium is picked up by forceps to make a temporary sample for observation and measurement under a microscope. The top of part of the mycelium can produce spherical sporodochia. The front part of the mycelium grows in a beaded manner. The scanning electron microscope results show that the strain contains oval-shaped and beaded spores. The branches are mostly at right angles or acute angles. It is often found that multiple mycelia are intertwined (the morphological diagram of the mycorrhizal fungus on PDA flat plate culture medium is shown in Figure 1 A, the morphological diagram of the mycelium and sporodochium under a microscope is shown in Figure 1 B, the morphological diagram of the mycelium and spores under a scanning electron microscope, the intertwining of the mycelium and the branches at right angles are shown in Figure 1 C and D). It is preliminarily judged that the strain is a mycorrhizal fungus of Tulasnella sp.
[0026] The PDA culture medium formula in the application is that the potato is 200g, the glucose is 20g, and the deionized water is 1000mL.
[0027] (4) Molecular identification: the obtained strain BJ1 is extracted by CTAB method to perform ITS sequencing.
[0028] 1) Extraction of total DNA:
[0029] 1. First, the fungal mycelium on the culture medium is scraped by a knife in a 65℃ water bath, and the sample is gently scraped to avoid scraping the culture medium and placed in a sterile mortar. The sample is ground into powder by liquid nitrogen for several times, and then placed in a 1.5ml sterile tube.
[0030] 2. 700ul of 2% CTAB extraction buffer is added, and the sample is gently shaken.
[0031] 3. The sample is placed in a 65℃ water bath, and shaken gently every 10 minutes. After 40 minutes, the sample is taken out.
[0032] 4. After cooling for 2 minutes, 700ul of chloroform-isoamyl alcohol (24:1) is added, and shaken for 2-3 minutes.
[0033] 5. 12000rmp 4℃ centrifugation for 10min (steps 4 and 5 can be repeated twice)
[0034] 6. After centrifuging at 12000 rpm at 4℃ for 10 min, gently aspirate the supernatant with a pipette and transfer it into a centrifuge tube containing 600 μL of isopropanol (pre-cooled at -20℃). Gently shake the centrifuge tube up and down for 30 seconds to fully mix the isopropanol with the water layer until DNA flocculent matter is visible. Precipitate the DNA at -20℃ for 20 minutes.
[0035] 7. After centrifuging at 12000 rpm at 4℃ for 10 minutes, immediately discard the liquid; do not pour out the white DNA.
[0036] 8. Add 600 μL of 70% ethanol (pre-cooled at -20℃) and invert the container.
[0037] 9. Centrifuge at 12000 rpm at 4℃ for 30 seconds, then immediately discard the liquid. Allow the DNA to air dry naturally or use a hairdryer to dry it. Add 30 μL ddH2O to dissolve the DNA and store it at -20℃ for later use.
[0038] 2) PCR amplification
[0039] Amplification primers:
[0040] ITS1-F: 5′-TCCGTAGGTGAACCTGCGG-3′;
[0041] ITS4-R: 5′-TCCTCCGCTTATTGATATGC-3′;
[0042] PCR amplification of the rDNA-ITS region reaction system (50.0 μL): total DNA of the strain 2.0 μL, primer ITS1-F 2.0 μL, primer ITS4-R 2.0 μL, ddH2O 19 μL, Taq polymerase 25 μL.
[0043] PCR amplification of the rDNA-ITS region reaction program: pre-denaturation, 94℃ for 3 min; amplification cycles (34 cycles): 94℃ for 30 s, annealing, 50℃ for 30 s, extension, 72℃ for 90 s, extension; 72℃ for 8 min; storage, 4℃.
[0044] According to Arild R. Arifin et al. (2021) in the study of new species of Tulasnella associated with terrestrial orchids in Australia, the cluster analysis was carried out using the nuclear locus C4102 (gene sequence as shown in SEQ ID No. 10, encoding glutamate synthase), the mitochondrial locus C14436 (gene sequence as shown in SEQ ID No. 11, ATP synthase) and C3304 (gene sequence as shown in SEQ ID No. 12, ATP helicase) mentioned in Monica P. Ruibal et al. (2013) in the phylogeny of Tulasnella (Tulasnellaceae) and microsatellite markers associated with mycorrhizal fungi associated with Australian orchids. The sequences of each primer are as follows:
[0045] C4102-F: ATCAARTAYGCTGGCCTKCCTTGG;
[0046] C4102-R: CGRCCGCCWGTCATGTACTCGCA;
[0047] C14436-F: ATGGACGGTACYGADGGTCTYG;
[0048] C14436-R: CACGGAAGTAYTCNGCRATGG;
[0049] C3304-F: TTGAAGTCACCGGGAAGAAC;
[0050] C3304-R: CGGCGTTACGCTTSGTCT;
[0051] PCR amplification rDNA reaction system (50.0 μL): 2.0 μL of total DNA of the strain, 2.0 μL of upstream primer, 2.0 μL of downstream primer, 19 μL of ddH2O, 25 μL of Taq polymerase.
[0052] PCR amplification rDNA-ITS region reaction procedure: 94℃, 3min; amplification cycle (12 cycles): 94℃ 30s, 66℃ 40s (-3℃ / second cycle), 72℃ 1min; 94℃ 30s (30 cycles); 48℃ 40s; 72℃ 1min; 72℃, 20min; 11℃ preservation.
[0053] The qualified PCR product was sent to Shanghai Bioengineering Co., Ltd. for sequencing, and the ITS gene sequence of the Tulasnella mycorrhizal fungus of the application was as shown in SEQ ID No. 1, and was submitted to the NCBI (blast.ncbi.nlm.nih.gov / Blast.cgi) database for comparison, and the phylogenetic tree of the mycorrhizal fungus of the application constructed by the neighbor-joining method is shown in Figure 2 . The strain clusters in the same branch with Epulorhiza sp., and the coverage reaches 99%, and the similarity is 99.84%. The sequences of Tulasnella fungi reported in the literature and patents were collected, and further species level analysis was carried out using mitochondrial C14436, C3304 and C4102 as primers, and after sample sequencing, the four gene sequences were concatenated for phylogenetic tree analysis, and the strain has no mutual clustering strain Figure 3 ). Combined with the morphological characteristics of colonies, hyphae and spores, it is preliminarily judged that the strain is a new unreported Tulasnella mycorrhizal fungus.
[0054] The newly screened strain is named Tulasnella sp. fungus, and the strain number is BJ1, which was preserved in the China General Microbiological Culture Collection Center on July 19, 2023, with the preservation number of CGMCC No. 40773, and the address is No. 1, Yihuangyuan 3rd, Beichen West Road, Chaoyang District, Beijing, China, with the postcode of 100101. The nrDNA ITS sequence was submitted to the U.S. National Center for Biotechnology Information database (NCBI, http: / / www.ncbi.nlm.nih.gov / ), and the sequence number was OR245559.
[0055] Example 2: Promoting effect of Tulasnella mycorrhizal fungus (Tulasnella sp.) BJ1 strain on seed germination and seedling formation of white
[0056] 1) The test strain Tulasnella sp. BJ1 isolated in Example 1 stored in a test tube slant at 4°C was taken out and inoculated on PDA flat plate medium respectively, and placed in an artificial climate box at 25±2°C for culture. When the fungal hyphae grew fast and filled the culture dish (about 7 days), it was taken out as a symbiotic germination material.
[0057] 2) Preparation of symbiotic germination medium and inoculation: The medium used was agar (agar powder: water = 1:100) + PDA medium (PDA medium as the substrate, poured into agar after solidification). Pour the prepared PDA medium into a screw cap bottle, tighten the cap, sterilize (121°C, 20min) and reserve. Place a 6cm diameter 200 mesh sterile nylon mesh cloth on the agar + PDA medium surface of a 9cm culture dish, divide the prepared medium into two groups for processing, respectively, the blank control group without inoculation, and the strain group inoculated with BJ1, 10 plates in each group, then place in an artificial climate chamber at 25±2°C for culture, and wait for the bacteria to grow on the medium.
[0058] 3) Seed sterilization and symbiotic culture: Before the experiment, the seeds (mature fruits collected from Bletilla striata plants in the experimental base of Hangzhou Xiaoshan District (30.03507°N, 120.22744°E)) stored at 4°C were taken out and placed at room temperature for about 15 minutes to restore the seed temperature to room temperature. After sterilizing the surface of the Bletilla striata fruit (soaking in 3% sodium hypochlorite for 7min, soaking in 75% ethanol for 5min, and washing with sterile water for 3-4 times), the fruit pod was cut open with a sterile scalpel, and the seeds were scattered onto the agar + PDA medium that had been covered with the gelatinous fungus, and placed in a 25°C light culture condition. Every 7 days, 15 protocorms were randomly collected, photographed, and the length, width, and fresh weight of the Bletilla striata protocorms were measured and analyzed according to the quantitative evaluation method of Yamamoto T et al. (Yamamoto T, et al. (2017). Cfs lp, a Novel Membrane Protein in the PQ-Loop Family, Is Involved in Phospholipid Flippase Functions in Yeast. G3 (Bethesda), 7(1): 179-192.) for the growth of Bletilla striata protocorms.
[0059] 4) Detection: According to Yamamoto T's evaluation method for the growth of Bletilla striata protocorms: (a) a straight line (dotted line) is drawn from the base to the tip of the protocorm to measure the length (L), (b) a straight line (solid line) is drawn through the two ends of the swollen embryo, and (c) a straight line (dotted line) is drawn perpendicular to the solid line at the most swollen part to measure the width (W). Every 7 days is a sampling time point, and the length, width, and fresh weight of 15 protocorms are measured, with each experiment repeated 3 times. Microscopic observation is used to observe the growth differences between the parasitized and control groups of Bletilla striata seeds every week.
[0060] 5) The formation of seedlings in the final two treatment groups is shown in Figure 4 . The results show that Bletilla striata seeds can also grow normally under the above experimental conditions, but the growth is slower and weaker Figure 4A); while BJ1 strain had significant promotion effect on the germination of B. delavayi seeds. After 1 week of culture, B. delavayi seeds began to absorb water and swell, becoming round and full, but there was no significant difference between the symbiotic and non-symbiotic groups. After 2-4 weeks of culture, the difference between the symbiotic and non-symbiotic groups gradually increased. The symbiotic group showed an increasing growth with a larger growth rate, while the non-symbiotic group showed a stable growth with a lower growth rate Figure 4 B). For the data statistics of B. delavayi protocorm weight, there was also a significant difference between the symbiotic and non-symbiotic groups. After 1 week of culture, the weight of the symbiotic group was greater than that of the non-symbiotic group, but there was no significant difference. After 2-4 weeks of culture, the difference in weight between the symbiotic and non-symbiotic groups of B. delavayi seeds became larger Figure 4 C).
Claims
1. A fungus of the genus Gloeophyllum sp. characterized in that, Tulasnella The fungi of the genus *Colletotrichum* are *Colletotrichum* ( Tulasnella (sp.) Fungus BJ1, accession number CGMCC No.40773. 2. The use of a fungus of the genus Tulasnella as claimed in claim 1 for promoting the germination of seeds of the Japanese white birch or the growth of Japanese white birch protocorms.
3. The use of a fungus of the genus Tulasnella as claimed in claim 1 for the preparation of a material for promoting the germination of seeds of the Japanese white birch or the growth of Japanese white birch protocorms.
4. A material for promoting germination of a bud seed or growth of a bud protocorm of a white bark magnolia, characterized by, The active ingredient comprises a fungus of the genus Tulasnella as claimed in claim 1.
5. The method for preparing the material for promoting the germination of the seeds of the white birch or the growth of the protocorms of the white birch according to claim 4, characterized in that, The material for promoting the germination of seeds of the Japanese white birch or the growth of Japanese white birch protocorms is obtained by inoculating the fungus of the genus Tulasnella as claimed in claim 1 into an activated culture medium and culturing the fungus to obtain a Petri dish containing mycelium of the fungus of the genus Tulasnella.
6. The production method according to claim 5, wherein The culture temperature is 23-27°C and the culture time is 7 days.
7. A method of promoting germination of a bud seed or growth of a bud protocorm, characterized by, The fungus of the genus Tulasnella as claimed in claim 1 or the material as claimed in claim 4 is used for co-culturing with seeds of the Japanese white birch.
8. The method for promoting the germination of the seeds of the rhizome of the Japanese white birch or the growth of the protocorms of the rhizome of the Japanese white birch according to claim 7, characterized in that, The co-culturing conditions are 2-4 weeks of co-culturing at 25°C under light.
Citation Information
Patent Citations
Seedling growing method adopting Dendrobium devonianum seed and symbiotic fungus mixed sowing
CN105815002A
Method for screening tulasnella fungi and establishing symbiotic system for promoting seed germination of cymbidium mannii and cattleya hybrida
CN108048334A
Bacterial strain for promoting seed germination of Bletilla striata to form seedlings and application of bacterial strain
CN111100797A