Biofilm dispersion regulating gene spoIIIJ and its application
By constructing and knocking out the spoIIIJ gene in Bacillus Vares FZB42, the △spoIIIJ strain was generated, which solved the problem of screening excellent proliferation strains in the prior art, and significantly improved its indole acetic acid secretion ability and proliferation function.
Patent Information
- Application Number
- CN202311232481.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-09-22
- Publication Date
- 2025-04-18
- Estimated Expiration
- 2043-09-22
AI Technical Summary
The prior art is difficult to effectively screen and construct excellent proliferation strains of Bacillus Vares FZB42, especially in terms of biofilm dispersion regulation and indole acetic acid secretion.
By constructing a knockout fragment of the biofilm dispersed regulatory gene spoIIIJ and transforming it into FZB42, the spoIIIJ knockout strain △spoIIIJ was generated, and strains with significantly improved secretion of indole acetic acid were screened out.
The loss of biofilm dispersion ability of Bacillus Vares FZB42 and the significant improvement of indole acetic acid secretion level were achieved, enhancing its genopromotion ability.
Smart Images
Figure CN117363632B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of microbial genetic engineering, and more specifically relates to a biofilm dispersion regulating gene spoIIIJ and an application thereof. Background Art
[0002] Bacillus velezensis FZB42 is a Gram-positive plant rhizosphere growth-promoting bacterium that was isolated from the rhizosphere of German sugar beets in 1998 and sequenced as the first Bacillus amyloliquefaciens strain in 2007. FZB42 has been commercialized and colonizes plant roots in the form of biofilms and promotes plant growth. The development of bacterial biofilms is a complex cyclic process that includes initial attachment, formation, maturation, and dispersion. In addition to forming biofilms to help colonization, FZB42 can also synthesize indoleacetic acid (IAA) to promote plant growth. As a plant rhizosphere growth-promoting bacterium, FZB42 has broad application prospects, so analyzing its biocontrol mechanism is of far-reaching significance.
[0003] The whole genome of FZB42 has been sequenced, which provides a premise for screening biofilm regulatory genes. Given that biofilm colonization of FZB42 is a key factor in its growth-promoting function, screening FZB42 biofilm regulatory genes will help to explore its growth-promoting value. Summary of the invention
[0004] In view of the above problems existing in the prior art, the technical problem to be solved by the present invention is to provide the spoIIIJ gene of Bacillus varezii FZB42 for constructing a transgenic strain; another technical problem to be solved by the present invention is to provide the application of the spoIIIJ gene of Bacillus varezii FZB42 for screening excellent growth-promoting strains.
[0005] In order to solve the above technical problems, the technical solution adopted by the present invention is as follows:
[0006] The nucleotide sequence of the biofilm dispersion regulating gene spoIIIJ is shown in SEQ ID NO.1.
[0007] The biofilm dispersion regulating gene spoIIIJ is used in inhibiting the secretion of indoleacetic acid by Bacillus varezii FZB42.
[0008] The following steps are involved:
[0009] (1) Construction of a knockout fragment of the biofilm dispersion regulatory gene spoIIIJ;
[0010] (2) transforming the constructed knockout fragment of the biofilm dispersion regulatory gene spoIIIJ into Bacillus varezii FZB42;
[0011] (3) The strain Bacillus varezii FZB42 with significantly improved indoleacetic acid secretion level was cultivated and screened.
[0012] The nucleotide sequence of the knockout fragment of the biofilm dispersion regulating gene spoIIIJ is shown in SEQ ID NO.3.
[0013] The method for constructing the knockout fragment of the biofilm dispersion regulating gene spoIIIJ is as follows: based on the biofilm dispersion mutation library, the biofilm regulating gene spoIIIJ is identified by reverse PCR, and the target fragment of the spoIIIJ gene knockout is obtained by overlapping PCR, that is, the knockout fragment of the biofilm dispersion regulating gene spoIIIJ.
[0014] The reverse PCR primer sequences are as follows:
[0015] FBO752-F: 5'-GCTTGTAAATTCTATCATAATTG-3',
[0016] FBO753-R: 5'-AGGGAATCATTTGAAGGTTGG-3'.
[0017] The application of the biofilm dispersion regulating gene spoIIIJ in inhibiting the expression of tryptophan synthesis genes.
[0018] The tryptophan synthesis genes are trpB and trpC.
[0019] The application of the biofilm dispersion regulating gene spoIIIJ in inhibiting the expression of indoleacetic acid synthesis genes.
[0020] The indoleacetic acid synthesis gene is ysnE.
[0021] Compared with the prior art, the present invention has the following beneficial effects:
[0022] 1) The present invention is based on a biofilm dispersed mutation library, and the biofilm regulatory gene spoIIIJ is identified by reverse PCR. The target fragment of the spoIIIJ gene knockout is obtained by overlapping PCR, and the fragment is introduced into the wild-type FZB42 strain by chemical transformation to obtain the spoIIIJ knockout strain △spoIIIJ.
[0023] 2) Compared with the wild-type FZB42, the △spoIIIJ strain of the present invention lacks the ability to disperse biofilm.
[0024] 3) The level of indoleacetic acid (IAA) secreted by the ΔspoIIIJ strain of the present invention is significantly increased compared with the wild-type FZB42.
[0025] 4) Compared with the wild-type FZB42, the relative expression levels of the tryptophan synthesis genes trpB and trpC and the indoleacetic acid (IAA) synthesis gene ysnE of the △spoIIIJ strain of the present invention were significantly increased. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] Figure 1 This is the dispersion diagram of FZB42 and △spoIIIJ biofilm;
[0027] Figure 2 Figure 2 is the secretion level of FZB42 and ΔspoIIIJ IAA;
[0028] Figure 3 This is the relative expression level of FZB42 and △spoIIIJ trpB, trpC, and ysnE at 12 h of culture. DETAILED DESCRIPTION
[0029] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described below in conjunction with specific embodiments. Unless otherwise specified in the following embodiments, the technical means used are conventional means well known to those skilled in the art.
[0030] The Bacillus varezii FZB42 of the present invention is stored in the Molecular Pathology Laboratory of the Forestry College of Nanjing Forestry University.
[0031] Main reagents: Taq I endonuclease, Premix Taq TM , high-fidelity enzymes were purchased from Takara; gel recovery kits were purchased from Vazyme; reverse transcription and qPCR kits were purchased from TIANGEN; 3-indoleacetic acid was purchased from Sangon; other reagents were of analytical grade.
[0032] LB medium: Tryptone 10g / L, Yeast extract 5g / L, Nacl 5g / L, solid culture medium needs to be supplemented with Agar 15g / L.
[0033] LBGM liquid medium: LB medium was supplemented with 1 mL 100 mM MnSO4 / L and 10 mL glycerol / L.
[0034] Example 1
[0035] 1. Construction of FZB42 transposon library using Escherichia coli-Bacillus shuttle plasmid pMarA
[0036] The E. coli-Bacillus shuttle plasmid pMarA was transformed into FZB42 by electroporation, and the correctly verified transformant was named FBS239.
[0037] The FBS239 plates stored in a -80°C refrigerator were streaked and cultured in a 30°C constant temperature incubator overnight. A single colony was picked and inoculated into LB liquid medium (Kan, Em) and cultured at 30°C, 200 rpm for 12 h. The bacterial solution was diluted 10 5 ~10 7 Spread on Kan screening medium, place in oven at 50℃ for 12h, transfer to constant temperature incubator at 30℃ for 12h; pick out single colonies and streak inoculate on Kan and Em screening medium one by one. The colony that can grow on Kan screening medium but not on Em screening medium is a correct transposon, and 5000 transposons are selected to form FZB42 transposon mutation library.
[0038] 5000 transformants were inoculated into 96-well plates containing LBGM liquid culture medium and cultured at 30°C for 96 h. A mutant strain SL08 was screened based on the biofilm non-dispersion phenotype.
[0039] 2. Identification of the insertion position of the transposable sequence in the mutant SL08
[0040] The genomic DNA of the mutant strain SL08 was extracted by the CTAB method, and the genomic DNA of the mutant strain was digested with Taq I. After sufficient digestion, T4 DNA ligase was used for enzyme ligation. Reverse PCR primers were designed according to the transposition sequence TnYLB-1 (SEQ ID No. 2), and the primer sequences were as follows:
[0041] FBO752-F: 5'-GCTTGTAAATTCTATCATAATTG-3',
[0042] FBO753-R: 5'-AGGGAATCATTTGAAGGTTGG-3'.
[0043] The enzyme linkage product was used as a template, FBO752-F was used as the upstream primer, and FBO753-R was used as the downstream primer. According to the PCR reaction system (DNA of enzyme linkage 2 μL, Primer-F 1 μL, Primer-R 1 μL, Premix Taq TM 12.5μL, ddH2O up to 25μL) and PCR reaction program (95℃3min; 95℃15s, 50℃15s, 72℃3min, 30 cycles; 72℃5min), the sequencing results of PCR products were compared with the FZB42 genome map, and the biofilm regulatory gene spoIIIJ (SEQID No.1) was identified.
[0044] 3. Construction of spoIIIJ gene knockout strain △spoIIIJ
[0045] 1) According to the FZB42 genome map, primers were designed as follows:
[0046] SLO1-F: 5'-AGGCAGAAATTCATCCCTTATTACTTTAAC-3',
[0047] SLO2-R: 5'-GTACATCCGCAACTGTCCAT-CGC TGGCGGGATGTTTCCCAATCC-3',
[0048] SLO3-F: 5'-TAGTATCGACGGAGCCGA-AATCGTAACGATGATGATCGATAAAC-3',
[0049] SLO4-R: 5'-AAATAAGGTTTCTAAACTGGTTAAGGTATGTT-3'.
[0050] The CTAB method was used to extract FZB42 genomic DNA, which was used as a template. SLO1 and SLO3 were used as upstream primers, and SLO2 and SLO4 were used as downstream primers. The PCR reaction system (Genome DNA 2 μL, Primer-F 1 μL, Primer-R 1 μL, Max DNA Polymerase 25μL, ddH2O up to 50μL) and PCR reaction program (98℃10s; 98℃10s, 55℃15s, 72℃30s, 30 cycles, 72℃120s) were used to amplify fragments of about 1000bp upstream and downstream of spoIIIJ.
[0051] 2) Design primers according to the pMarA plasmid map as follows:
[0052] O4-Km-F:5'-:TCGGCTCCGTCGATACTATG-3',
[0053] O5-Km-R: 5'-ATGGACAGTTGCGGATGTAC-3'.
[0054] FBS239 DNA was extracted using the CTAB method and used as a template. O4-Km was used as the upstream primer and O5-Km was used as the downstream primer. The PCR reaction system (Genome DNA 2 μL, Primer-F 1 μL, Primer-R 1 μL, The Kan-resistant fragment was amplified using the following PCR reaction program (98°C for 10 s; 98°C for 10 s, 55°C for 15 s, 72°C for 30 s, 30 cycles, and 72°C for 120 s).
[0055] 3) Purify the three PCR products according to the instructions of the common DNA product purification kit (TIANGEN, DP204), measure the concentration in ng / μL by Nanodrop, convert it to pmol concentration, mix the three purified PCR products in a ratio of 1:1:1 as templates, without adding primers, and follow the PCR reaction system (template DNA 10μL, Max DNA Polymerase 25 μL, ddH2O up to 50 μL) PCR reaction program (98°C 10 s; 98°C 10 s, 55°C 15 s, 72°C 30 s, 12 cycles, 72°C 120 s) amplification.
[0056] The PCR product from the previous step was directly used as a template, and SLO1 was used as the upstream primer and SLO4 as the downstream primer to amplify the target fragment. Electrophoresis showed about 3000 bp, which was in line with expectations, and the target fragment for knocking out the spoIIIJ gene was obtained (SEQ ID No. 3).
[0057] 4) According to the instructions of the common agarose gel DNA recovery kit (TIANGEN, DP209), the target fragment was excised and recovered.
[0058] 5) The target fragment was transformed into wild-type FZB42 by chemical transformation to obtain spoIIIJ gene knockout transformants.
[0059] 6) Positive colony PCR detection
[0060] Pick a single colony of the transformant obtained in the previous step and place it in a centrifuge tube containing 30 μL ddH2O. Place it in a metal bath at 100°C for 10 minutes, then immediately place it in an ice bath for 2 minutes, centrifuge it at 12000 rpm for 1 minute, and take 1 μL of the supernatant as a template.
[0061] According to the FZB42 genome map, the primers were designed as follows:
[0062] spoIIIJ-F: 5'-TTCCGTCCCGTAGCAGTCAC-3',
[0063] spoIIIJ-R: 5'-ACGTTTTTAAAGCGCTTCC-3'.
[0064] The 2×Taq enzyme system of Takara Company was used, spoIIIJ-F was used as the upstream primer, spoIIIJ-R was used as the downstream primer, and the bacterial solution was PCR amplified according to the reaction system (8.5μL ddH2O, 12.5μL 2×TaqMaster Mix, 1μL supernatant, 1μL spoIIIJ-F (10μM), 1μL spoIIIJ-R (10μM)) and the reaction procedure (95℃5min; 95℃30s, 50℃30s, 72℃60sec / kb, 30 cycles; 72℃5min). The amplified bacterial solution PCR was taken out for gel electrophoresis detection, and the bacterial solution with bands in the electrophoresis pattern that were similar in size to the target fragment and bright and clear, that is, the positive clone bacterial solution, was sampled and sent to the company for sequencing. The sequencing results were aligned using BLAST (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi) software, and the alignment was correct, indicating that the spoIIIJ gene knockout strain △spoIIIJ was successfully constructed.
[0065] Example 2
[0066] Under sterile conditions, single colonies of wild-type FZB42 and △spoIIIJ were picked and inoculated into LB liquid medium for pre-culture at 37°C and 200 rpm overnight. The pre-cultured bacterial solution was taken and adjusted to OD 600 =1, inoculated into 24-well plates at 1% (2 mL LBGM medium was added to each well), cultured at 25°C for 120 h, and the biofilm at the solid-air interface and the bottom solution were observed.
[0067] The results are as follows Figure 1 As shown, the biofilm on the FZB42 surface has dispersed, while the △spoIIIJ surface still maintains a robust biofilm. The bottom solution of FZB42 has become turbid while the bottom solution of △spoIIIJ is still clear, indicating that the loss of spoIIIJ causes defects in biofilm dispersion.
[0068] Example 3
[0069] Weigh pure 3-indoleacetic acid and dissolve it in ddH2O to prepare 0, 20, 40, 60, 80, and 100 mg / L indoleacetic acid (IAA) solutions. Take 1 mL of indoleacetic acid (IAA) solutions of different concentrations and add 1 mL of Salkowski reagent (accurately measure 25 mL of 70% HClO4, add it to 25 mL of distilled water, and add 1 mL of 0.5 M FeCl3 solution after cooling to room temperature), mix and react in the dark at 25°C for 30 min, and measure OD 530 The absorbance value at the point where the standard curve is drawn is taken as the horizontal axis and the absorbance value as the vertical axis.
[0070] Under sterile conditions, single colonies of wild-type FZB42 and △spoIIIJ were picked and inoculated into LB liquid medium for pre-culture at 37°C, 200 rpm overnight; the bacterial solution obtained from the pre-culture was taken and adjusted to OD with sterile liquid LB. 600 =1; inoculate 1% into new LB liquid medium, culture at 37°C, 200rpm for 12h-18h. Take 1mL of bacterial solution and add 1mL of Salkowski reagent, mix and react in the dark at 25°C for 30min, and measure the absorbance OD 530 , and the standard curve was used to calculate the concentration of indoleacetic acid (IAA).
[0071] The results are as follows Figure 2 As shown, the level of indoleacetic acid (IAA) secreted by ΔspoIIIJ was significantly increased compared with wild-type FZB42.
[0072] Example 4
[0073] 1. Extraction of Total RNA
[0074] The total RNA of wild-type FZB42 and △spoIIIJ was extracted by TRIZOL method, and the RNA was detected by 1% agarose gel electrophoresis, and the concentration was detected by Nanodrop. The extracted RNA was detected by electrophoresis and showed that the 5S, 16S, and 23S bands were clear and there was no degradation. The OD 260 / OD 280 ≈2, basically no protein contamination, FZB42 and △spoIIIJ and RNA concentrations are 2438ng / μL and 2912ng / μL, and the RNA purity and quality meet the experimental requirements.
[0075] 2. Reverse transcription and genomic DNA removal
[0076] According to the instruction manual of HiScript III All-in-one RT SuperMix Perfect for qPCR (R333-01), cDNA was obtained by reverse transcription.
[0077] 3. qPCR quantitative detection
[0078] The relative expression levels of tryptophan synthesis genes trpB, trpC and indoleacetic acid (IAA) synthesis gene ysnE in wild-type FZB42 and △spoIIIJ were determined by qPCR, and gyrA was selected as the internal reference gene.
[0079] The qPCR reaction system was prepared according to the instructions of the Talent Fluorescence Quantification Detection Kit (SYBR Green) (TIANGEN, FP209), and the qPCR reaction was performed using a two-step PCR reaction program (95°C for 3 min; 95°C for 5 s, 60°C for 15 s, 40 cycles). -ΔΔCT The results of the fluorescence quantitative PCR experiment were calculated by the method, and the data were analyzed using Prism. The primers designed according to the FZB42 genome map are as follows:
[0080] gyrA-F: TGCAGCGGTGTATCAATTCC,
[0081] gyrA-R:GGCCGTTTGTTTGTACAGGT.
[0082] trpB-F:TGCAGCGGTGTATCAATTCC,
[0083] trpB-R:CGGACAAGGTTGTTGCATGT.
[0084] trpC-F:CGGGTATCCGTGAGAACTGA,
[0085] trpC-R: GGCTGATTGCCGAAGTGAAA.
[0086] ysnE-F: TCAAGCATATGGCGGAGGAT,
[0087] ysnE-R:GCGGTGCCTTAAAGGAGCTA.
[0088] The results are as follows Figure 3 As shown, compared with the wild-type FZB42, the relative expression levels of tryptophan synthesis genes trpB, trpC and indoleacetic acid (IAA) synthesis gene ysnE in △spoIIIJ were significantly increased.
[0089] In summary, the deletion of the spoIIIJ gene of Bacillus varezii can enhance the indoleacetic acid (IAA) secretion ability of the FZB42 strain, which has important application value in improving the growth-promoting ability of FZB42.
Claims
1. Knockout of genes regulating biofilm dispersion spoIII Application of the biofilm dispersion regulating gene in promoting the secretion of indoleacetic acid by Bacillus varezii FZB42 spoIII The nucleotide sequence is shown in SEQ ID NO.
1.
2. The use according to claim 1, characterized in that: The following steps are involved: (1) Construction of biofilm dispersion regulation genes spoIII knockout fragments; (2) Disperse the regulatory genes of the constructed biofilm spoIII The knockout fragment was transformed into Bacillus varezii FZB42; (3) The strain Bacillus varezii FZB42 with significantly improved indoleacetic acid secretion level was cultivated and screened.
3. The use according to claim 2, characterized in that: Biofilm dispersion regulatory genes spoIII The nucleotide sequence of the knockout fragment is shown in SEQ ID NO.
3.
4. The use according to claim 3, characterized in that: Biofilm dispersion regulatory genes spoIII The knockout fragments were constructed by: based on the biofilm dispersed mutation library, the biofilm regulatory genes were identified by inverse PCR. spoIIIJ, Knockout obtained by overlapping PCR spoIII The target gene fragment, namely the biofilm dispersion regulating gene spoIII knockout fragment.
5. The use according to claim 4, characterized in that: The reverse PCR primer sequences are as follows: FBO752-F: 5'-GCTTGTAAATTCTATCATAATTG-3', FBO753-R: 5'-AGGGAATCATTTGAAGGTTGG-3'.