Method for constructing multi-gene modified yeast and application thereof
By constructing a long double-stranded DNA target vector and converting it into a single strand using a two-step fusion PCR and nested PCR method, the problem of low efficiency in multi-gene modification of *Candida bacillus* was solved. This method enabled efficient transformation and rapid fermentation to produce an equal amount of sophorolipids, thus reducing operating costs.
Patent Information
- Application Number
- CN202311347892.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-10-17
- Publication Date
- 2026-04-10
- Estimated Expiration
- 2043-10-17
AI Technical Summary
Existing methods for multi-gene modification of Candida bumblebee are inefficient, time-consuming, complex, and costly. They are difficult to ferment and generate an equal amount of sophorolipids in a short time, and existing methods are difficult to construct and transform multi-gene long-fragment DNA vectors with a length greater than 8000 bp.
A long double-stranded DNA target vector was constructed using a two-step fusion PCR and nested PCR method. Multiple gene fragments were linked by introducing homologous sequences and then single-stranded into a long single-stranded DNA target vector. The vector was then transformed into yeast using electroporation technology, and positive transformants were screened.
This method enables the efficient construction of multi-gene modified yeast, shortens vector construction time, increases transformation success rate, reduces costs, improves yeast modification efficiency, shortens fermentation time, and enhances the fermentation efficiency of sophorolipids.
Smart Images

Figure CN117511986B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology. More specifically, it relates to a method for efficiently constructing multi-gene modified yeast and its applications. Background Technology
[0002] Sophorolipids are a class of biosurfactants that possess the general properties of conventional surfactants, such as solubilization, emulsification, wetting, foaming, dispersion, and surface tension reduction, and are extremely environmentally tolerant. *Candida albicans* (bumblebee) Starmerella bombicola , S. bombicola *Candida albicans* is a non-pathogenic *Candida* yeast capable of synthesizing sophorolipids. Among the known sophorolipid-producing strains, *Candida albicans* has the highest yield and the best application prospects. However, compared with commonly used chemical surfactants, the cost of using *Candida albicans* to ferment and produce sophorolipids is still relatively high. Therefore, it is necessary to provide *Candida albicans* strains with high sophorolipid production or strains that can ferment and produce sophorolipids in a shorter time, in order to reduce the production cost of sophorolipids using *Candida albicans* fermentation from the source.
[0003] While there are reports of increasing sophorolipid production in *Candida bumblebee* by knocking out specific genes, reports of *Candida bumblebee* strains that can ferment and produce the same amount of sophorolipids in a shorter time are rare. Furthermore, studies have found that the sophorolipid synthesis pathway in *Candida bumblebee* is regulated by multiple key enzyme genes and influenced by multiple metabolic pathways, including fatty acid β-oxidation and glucose breakdown. To further improve the sophorolipid production capacity of *Candida bumblebee*, it may be necessary to modify multiple key enzyme genes in different pathways, and also introduce resistance genes that facilitate the screening of positive clones. This places very high technical demands on the construction efficiency and transformation efficiency of long-fragment DNA vectors.
[0004] The existing method for multi-gene modification of Bombicola theae mainly is step-by-step modification, that is, first, a single gene of Bombicola theae is knocked out or overexpressed by homologous recombination, and then the successfully modified positive strain is screened, and the next gene modification is carried out by taking the strain as a starting strain. This method has the problems of low efficiency, long time consumption, complicated operation and high cost. In addition, although there is a method for obtaining a linear knockout cassette by fusion PCR and transforming the yeast to knock out the gene, the linear knockout cassette constructed by this method only contains a single gene, and the overall length is only 2729 bp. This method may not be suitable for the construction and transformation of multi-gene long fragment DNA vector. When the key enzymes in the metabolic pathway related to the synthesis of sophorolipids in Bombicola theae are genetically modified, simple and rapid construction of multi-gene fragment vector and high-efficiency transformation efficiency are important guarantees for accelerating the development of high-yield sophorolipid stable strains. Therefore, there is an urgent need to provide a method for efficiently constructing multi-gene modified yeast. SUMMARY
[0005] The present application provides a method for efficiently constructing multi-gene modified yeast, and a multi-gene modified Bombicola theae strain capable of fermenting to generate an equal amount of sophorolipids in a shorter time is constructed by using the method.
[0006] The present application provides a method for efficiently constructing multi-gene modified yeast.
[0007] Another object of the present application is to provide a multi-gene modified yeast constructed by using the method.
[0008] The above objects of the present application are achieved by the following technical solutions:
[0009] The existing method for multi-gene modification of yeast mainly is step-by-step modification, which has the problems of low efficiency, long time consumption, complicated operation and high cost. Although multiple genes can be connected into a long double-stranded DNA by fusion PCR, it is difficult to fuse and connect by conventional fusion PCR reaction if the gene fragments to be fused contain long DNA sequences and the number of gene fragments is large. In addition, double-stranded vectors with a length of more than 8000 bp are difficult to be transformed into yeast by conventional electroporation method, which is not conducive to the multi-gene modification of yeast. In order to overcome the above technical problems, the present application provides a method for efficiently constructing multi-gene modified yeast, which comprises the following steps:
[0010] S1. Determine the gene to be knocked out, one or several genes to be overexpressed; take the upstream homologous arm of the gene to be knocked out as the first DNA fragment, take the downstream homologous arm of the gene to be knocked out as the last DNA fragment, and the one or several genes to be overexpressed are DNA fragments connected in sequence between the first and last DNA fragments.
[0011] S2. Prepare all the DNA fragments described in S1, and connect all the DNA fragments into a long double-stranded DNA target vector for multi-gene modification by two-step fusion PCR and nested PCR;
[0012] In the reaction program of the two-step fusion PCR, the extension time is calculated at an enzyme reaction rate of 30-60 sec / Kb.
[0013] S3. Single-strand the long double-stranded DNA target vector obtained in S2 into a long single-stranded DNA target vector and transform the yeast strain competent cells, and screen positive transformants.
[0014] Specifically, the gene to be overexpressed in S1 includes the nucleotide sequence of its coding region, promoter and terminator.
[0015] Specifically, the 3' end of the first DNA fragment in S1 is introduced with a sequence of 35-45 bp homologous to the 5' end of the DNA fragment to be connected, the 5' end of the last DNA fragment is introduced with a sequence of 35-45 bp homologous to the 3' end of the DNA fragment to be connected, and the 5' end of the remaining intermediate DNA fragment is introduced with a sequence of 35-45 bp homologous to the 3' end of the DNA fragment to be connected, and the 3' end is introduced with a sequence of 35-45 bp homologous to the 5' end of the DNA fragment to be connected.
[0016] For the convenience of screening of multi-gene modified yeast strains, the gene to be overexpressed also includes a resistance gene. The 5' end of the DNA fragment of the resistance gene is introduced with a sequence of 35-45 bp homologous to the 3' end of the DNA fragment to be connected, and the 3' end is introduced with a sequence of 35-45 bp homologous to the 5' end of the DNA fragment to be connected.
[0017] Alternatively, all the DNA fragments can be prepared by artificial synthesis or PCR method.
[0018] Specifically, the two-step method fusion PCR of S2 includes a first step of primer-free fusion PCR and a second step of primer-containing fusion PCR; the reaction system of the first step of primer-free fusion PCR includes all DNA fragments and high-fidelity enzyme, and the extension time in the reaction program is calculated at the enzyme reaction rate of 30-60 sec / Kb; the second step of primer-containing fusion PCR uses the reaction product of the first step of primer-free fusion PCR as a template, and uses the upstream primer of the upstream homologous arm of the gene to be knocked out and the downstream primer of the downstream homologous arm of the gene to be knocked out to perform PCR amplification reaction, and the extension time in the reaction program is calculated at the enzyme reaction rate of 30-60 sec / Kb.
[0019] More specifically, the reaction system of the first step of primer-free fusion PCR is that the prepared DNA fragments with homologous sequences are added to the PrimeSTAR Max Premix reaction system in the same molar number, without adding any primer, and 5-10 cycles are performed, and the extension speed is 30-60 s / Kb.
[0020] Preferably, the first step of primer-free fusion PCR is performed for 10 cycles.
[0021] Specifically, when the length of the long double-stranded DNA target vector to be constructed exceeds 5000 bp, the total amount of the added DNA fragments needs to be greater than 500 ng.
[0022] Specifically, the second step of primer-containing fusion PCR of S2 is performed for 25-30 cycles.
[0023] Specifically, the nested PCR of S2 only includes a pair of primers, and one primer needs to be phosphorylated at the 5' end.
[0024] Specifically, the single-stranded long double-stranded DNA target vector of S3 includes the following steps:
[0025] S31. Adding DNA helicase A to the product obtained in S2 to recognize the 5' end of the long double-stranded DNA target vector which is phosphorylated and modified and to initially digest the chain;
[0026] S32. Adding DNA helicase B to the reaction solution of S31 to completely digest the 5' end of the chain which is phosphorylated and modified.
[0027] Specifically, in step S31, 5 μL of DNA helicase A and 10 μL of reaction buffer are added to every 10-15 μg of product.
[0028] Specifically, the reaction conditions of S31 and S32 are the same, and the reaction conditions are 37°C for 5-15 min, 80°C for 5 min, and 4°C for 10 min.
[0029] Preferably, the reaction time at 37°C is 10 min.
[0030] The above reaction system and conditions can be used when the length of the constructed long double-stranded DNA target vector is less than 10,000 bp. If the length is more than 10,000 bp, the reaction system and conditions need to be adjusted appropriately and the reaction time is prolonged.
[0031] Specifically, 0.1-1% (v / v) DMSO (dimethyl sulfoxide) is added to the reaction solution when the yeast strain competent cells are electrotransformed.
[0032] Preferably, the final concentration of DMSO added is 0.5%.
[0033] Specifically, the electrotransformation conditions are 5 ms and 2.5 kV pulse.
[0034] In view of the high efficiency of multi-gene modification of yeast strains achieved by the method of the present application, the present application also claims the use of the method in the construction of multi-gene modified yeast strains.
[0035] Specifically, the yeast strain is Candida bombicola.
[0036] As an embodiment, the present application also provides a multi-gene modified yeast strain, which is obtained by multi-gene modification of the yeast strain Candida bombicola according to the method of the present application.
[0037] Specifically, the multi-gene modification is the knockout of the MFO-2 gene of the yeast strain and the overexpression of the MRD-2 and pUGTB genes.
[0038] Specifically, the nucleotide sequence of the MFO-2 gene is shown in SEQ ID NO. 1; the nucleotide sequence of the MRD-2 gene is shown in SEQ ID NO. 5; and the nucleotide sequence of the pUGTB gene is shown in SEQ ID NO. 6.
[0039] As an alternative embodiment, the nucleotide sequence of the upstream homologous arm of the MFO-2 gene used for the knockout of the MFO-2 gene is shown in SEQ ID NO. 2, and the nucleotide sequence of the downstream homologous arm of the MFO-2 gene is shown in SEQ ID NO. 3.
[0040] Specifically, the method for constructing the multi-gene modified Candida bombicola strain with the knockout of the MFO-2 gene and the overexpression of the MRD-2 and pUGTB genes comprises the following steps:
[0041] S1. DNA fragments of the upper and lower homologous arms of the MFO-2 gene with homologous sequences and DNA fragments of the MRD-2 and pUGTB genes are obtained by PCR amplification;
[0042] S2. All the DNA fragments are connected into a long double-stranded DNA target vector for multi-gene modification by two-step fusion PCR and nest PCR with the DNA fragments obtained in S1 as templates;
[0043] S3. The long double-stranded DNA target vector obtained in S2 is single-stranded into a long single-stranded DNA target vector and transformed into a yeast bacterial competent cell, and positive transformants are screened.
[0044] Specifically, the primers for amplifying the upper homologous arm of the MFO-2 gene are MFO-2_5F and MFO-2_5R, and the sequences thereof are shown in SEQ ID NO. 7 and 8, respectively; the primers for amplifying the lower homologous arm of the MFO-2 gene are MFO-2_3F and MFO-2_3R, and the sequences thereof are shown in SEQ ID NO. 9 and 10, respectively; the primers for amplifying the MRD-2 gene are MRD-2 oeF and MRD-2 oeR, and the sequences thereof are shown in SEQ ID NO. 11 and 12, respectively; and the primers for amplifying the pUGTB gene are pUGTB oeF and pUGTB oeR, and the sequences thereof are shown in SEQ ID NO. 13 and 14, respectively.
[0045] Specifically, the PCR reaction system for amplifying the upper homologous arm of the MFO-2 gene is as follows: PrimeSTAR Max Premix 25.0 μL, genomic DNA 2.0 μL, upper and lower primers each 1.0 μL, and dd H2O 50 μL; and the reaction program is as follows: 98℃ 10 sec; 55℃ 5 sec, 72℃ 5 sec / Kb calculated extension time, 30 cycles; and 72℃ 10 min.
[0046] The PCR reaction systems for amplifying the lower homologous arm of the MFO-2 gene, the MRD-2 gene and the pUGTB gene are the same as that for amplifying the upper homologous arm of the MFO-2 gene, and the reaction programs are also the same.
[0047] Specifically, when amplifying each DNA fragment, the amount of the genomic DNA is 50-200 ng.
[0048] Specifically, when constructing the long double-stranded DNA target vector for modifying the yeast bacteria, a modified resistance gene for resistance screening is also introduced, and the nucleotide sequence thereof is shown in SEQ ID NO. 4, which is a hygromycin resistance gene.
[0049] In the present application, the DNA fragment of the modified resistance gene is obtained by synthesis.
[0050] Specifically, the connection order of the gene fragments in the fusion PCR is: the upstream homologous arm of the MFO-2 gene + pUGTB + the resistance screening gene + MRD-2 + the downstream homologous arm of the MFO-2 gene.
[0051] Specifically, the two-step method PCR fusion process of the gene fragments is: the gene fragments with the homologous arms are added into the PCR reaction system in the same molar amount, the total DNA amount is 500-1000 ng, no primer is added, 5-10 cycles are carried out, and the extension speed is 30-60 s / Kb to complete the first step of the fusion PCR.
[0052] Preferably, the total DNA amount is 800 ng, 10 cycles are carried out, and the extension speed is 30 s / Kb.
[0053] The primer MFO-2_5F and MFO-2_3R are added into the PCR product of the first step of the fusion PCR, 25-30 cycles are carried out, and the extension speed is 30-60 s / Kb to complete the second step of the fusion PCR.
[0054] Specifically, the sequences of the primers used in the nested PCR of the multi-gene modified yeast are shown in SEQ ID NO. 15-16 in sequence; the 5' end of the primer shown in SEQ ID NO. 16 is modified with a phosphate group.
[0055] Specifically, the process of the nested PCR of the multi-gene modified yeast is: 5-10 μL of the product of the second step of the fusion PCR is diluted by 100-500 times, 2-10 μL of the diluted product is taken as a template, the primers shown in SEQ ID NO. 15-16 are added, 25-30 cycles of the nested PCR are carried out, and the extension speed is 5-10 s / Kb to obtain the long double-stranded DNA linear target vector with the phosphate group at the 5' end of the antisense chain.
[0056] Preferably, 10 μL of the product of the second step of the fusion PCR is diluted by 200 times, 5 μL is taken as the template of the nested PCR, and the extension speed is 5 s / Kb.
[0057] The present application has the following beneficial effects:
[0058] The application provides a method for efficiently constructing a multi-gene modified yeast strain, which constructs a long double-stranded DNA target vector with a length of 8000 bp or more by a two-step method of fusion PCR and nest PCR, and single-strands the long double-stranded DNA target vector into a long single-stranded DNA target vector, so as to efficiently and successfully transform the yeast strain, greatly shortens the time required for constructing the vector, improves the success rate of the long-chain DNA in transforming the yeast strain, improves the modification efficiency of the yeast strain, and is simple in steps, short in time consumption, high in vector transformation efficiency, low in cost, and can be widely used for multi-gene modification of the yeast strain. The application constructs a multi-gene modified Bombus nasonis Candida albicans strain by knocking out MFO-2 gene and overexpressing MRD-2 and pUGTB genes, and the multi-gene modified Bombus nasonis Candida albicans strain can ferment an equal amount of sophorolipids in a shorter time compared with the wild type, which is beneficial to shorten the fermentation time, save energy consumption and improve the fermentation efficiency of sophorolipids in actual production. BRIEF DESCRIPTION OF DRAWINGS
[0059] Figure 1 A flowchart for utilizing the method of the application to utilize MFO-2, pUGTB and MRD-2 for multi-gene modification.
[0060] Figure 2 An agarose gel electrophoresis diagram of DNA fragments of each gene required for constructing a long double-stranded DNA target vector and a fusion PCR product.
[0061] Figure 3 An agarose gel electrophoresis diagram of a long double-stranded DNA target vector obtained by nest PCR and a long single-stranded DNA target vector after single-stranding; (1) in the diagram is an agarose gel electrophoresis diagram of a nest PCR product; (2) in the diagram is an electrophoresis diagram of a long double-stranded DNA target vector and a long single-stranded DNA target vector after single-stranding.
[0062] Figure 4 A PCR verification electrophoresis diagram of a transformant colony.
[0063] Figure 5 A comparison result diagram of a ΔMFO-2-pUGTB+MRD-2 strain and a wild type strain. S. bombicola ΔMFO-2-pUGTB+MRD-2 + Strains and wild type S. bombicola A comparison result diagram of sophorolipid production ability of strains.
[0064] Figure 6 A comparison result diagram of fusion of multi-gene fragments by fusion PCR (One-step) and fusion PCR (Two-step).
[0065] Figure 7 A transformation result diagram of Candida albicans after being electrically transformed by using a ds DNA linear vector and a ss DNA vector respectively. DETAILED DESCRIPTION
[0066] The present application is further illustrated in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present application in any form. Unless otherwise specified, the reagents, methods and devices used in the present application are conventional reagents, methods and devices in the art.
[0067] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.
[0068] Example 1 Multi-gene modification of Bombicola thebae
[0069] The present application provides a method for efficiently constructing multi-gene modified yeast, and the method is used to realize multi-group different multi-gene modification of yeast. The present application takes the knock-out of MFO-2 gene and the overexpression modification of MRD-2 and pUGTB genes of Bombicola thebae as an example to illustrate the method for efficiently constructing multi-gene modified yeast. First, a long double-stranded DNA target vector is constructed by two-step fusion PCR and nested PCR, and the long double-stranded DNA target vector is single-stranded to obtain a long single-stranded target DNA vector for multi-gene modification and transformed into Bombicola thebae to obtain multi-gene modified S. bombicola ΔMFO-2-pUGTB+MRD-2 + Strain. When MFO-2, pUGTB and MRD-2 are used for multi-gene modification by the method of the present application, the flowchart is as shown in Figure 1
[0070] The specific method for multi-gene modification is as follows:
[0071] 1. Construction of long double-stranded DNA target vector
[0072] First, the DNA fragments of each gene to be fused with homologous sequences are obtained by PCR amplification or synthesis, and the DNA fragments are sequentially connected by fusion PCR to obtain a fusion PCR product using the introduced homologous sequences, and the long double-stranded DNA target vector is obtained by nested PCR using the fusion PCR product as a template.
[0073] (1) Obtaining DNA fragments of each gene
[0074] In order to realize the knock-out of the MFO-2 gene of Bombus nataliae, the present application designs primers for amplifying the upstream homologous arm (MFO-2-5') and the downstream homologous arm (MFO-2-3') of the MFO-2 gene (the upstream homologous arm amplification primer: MFO-2_5F / 5R; the downstream homologous arm amplification primer: MFO-2_3F / 3R), and designs primers for amplifying the MRD-2 (MRD-2 oeF / oeR) and pUGTB (pUGTB oeF / oeR) genes, and the primers further introduce part of the preferred homologous sequences so as to introduce the homologous sequences at both ends of the obtained sequences by PCR amplification.
[0075] The preferred homologous sequences are as follows:
[0076] MF-U: CAAGAAGGGAAAGTGAAACCAGAGAGTGGGACCTGATTC
[0077] U-H: AGGTAGATAGATACACGTTTTTAGACGTGCATACATGCGAGT
[0078] H-MR: AGCGACGCACGATCCAATACATGGTGGATGATATACAGGTA
[0079] MR-MF: CATTTAGCGAGCCACAAGTGAACACCAAAGCCATTACTGC
[0080] The nucleotide sequence of the MFO-2 gene is shown as SEQ ID NO. 1, the nucleotide sequence of the upstream homologous arm of the MFO-2 gene is shown as SEQ ID NO. 2, the nucleotide sequence of the downstream homologous arm of the MFO-2 gene is shown as SEQ ID NO. 3, the nucleotide sequence of the MRD-2 gene is shown as SEQ ID NO. 5, and the nucleotide sequence of the pUGTB gene is shown as SEQ ID NO. 6. The primer sequences for amplifying the DNA fragments are shown in Table 1:
[0081] Table 1 Primers for amplifying each DNA fragment
[0082]
[0083] In addition, the application prepares the DNA fragment of the modified hygromycin resistance gene (gF-Hph-gR, nucleotide sequence as shown in SEQ ID NO. 4) for resistance screening by an artificial synthesis method, and the preferred homologous sequences are introduced at both ends of the DNA fragment. The genomic DNA of the bee Candida utilis is extracted by using a yeast genomic DNA extraction kit, and the DNA fragments of the upstream and downstream homologous arms of MFO-2 with the homologous sequences and the DNA fragments of pUGTB and MRD-2 gene are obtained by PCR amplification, and are used as templates for the next fusion PCR.
[0084] Specifically, the MFO-2-5', pUGTB, the modified resistance gene gF-Hph-gR, MRD-2 and MFO-2-3' are fused by homologous recombination in the fusion PCR by using the preferred homologous sequences of the application. Among them, the MFO-2-5' and pUGTB are homologously recombined by using the homologous sequence MF-U, the pUGTB and gF-Hph-gR are homologously recombined by using the homologous sequence U-H, the gF-Hph-gR and MRD-2 are homologously recombined by using the homologous sequence H-MR, and the MRD-2 and MFO-2-3' are homologously recombined by using the homologous sequence MR-MF, and the connection sequence is as shown in Figure 1 .
[0085] The PCR reaction system and the reaction degree for amplifying the DNA fragments of MFO-2-5', MFO-2-3', MRD-2 and pUGTB gene are shown in Table 2:
[0086] Table 2 PCR reaction system and reaction procedure
[0087]
[0088] ※ MFO-2-5': 3 sec; MFO-2-3': 3 sec; pUGTB: 20 sec; MRD-2: 22 sec; gF-Hph-gR: 17 sec
[0089] After the PCR is completed, the DNA fragments of each gene amplified are detected by agarose gel electrophoresis and purified by using a DNA product purification kit, and the electrophoresis detection result is as shown in Figure 2 . It can be known from Figure 2 that the DNA fragments are successfully amplified. The concentrations of the DNA fragments are measured by using a microspectrophotometer, and the two-step fusion PCR is performed.
[0090] (2) Two-step fusion PCR
[0091] ① First step: primer-free fusion PCR
[0092] The amplified DNA fragments with homologous sequences and the DNA fragments of the synthetic resistance genes are added into 50 μL of a PCR reaction system in the same molar number, so that the total DNA amount is 500-1000 ng, no primer is added, 5-10 cycles are carried out, the extension speed is 30-60 s / Kb, and the first primer fusion PCR is completed. The reaction system and the reaction procedure of the first primer fusion PCR are shown in Table 3.
[0093] Table 3 Reaction system and reaction procedure of the first primer fusion PCR
[0094]
[0095] Through experiments, the total DNA amount is 800 ng, 10 cycles, the extension speed is 30 s / Kb, and the effect of using the high-fidelity enzyme PrimeSTAR series to carry out the reaction is the best.
[0096] 2. Second primer fusion PCR
[0097] The primer MFO-2_5F and MFO-2_3R are added into the PCR product in 1, 25-30 cycles are carried out, the extension speed is 30-60 s / Kb, and the second fusion PCR is completed. The fusion PCR product is detected by agarose gel electrophoresis, and the detection result is shown in Table 2. Figure 2 It can be known from Table 2 that the multiple gene fragments are successfully fused. Figure 2
[0098] The reaction system and the reaction procedure of the second primer fusion PCR are shown in Table 4.
[0099] Table 4 Reaction system and reaction procedure of the second primer fusion PCR
[0100]
[0101] (3) Nested PCR
[0102] Take two-step fusion PCR product 5-10 μL dilution 100-500 times, take dilution 2-10 μL as template, add primer Nest-F (TGCTCATGTCCACTGAAGC, SEQ ID NO.15) and Nest-R (P-CGAGATACGCCTAATCAGTCA, SEQ ID NO.16, 5' end modified with phosphate group), carry out 25-30 cycles of nest PCR, the reaction system and reaction procedure of nest PCR are shown in Table 5, the extension speed is 5-10 s / Kb, and the long double-strand DNA linear target vector (double-strand DNA, ds DNA) with 5' end phosphorylated modification is obtained by amplification, and the ds DNA vector is purified using a DNA fragment purification kit.
[0103] Through experiments, 10 μL of the two-step fusion PCR product is diluted 200 times, 5 μL is taken as a nest PCR template, and the effect of 5 s / Kb extension speed is best.
[0104] Table 5 Nest PCR reaction system and reaction procedure
[0105]
[0106] The nest PCR product is subjected to agarose gel electrophoresis, and the results are shown in (1) of Figure 3 As can be seen from the figure, the long double-strand DNA linear target vector with high purity (single characteristic band) is obtained by nest PCR.
[0107] 2, Transformation of multi-gene modified linear vector
[0108] (1) Preparation of long single-strand DNA (single-strand DNA, ss DNA) target vector
[0109] Take 10-15 μg of the purified nest PCR product as a template (i.e. long double-strand DNA target vector with 5' end of antisense strand phosphorylated modification, ds DNA), add 5 μL of DNA helicase A and 10 μL of reaction buffer, and dilute to 50 μL with RNase-Free sterilized water, to carry out the reaction of recognizing antisense strand and initial digesting antisense strand, and the reaction conditions are: 37℃ reaction for 5-15 min; 80℃ reaction for 5 min; 4℃ storage for 10 min.
[0110] Through experiments, the effect of 37℃ reaction for 10 min is best.
[0111] Add 1 μL of DNA helicase B to the reaction solution from the first step to completely digest the antisense strand. The reaction conditions are the same as the previous step. After obtaining ss DNA, purify it using a DNA fragment purification kit. Detect the purified ss DNA by agarose gel electrophoresis. The results are as follows: Figure 3 As shown in (2) of the figure. As can be seen from the figure, the present invention successfully converts the multi-gene modified long double-stranded DNA linear vector into a multi-gene modified long single-stranded DNA linear vector.
[0112] (2) Electroporation of long single-stranded DNA (ss DNA) target vector and verification of transformed colonies
[0113] ① Preparation of competent yeast cells
[0114] Bumblebee *Candida* yeast (S.) bombicola Single colonies of the bacteria were inoculated into a 250 mL shake flask containing 25 mL of YPD medium and cultured at 30°C and 300 rpm for 18 hours. The culture solution from the previous step was then inoculated at 2% (v / v) into a 250 mL shake flask containing 50 mL of YPD medium and cultured at 30°C and 120 rpm until the OD600 value was between 1 and 2. The bacterial culture was transferred to a 50 mL centrifuge tube and centrifuged at 3000 g and 4°C for 5 min to collect the bacterial cells. The cells were resuspended in 50 mL of ice-cooled sterile water, centrifuged at 3000 g and 4°C for 5 min, and the supernatant was discarded. The precipitate was resuspended again in 50 mL of ice-cooled sterile water and centrifuged. The bacterial precipitate was resuspended in 4 mL of pre-chilled sorbitol solution (1 M), centrifuged at 3000 g and 4°C for 5 min, and the supernatant was discarded. The precipitate was then dissolved in 4 mL of freshly prepared 0.1 M lithium acetate solution (3500 μL water plus 400 μL...). The precipitate was suspended in 0.1 M lithium acetate and 100 μL of 0.1 M DTT and left at room temperature for 15 min. Then, it was centrifuged at 3000 g and 4 °C for 5 min and the supernatant was discarded. The bacterial precipitate was resuspended in 4 mL of pre-chilled sorbitol solution (1 M) and centrifuged at 3000 g and 4 °C for 5 min. The supernatant was discarded. The bacterial cells were resuspended in 250 μL of pre-chilled sorbitol solution (1 M) to obtain competent cells, which were placed on ice for transformation experiments.
[0115] ② Electroporation of ss DNA target vector
[0116] Take 50 μL of the competent cell suspension into a centrifuge tube, add 3 μg of the ss DNA target vector and DMSO with a final concentration of 0.5% (v / v) into the centrifuge tube, mix well, and precool on ice for 5 min; transfer the mixture into an electroporation cup with a 0.2 cm gap, and precool on ice for 5 min; use a Micro Pulser (Bio-Rad) to apply a pulse of 5 ms and 2.5 kV to the mixture; take out the electroporation cup, immediately add 1 mL of pre-cooled sorbitol solution (1 M), mix gently, and then transfer into a 1.5 mL centrifuge tube, and incubate at 30°C for 1 h; take 100 μL of the mixture solution and spread on YPD solid medium containing hygromycin, and incubate at 30°C for 5-7 days.
[0117] ③ Verify the single colony on the YPD plate containing hygromycin
[0118] Take the single colony on the YPD plate for liquid culture, incubate at 30°C for 12-16 h, and use a yeast DNA extraction kit to extract the genomic DNA; use the genomic DNA as a template, and use primers Nest-F and Nest-R to perform PCR amplification, and perform agarose gel electrophoresis on the amplified DNA fragments, and the results are shown in Figure 4 If the length of the amplified DNA fragment is consistent with the length of the long double-stranded DNA target vector obtained through the nest PCR, it is proved that the vector for multi-gene modification constructed in the application is successfully connected into the genomic DNA of the Apilarnax borianus strain. It can be known from Figure 4 that the multi-gene modification linear vector with a length of about 9000 bp is successfully transformed into the Apilarnax borianus strain by using the method described in the application, and the S. bombicola ΔMFO-2 - pUGTB + MRD-2 + strain is constructed.
[0119] Example 2 S. bombicola ΔMFO-2 - pUGTB + MRD-2 + Strain detection of the ability to produce sophorolipids
[0120] The application takes the wild-type Apilarnax borianus strain as a control, and detects the ability of the S. bombicola ΔMFO-2 - pUGTB + MRD-2 + strain to produce sophorolipids.
[0121] (1) Fermentation culture of the strain
[0122] The strain to be detected is inoculated into a test tube containing 5 mL of YPD seed medium, and cultured at 30°C at a rotation speed of 200-250 rpm for 24-36 h. The seed liquid is inoculated into a shake flask containing 50 mL of YPD medium at an inoculation amount of 2% (v / v) for primary shake flask fermentation, and cultured at 25-30°C at a rotation speed of 200-300 rpm for 24-48 h. When the OD 600 =1.0, the fermentation liquid is inoculated into a 500 mL shake flask containing 100 mL of fermentation medium at an inoculation amount of 5% (v / v), and cultured at 25-30°C at a rotation speed of 200-250 rpm for 5-7 days. The total sophorolipid content in the fermentation liquid is determined by the anthrone method, and the residual glucose content in the fermentation liquid is determined by a biosensor analyzer SBA-40E, so as to compare S. bombicola ΔMFO-2 - pUGTB + MRD-2 + and the sophorolipid yield of the wild strain.
[0123] The YPD medium comprises 1% (w / v) yeast extract, 2% (w / v) peptone, and 2% (w / v) glucose.
[0124] The fermentation medium comprises 1% (w / v) yeast extract, 4% (w / v) linoleic acid, 8% (w / v) glucose, 0.1% KH2PO4, 0.1% Na2HPO4•12H2O, and 0.05% MgSO4•7H2O.
[0125] The shake flask fermentation is preferably performed by inoculating the primary shake flask fermentation liquid into 100 mL of culture medium at an inoculation amount of 5% (v / v), and culturing at 30°C at a rotation speed of 200-250 rpm for 7 days.
[0126] (2) Determination of residual sugar content
[0127] The glucose concentration in the culture medium is determined by using a biosensor analyzer SBA-40E.
[0128] The fermentation liquid is centrifuged to obtain supernatant, and the supernatant is filtered through a 0.45 μm filter membrane. 25 μL of the filtrate diluted to an appropriate multiple is injected. The residual glucose content (g / L) in the fermentation liquid = n x m / 100 (n is the instrument reading, and m is the dilution multiple).
[0129] (3) Determination of sophorolipid content in the fermentation liquid by the anthrone-sulfuric acid method
[0130] 500 μL of the fermentation broth taken on the 4th, 5th, 6th and 7th day of fermentation respectively, 1 mL of ethanol was added, and mixed uniformly by shaking, and centrifuged at 12000 r / min for 10 min. 20 μL of the supernatant was added to an 8 mL EP tube, and 980 μL of distilled water (diluted 50 times) was added. The total sugar content was determined by the anthrone-sulfuric acid method, the total sophorolipid content was the amount of total sugar minus the residual glucose amount in the fermentation broth, and the sophorolipid content was calculated according to the ratio between the molecular weights of sophorolipid and glucose, i.e. 1.91 g of sophorolipid was equivalent to 1 g of glucose, and the total sophorolipid content was calculated, and the results are shown in Table 1. Figure 5 As can be seen from Table 1, Figure 5 although the knockout of the MFO-2 gene and the overexpression of the pUGTB gene and the MRD-2 gene have no obvious effect on the yield of sophorolipid synthesized by Bombiella bombicola, S. bombicola ΔMFO-2 - pUGTB + MRD-2 + compared with the wild type S. bombicola The sophorolipid in the fermentation broth can reach the peak value faster, i.e. the time required for fermentation to generate an equal amount of sophorolipid is shorter, which is beneficial to shorten the fermentation time required in actual production, save energy consumption, and improve fermentation efficiency.
[0131] Example 1 uses one-step fusion PCR to fuse 5 DNA fragments
[0132] In the present application, one-step fusion PCR is used to fuse the 5 DNA fragments in Example 1, and the method for obtaining the 5 DNA fragments is the same as that in Example 1. The MFO-2-5', MFO-2-3', pUGTB, MRD-2 and gF-Hph-gR DNA fragments with homologous sequences are added to a 50 μL PCR reaction system in the same molar amount, the total DNA amount is 800 ng, a high-fidelity enzyme PrimeSTAR series is used to prepare the reaction system, primers MFO-2_5F and MFO-2_3R are added for fusion PCR reaction, the extension speed is 30 sec / Kb, the cycle number is 30, and the reaction system and reaction program are shown in Table 6.
[0133] Table 6 Reaction system and reaction program of one-step fusion PCR
[0134]
[0135] The fusion PCR product is purified using a DNA fragment purification kit, and the purified DNA fragment is detected by agarose gel electrophoresis and compared with the product obtained by two-step fusion PCR, and the results are shown in Table 2. Figure 6 As can be seen from Table 2, Figure 6It can be seen that the one-step fusion PCR method does not correctly fuse and extend multiple gene fragments, indicating that the efficiency of two-step fusion PCR is higher than that of one-step fusion PCR for the fusion of multiple gene fragments, especially when the fusion contains multiple long gene fragments (pUGTB, MRD, gF-Hph-gR).
[0136] Example 2: Two-step fusion PCR was used to fuse five DNA fragments at an extension speed of 5 sec / Kb
[0137] The two-step fusion PCR process was the same as in Example 1, except that the extension speed was 5 sec / Kb (45 sec), and the fusion PCR product was purified using a DNA fragment purification kit. The purified DNA fragments were detected by agarose gel electrophoresis and compared with the product obtained by two-step fusion PCR. The results are shown in Figure 6 Figure 6 It can be seen that the two-step fusion PCR using high-fidelity DNA polymerase at a conventional extension speed of 5 sec / Kb does not correctly fuse and extend multiple DNA fragments. In general, to ensure complete extension of the DNA fragments, the extension time may be appropriately extended, but it is usually only extended by a few seconds or tens of seconds. Because the extension time is too long, the specificity of amplification will decrease, so the extension time is not extended by more than 6 times as in the present application. Based on the fusion PCR method described in the present application, for the fusion of multiple gene fragments, especially when the fusion contains multiple long gene fragments, extending the extension time as described in the present application can ensure the correct fusion and extension of the gene DNA fragments.
[0138] Example 3: Electroporation of long double-stranded DNA (ds DNA) linear vector into M. melliferae
[0139] The preparation of yeast competent cells was the same as in Example 1. The electroporation of the ds DNA linear vector was as follows: 50 μL of the competent cell suspension was taken into a centrifuge tube, 4 μg of the ds DNA target vector was added, mixed well, and pre-cooled on ice for 5 min. The mixture was transferred to a 0.2 cm gap electroporation cup, placed on ice for 5 min, and then a 5 ms and 2.5 kV pulse was applied to the mixture using a MicroPulser. The electroporation cup was removed and 1 mL of pre-cooled sorbitol solution (1 M) was immediately added. After gentle mixing, the mixture was transferred to a 1.5 mL centrifuge tube and incubated at 30°C for 1 hour. 100 μL of the mixture solution was spread on YPD solid medium containing hygromycin, and incubated at 30°C for 5-7 days.
[0140] The results of electroporation of long double-stranded DNA (ds DNA) linear vector into M. melliferae are shown in Figure 7 As shown in Figure 7 The results show that no colony grew on the YPD plate transformed by the ds DNA linear target vector, and the vector failed to be successfully transformed into the genomic DNA of the yeast cells, indicating that the efficiency of transforming the linear DNA of about 9000 bp in size into the yeast cells was very low.
[0141] Example 3: Linear vector of long single-stranded DNA (ss DNA) electroporated into the yeast cells
[0142] The preparation of the yeast cell competent cells was the same as in Example 1, and the electroporation of the ss DNA linear vector was as follows: 50 μL of the competent cell suspension was taken into a centrifuge tube, 3 μg of the ss DNA target vector was added thereto, and mixed uniformly, and then pre-cooled on ice for 5 min; the mixture was transferred into an electroporation cup with a gap of 0.2 cm, and placed on ice for 5 min; the mixture was subjected to a pulse of 5 ms and 2.5 kV using a Micro Pulser; the electroporation cup was taken out immediately, and 1 mL of pre-cooled sorbitol solution (1 M) was added thereto, mixed gently, and then transferred into a 1.5 mL centrifuge tube, and placed at 30°C for 1 hour; 100 μL of the mixture was spread on a YPD medium containing hygromycin, and cultured at 30°C for 5-7 days. The results of the electroporation of the linear vector of long single-stranded DNA (ss DNA) into the yeast cells are shown in Table 3. Figure 7 As shown in Figure 7 The results show that the ds DNA was not successfully electroporated into the yeast cells even if it was only single-stranded.
[0143] The above examples are the preferred embodiments of the present application, but the embodiments of the present application are not limited by the above examples, and any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present application are equivalent replacement modes, and are all included in the protection scope of the present application.
Claims
1. A method for constructing a multi-gene modified yeast, characterized in that, The method comprises the following steps: S1. determining a gene to be knocked out and one or more genes to be overexpressed; taking the upstream homologous arm of the gene to be knocked out as a first DNA fragment, taking the downstream homologous arm of the gene to be knocked out as a last DNA fragment, and taking the one or more genes to be overexpressed as DNA fragments connected in sequence between the first DNA fragment and the last DNA fragment; The gene to be knocked out is an MFO-2 gene, the nucleotide sequence of which is shown in SEQ ID NO. 1; the nucleotide sequence of the upstream homologous arm MFO-2-5' of the MFO-2 gene is shown in SEQ ID NO. 2, and the nucleotide sequence of the downstream homologous arm MFO-2-3' of the MFO-2 gene is shown in SEQ ID NO. 3; the genes to be overexpressed are gF-Hph-gR, MRD-2 and pUGTB, the nucleotide sequence of the gF-Hph-gR gene is shown in SEQ ID NO. 4, the nucleotide sequence of the MRD-2 gene is shown in SEQ ID NO. 5, and the nucleotide sequence of the pUGTB gene is shown in SEQ ID NO. 6; S2. preparing all the DNA fragments described in S1, and connecting all the DNA fragments into a long double-stranded DNA target vector for multi-gene modification by two-step fusion PCR and nest PCR; the extension time in the reaction program of the two-step fusion PCR is calculated at an enzyme reaction rate of 30-60 sec / Kb; The connection sequence of all DNA fragments in the fusion PCR is MFO 2 gene upstream homologous arm + pUGTB gene + gF-Hph-gR gene + MRD 2 gene + MFO 2 gene downstream homologous arm; MFO-2-5', pUGTB, gF-Hph-gR, MRD-2 and MFO-2-3' are fused by homologous recombination in the fusion PCR; wherein MFO-2-5' and pUGTB are homologously recombined by using homologous sequences MF-U, pUGTB and gF-Hph-gR are homologously recombined by using homologous sequences U-H, gF-Hph-gR and MRD-2 are homologously recombined by using homologous sequences H-MR, and MRD-2 and MFO-2-3' are homologously recombined by using homologous sequences MR-MF; MF-U: CAAGAAGGGAAAGTGAAACCAGAGAGTGGGACCTGATTC; U-H: AGGTAGATAGATACACGTTTTTAGACGTGCATACATGCGAGT; H-MR: AGCGACGCACGATCCAATACATGGTGGATGATATACAGGTA; MR-MF: CATTTAGCGAGCCACAAGTGAACACCAAAGCCATTACTGC; S3. single-strandizing the long double-stranded DNA target vector obtained in S2 into a long single-stranded DNA target vector and transforming a yeast strain competent cell, and screening a positive transformant.
2. The method of claim 1, wherein S2, all the DNA fragments are prepared by artificial synthesis or PCR method; wherein, the primers for amplifying the upstream homologous arm of MFO-2 gene are MFO-2_5F and MFO-2_5R, and the sequences are shown in SEQ ID NO. 7-8 in sequence; the primers for amplifying the downstream homologous arm of MFO-2 gene are MFO-2_3F and MFO-2_3R, and the sequences are shown in SEQ ID NO. 9-10 in sequence; the primers for amplifying MRD-2 gene are MRD-2 oeF and MRD-2 oeR, and the sequences are shown in SEQ ID NO. 11-12 in sequence; the primers for amplifying pUGTB gene are pUGTB oeF and pUGTB oeR, and the sequences are shown in SEQ ID NO. 13-14 in sequence.
3. The method of claim 2, wherein In S2, the sequences of the primers used for nest PCR are shown in SEQ ID NO. 15-16 in sequence; the 5' end of the primer shown in SEQ ID NO. 16 is modified with a phosphate group.
4. The method of claim 1, wherein, The single-strandization of the long double-stranded DNA target vector obtained in S2 into long single-stranded DNA target vector in S3 comprises the following steps: S31. Adding DNA helicase A to the product obtained in S2 to recognize the 5' end of the chain modified by phosphorylation in the long double-stranded DNA target vector and initially digest the chain; S32. Adding DNA helicase B to the reaction solution of S31 to completely digest the 5' end of the chain modified by phosphorylation.
5. The method of claim 4, wherein, The reaction conditions of S31 and S32 are the same, and the reaction conditions are: 37℃ for 5-15 min, 80℃ for 5 min, and 4℃ for 10 min.
6. The use of the method of any one of claims 1-5 in constructing a multi-gene modified yeast strain.
7. A multi-genetically engineered yeast bacterium, characterized in that, The multi-gene modified yeast strain is obtained by modifying the Bombusia candida according to the method of any one of claims 1-5.
Citation Information
Patent Citations
Albumin fusion proteins
CN102816241A
Preparation method of genetically engineered bacterium for synthesizing glutathione and product thereof
CN104059936A