A serine protease inhibitor of teratocytes of Codonopsis plutellae and its application
By expressing the serine protease inhibitor CvT-SPN-bacteriostat gene in the abnormal cells of the plutella xylostella, the recombinant protein obtained can effectively inhibit the growth of pathogens, solving the problem that insect serpins are not used in antibacterial drugs in the existing technology, improving the efficiency of biological control and providing a basis for drug development.
Patent Information
- Application Number
- CN202311344705.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-10-17
- Publication Date
- 2025-09-16
- Estimated Expiration
- 2043-10-17
AI Technical Summary
Insect-derived serpins have not yet been used as antibacterial drugs in the prior art, and the efficiency of biological control of diamondback moth needs to be improved.
The serine protease inhibitor CvT-SPN-bacteriostat gene from the malformed cells of Cottontail plutella xylostella was cloned and expressed. The recombinant protein was obtained by prokaryotic expression and was shown to effectively inhibit the growth of Escherichia coli and Staphylococcus aureus.
This recombinant protein can significantly inhibit the growth of pathogens, protect the growth and development of parasitic wasp larvae in the body of the diamondback moth, improve the biological control efficiency of parasitic wasps, and provide a scientific basis for the development of antibacterial drugs and food preservatives.
Smart Images

Figure CN117551188B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of biomacromolecules, and in particular to a serine protease inhibitor of the teratocyte of Codonopsis plutellae and an application thereof. Background Art
[0002] Serine protease inhibitors (SPIs) are a class of inhibitors widely distributed in plants, animals, and microorganisms that act as regulators of serine protease activity. Based on sequence homology, the number of cysteine residues, and disulfide bonds within the molecule, SPIs can be divided into several families, including Kunitz, Kazal, Bowman-Birk, Serpin, and TIL (Trypsin Inhibitor Like Cysteine Rich Domain) families. Serpins, the largest family of SPIs, are found in nearly all life forms, including plants, animals, bacteria, and microorganisms. Serpins play key roles in numerous physiological and biochemical pathways, including inflammation, immune regulation, tumorigenesis, hemolymph coagulation, PPO activation, antimicrobial activity and cancer metastasis, sperm development, and regulation of glycolipid metabolism. Studies have reported promising applications for serpins in human metabolic diseases.
[0003] The diamondback moth (Plutella xylostella) is a significant pest of cruciferous crops, causing significant economic losses annually. Due to its robust reproductive capacity, wide host range, and strong adaptability to environmental factors, it is difficult to eradicate with conventional chemical pesticides and is prone to developing resistance. Therefore, biological control of the diamondback moth is particularly important.
[0004] The wasp Cotesia vestalis is a permissive parasitoid of the diamondback moth larvae. With its wide distribution and high parasitism rate, it is a dominant natural enemy of the diamondback moth and plays a crucial role in biological control. Teratocytes are a key parasitic factor in the Cotesia vestalis-diamondback moth (Plutella xylostella) parasitic system. Teratocytes are released from the embryonic serosa during egg hatching and dispersed into the host's hemolymph. Teratocytes secrete a variety of proteins, including serpins, that regulate the host's growth, development, immunity, and nutritional metabolism.
[0005] For example, patent application publication number CN107523572A discloses a CvT SPI gene, a serine protease inhibitor for the malformed cells of the diamondback moth, and its application. The nucleotide sequence of this gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by this gene is shown in SEQ ID NO.2. The recombinant protein obtained by in vitro prokaryotic expression of this gene can effectively inhibit the activation of prophenoloxidase in the hemolymph of its host, the diamondback moth, thereby inhibiting the melanization of the host hemolymph and weakening the host's immune response, providing a sequence reference for obtaining new transgenic insect-resistant crops. This recombinant protein can inhibit the activity of subtilisin A, trypsin, and porcine pancreatic elastase, which is of great significance for the development of serine protease inhibitor drugs. However, there are currently no reports of insect-derived serpins being used as antibacterial drugs. Summary of the Invention
[0006] In view of the deficiencies in the prior art, the present invention provides a CvT-SPN-bacteriostat, a serine protease inhibitor of the teratocytes of Cottontail plutella xylostella.
[0007] The present invention provides a CvT-SPN-bacteriostat, a serine protease inhibitor of Cottontail plutella xylostella teratocytes, the amino acid sequence of which is shown in SEQ ID No. 2.
[0008] The present invention also provides a gene encoding the CvT-SPN-bacteriostat, wherein the nucleotide sequence of the gene is shown in SEQ ID No. 1.
[0009] The present invention also provides a recombinant expression vector comprising the gene.
[0010] The present invention also provides a recombinant expression cell comprising the recombinant expression vector, wherein the host cell is Escherichia coli BL21.
[0011] The present invention also provides the use of the Cottonfly plutella xylostella teratocyte serine protease inhibitor CvT-SPN-bacteriostat in the preparation of serine protease inhibitors.
[0012] The present invention also provides the use of the CvT-SPN-bacteriostat, a serine protease inhibitor of the ectoderma plutellae, in the preparation of an antibacterial drug. The pathogenic bacteria targeted by the antibacterial drug are Escherichia coli or Staphylococcus aureus.
[0013] The present invention also provides the use of the Cottonfly plutella xanthophylla teratocyte serine protease inhibitor CvT-SPN-bacteriostat in the preparation of food preservatives.
[0014] Compared with the prior art, the present invention has the following beneficial effects:
[0015] 1. The sequence of the CvT-SPN-bacteriostat gene, a serine protease inhibitor for teratocytes of the plutella plutellae, was compared with gene databases and no identical genes were found. The amino acid sequence encoded by the CvT-SPN-bacteriostat gene, a serine protease inhibitor for teratocytes of the plutella plutellae, was compared with protein databases and no identical proteins were found.
[0016] 2. The present invention extracts total RNA from Cottonella plutellae, obtains cDNA as a template through reverse transcription, constructs a cDNA library, obtains transcriptomes of Cottonella plutellae and malformed cells through sequencing, screens EST sequence tags expressing specific serine protease inhibitors in malformed cells, and obtains the full-length cDNA sequence of CvT-SPN-bacteriostat by RACE. After obtaining the cDNA nucleotide sequence of CvT-SPN-bacteriostat, protein expression is induced using a prokaryotic expression method. Using a GST-tag, a large amount of soluble CvT-SPN-bacteriostat recombinant protein can be obtained in a relatively short period of time, which facilitates the activity experiment of CvT-SPN-bacteriostat.
[0017] 3. The present invention cloned the cDNA sequence of the CvT-SPN-bacteriostat gene, a serine protease inhibitor from the diamondback moth. Comparison of the amino acid sequence encoded by the gene showed that CvT-SPN-bacteriostat contains a serpin domain. The recombinant protein obtained by in vitro prokaryotic expression of the CvT-SPN-bacteriostat gene, a serine protease inhibitor from the diamondback moth, can effectively inhibit the growth of pathogenic bacteria Escherichia coli and Staphylococcus aureus, protecting the larvae in the host from infection by pathogens, thereby facilitating the growth and development of parasitic wasp larvae in the diamondback moth. This provides a scientific basis for improving the biological control efficiency of parasitic wasps and for the development of food preservatives and antibacterial drugs. At the same time, the recombinant protein can inhibit the activity of Bacillus subtilis protease and trypsin, and has important reference value for the development of new serpin inhibitor drugs. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 This is the result of gene coding sequence verification of the serine protease inhibitor CvT-SPN-bacteriostat in the teratocytes of Cottontail plutella xylostella.
[0019] Figure 2 This is a multiple sequence alignment analysis of the reactive center site (RCL) amino acid sequence of the teratocyst serine protease inhibitor CvT-SPN-bacteriostat from Cottonfly plutella xylostella and other species with known functions. The conserved serpin amino acid sequence of CvT-SPN-bacteriostat is underlined; the amino acid at the P1 position is arginine (Arg).
[0020] Figure 3 This electrophoresis shows the protein electrophoresis results from the prokaryotic expression and purification of the serine protease inhibitor CvT-SPN-bacteriostat gene from the teratocytes of Cottontail plutellae. Lanes 1-5 represent: protein samples without IPTG; protein samples induced with a final concentration of 0.5 mM IPTG; soluble protein samples induced with a final concentration of 0.5 mM IPTG and then sonicated; inclusion body protein samples induced with a final concentration of 0.5 mM IPTG and then sonicated; and purified and concentrated protein samples. Lane M represents a protein marker.
[0021] Figure 4 This figure shows the inhibitory effect of the recombinant protein expressed in prokaryotic cells from the CvT-SPN-bacteriostat gene, a serine protease inhibitor from the ectoderma of the plutella xylostella, on trypsin and subtilisin. GST was used as a negative control.
[0022] Figure 5 This figure shows the growth inhibition test results of the pathogenic bacteria Escherichia coli by adding 100 ng / μL of the recombinant protein obtained by prokaryotic expression of the serine protease inhibitor CvT-SPN-bacteriostat gene from the abnormal cells of Cottontail plutella xylostella; the blank control was an equal volume of PBS, the negative control was an equal amount of GST, and the positive control was 1 mg / ml ampicillin.
[0023] Figure 6 This figure shows the growth inhibition test results of the pathogen Staphylococcus aureus by adding 100 ng / μL of the recombinant protein obtained by prokaryotic expression of the serine protease inhibitor CvT-SPN-bacteriostat gene from the malformed cells of Cottontail plutella xylostella; the blank control was an equal volume of PBS, the negative control was an equal amount of GST, and the positive control was 1 mg / ml ampicillin. DETAILED DESCRIPTION
[0024] The invention discloses a CvT-SPN-bacteriostat gene, a serine protease inhibitor of Cottontail plutellae, which has an open reading frame (ORF) of 1011 bp, a sequence of which is shown in SEQ ID NO.1, and encodes a protein composed of 336 amino acids, the amino acid sequence of which is shown in SEQ ID NO.2.
[0025] The present invention provides a method for cloning the cDNA of the CvT-SPN-bacteriostat gene of the teratocystis wasp. plutellae by reverse transcribing the total RNA of the wasp. plutellae to obtain a cDNA library, combining the genome and transcriptome of the wasp. plutellae to screen for sequences containing a serpin domain, and then amplifying the full-length gene by RACE.
[0026] The expression vector of the recombinant protein of the teratocyte serine protease inhibitor CvT-SPN-bacteriostat of the plutella plutellae in the present invention is PGEX-6P-1. The present invention also provides an expression strain Escherichia coli BL21 containing the expression vector PGEX-6P-1 of the teratocyte serine protease inhibitor CvT-SPN-bacteriostat gene of the plutella plutellae.
[0027] The present invention further provides a method for preparing the recombinant protein. The present invention provides a method for preparing a recombinant protein of the CvT-SPN-bacteriostat gene, a serine protease inhibitor of the abnormal cells of the Cottonfly plutella. The process includes: connecting the sequence between positions 1 to 1011 of the CvT-SPN-bacteriostat gene, a serine protease inhibitor of the abnormal cells of the Cottonfly plutella. PGEX-6P-1 to obtain a recombinant expression plasmid, inducing expression using an Escherichia coli BL21 prokaryotic expression system, purifying the soluble recombinant protein obtained by ultrasonic lysis using a GST purification column, and then using an ultrafiltration centrifuge tube to replace the solution and concentrate to obtain an aqueous solution of the CvT-SPN-bacteriostat protein.
[0028] The present invention further provides a use of the obtained serine protease inhibitor CvT-SPN-bacteriostat gene: for preparing a serine protease inhibitor protein from the teratocyte of the diamondback moth, which can effectively inhibit the growth of pathogenic bacteria Escherichia coli and Staphylococcus aureus that invade the host diamondback moth. The protease inhibitor has potential application value in controlling pests and developing antibacterial drugs and food preservatives.
[0029] The recombinant protein obtained in vitro from the serine protease inhibitor CvT-SPN-bacteriostat gene of the present invention can effectively inhibit the activities of trypsin and subtilisin, providing sequence support for the development of protease inhibitor drugs.
[0030] Example 1
[0031] cDNA cloning and sequence analysis of the CvT-SPN-bacteriostat gene encoding the serine protease inhibitor in the teratocytes of Cottontail plutella xylostella.
[0032] 1.1 Collection of abnormal cells
[0033] The diamondback moth (Plutella xylostella) and the diamondback wasp (Cotesiavestalis) used in the present invention were collected from a vegetable field in the suburbs of Hangzhou on February 20, 2012, and the population was maintained in the laboratory. During the experimental study, the individual breeding method was used to obtain the parasitized diamondback moth. Five mated female wasps were blown into a finger-shaped tube, and then the finger-shaped tube was turned upside down on the table. A diamondback moth larva in the middle of the third instar was placed in the finger-shaped tube. After the parasitic wasp parasitized the diamondback moth, the host was immediately removed from the finger-shaped tube with a brush, and another diamondback moth was replaced and the process was repeated. The parasitized diamondback moth larvae were returned to the incubator for culture and used for subsequent experiments. 100 diamondback moths that were parasitized for 7 days were taken, the surface of the insect body was washed with 75% ethanol, and then the moisture on the surface of the insect body was absorbed with filter paper for standby use. In a 1×PBS and insect cell culture medium (volume ratio of 1:1), use tweezers to tear the insect body from head to tail, being careful not to tear the midgut, allowing the larvae to enter the culture dish, and allowing the hemolymph of the diamondback moth to flow out as much as possible. After the dissection, let the PBS-culture medium-hemolymph mixture stand for 20 minutes to allow the blood cells to adhere to the wall and avoid blood cell contamination. Shake the culture dish evenly to allow the abnormal cells to aggregate, and use a pipette tip to aspirate the abnormal cells. Use a 10μl pipette tip to aspirate the abnormal cells into a culture dish containing new culture medium, and repeat the washing three times. Finally, place the collected abnormal cells on a grinder and grind them.
[0034] 1.2 TRIzol method for total RNA extraction
[0035] (1) Add 1 ml of TRIzol to the abnormal cells and homogenize them thoroughly. Let them stand at room temperature for 5 minutes to allow them to fully lyse.
[0036] (2) Add 200 μl of chloroform, shake gently for 15 seconds, and let stand at room temperature for 2 minutes.
[0037] (3) Centrifuge at 4°C, 12,000 g, for 15 min. Clear liquid stratification is visible. Carefully aspirate the upper layer of liquid into a new sterilized 1.5 ml centrifuge tube.
[0038] (4) Add 500 μl of isopropanol, gently mix the liquid in the centrifuge tube, and let it stand at room temperature for 10 minutes;
[0039] (5) Centrifuge at 12,000 g for 10 min at 4°C and discard the supernatant. A small piece of translucent white solid will be visible at the bottom of the centrifuge tube, which is the total RNA.
[0040] (6) Add 1 ml of 75% ethanol, gently wash the precipitate, centrifuge at 7500 g for 5 min at 4°C, and discard the supernatant;
[0041] (7) Dry at room temperature or vacuum dry for 6-7 minutes, add 20-30 μl DEPC water to dissolve the RNA sample, and measure the OD value to quantify the RNA concentration (this method extracts RNA A 260 / A 280 The next test can be carried out only when the value is between 1.8 and 2.0).
[0042] 1.3 Construction of long-fragment cDNA library (for common PCR experiments)
[0043] (1) Prepare the following pre-reaction solution in a sterilized PCR tube: 1 μg of total RNA, 1 μl of Oligo(dT)20, 1 μl of 10 mM dNTP Mix, and add an appropriate amount of DEPC water to make up the total volume to 13 μl.
[0044] (2) After the mixture was denatured at 65°C for 5 min, it was immediately cooled on ice for 1 min.
[0045] (3) Quickly prepare the reaction solution and add the following reagents to the pre-reaction solution in order: 4 μl First Strand Buffer, 1 μl 0.1 M DTT, 1 μl RNaseOUT™, and 1 μl SuperScript™ III RT.
[0046] (4) The above reaction system was gently mixed, reacted at 50°C for 60 min, and then at 70°C for 15 min. After the reaction, it was stored in a -20°C refrigerator for later use.
[0047] 1.4 PCR reaction
[0048] (1) Prepare the following pre-reaction solution in a sterilized PCR tube: 10 μl 2×KOD One™ PCR MasterMix, 0.6 μl upstream primer, 0.6 μl downstream primer, 0.2 μl long fragment cDNA template, and 8.6 μl double-distilled water.
[0049] Upstream primer CvT-SPN-bacteriostat-F: CTGACATCTTCGACTTAGATGGAT,
[0050] Downstream primer CvT-SPN-bacteriostat-R: TTATGTTTCTATGGGATTATACAC.
[0051] (2) The above reaction system was gently mixed, and then the following PCR reaction was performed: one cycle of pre-denaturation at 98°C for 5 seconds; 35 cycles of denaturation at 98°C for 10 seconds, annealing at 58°C for 5 seconds, and extension at 68°C for 10 seconds; one cycle of tail extension at 72°C for 2 minutes, and finally cooling to 12°C.
[0052] (3) After the reaction is terminated at 12°C, the PCR reaction product should be promptly removed and tested on a gel or stored at -4°C.
[0053] 1.5 Agarose gel electrophoresis and recovery of target gene fragments
[0054] (1) Prepare 1.2% agarose gel and place it in an electrophoresis tank. Take 3-5 μl of sample and mix it with 6× gel loading buffer and then load it into the electrophoresis well. The electrophoresis buffer is 1×TAE, the voltage is 140V, and the electrophoresis time is 25-30 minutes (which can be adjusted appropriately according to the fragment size). After electrophoresis, observe the results in a UV-fluorescence instrument and take pictures to obtain the following: Figure 1 The strips shown.
[0055] (2) The DNA gel containing the target fragment was cut out under ultraviolet light, and the target nucleic acid fragment was recovered using the SPN-bacteriostat FastPureGel DNA Extraction Mini Kit (Vazyme).
[0056] 1.6TA connection and transformation.
[0057] (1) Use pGEM-T easy vector (Promega, USA) for ligation reaction. Prepare the following reaction solution in a 200 μl centrifuge tube (specific method depends on the kit used): 1 μl pGEM-T easy vector, 1 μl T4 DNA ligase, 3 μl insert DNA, 5 μl 2× Rapid Ligation buffer, and incubate in a PCR instrument at 4°C for 12 h.
[0058] (2) Heat shock method for transformation. Take out the competent E. coli and place it on ice. When the competent E. coli just begins to dissolve, add 10 μl of the plasmid or ligation product to 100 μl of the competent E. coli, flick to mix, and place on ice for 15 minutes; then heat shock in a 42°C water bath for 45-60 seconds, then immediately place on ice, place on ice for 5-10 minutes, add 600 μl of LB liquid culture medium that has been preheated to 37°C and does not contain antibiotics; incubate on a shaker at 37°C for 45-60 minutes for activation, take 100 μl and spread it on the LB solid plate culture medium containing the corresponding antibiotics, and incubate at 37°C for 10-12 hours until colonies appear.
[0059] (3) Use 2×TSINGKE Master Mix (red) to test the bacterial solution to determine whether the ligation reaction is successful. Prepare the following reaction in a PCR tube: 10 μl 2×TSINGKE Master Mix, 0.2 μl forward primer, and 0.2 μl reverse primer, and then perform the PCR reaction.
[0060] (4) The expected size band was cut out and sent to a sequencing company for first-generation sequencing. The sequencing results were consistent with the sequence of the 1011 bp CvT-SPN-bacteriostat gene open reading frame (ORF) shown in SEQ ID NO.1.
[0061] (5) Promega Plus SV Minipreps DNA Purification System Kit was used to extract the mini-plasmid, and the obtained plasmid was stored in a -20℃ refrigerator for future use.
[0062] 1.7 Sequence analysis of the CvT-SPN-bacteriostat gene
[0063] (1) After cloning the ORF of the target CvT-SPN-bacteriostat gene, the open reading frame ORF base sequence was translated into an amino acid sequence using Editseq software, and the number of amino acid residues and molecular mass were calculated.
[0064] (2) The reactive center site (RCL) and P1 site of CvT-SPN-bacteriostat were predicted in the MEROPS peptide database (https: / / www.ebi.ac.uk / merops / ). The RCL sequence of CvT-serpin was compared with the sequences reported in other species using MEGA software. The results are as follows: Figure 2As shown, the amino acid sequence of its reaction center loop is: EVGSQAAAVTAARLSLRFNVE, and the amino acid at the P1 site is arginine (Arg). Existing studies have shown that when the P1 site is Arg, the serpin can inhibit the activity of trypsin, thrombin, coagulation factor Xa (Factor Xa), tissue plasminogen activator (tPA) and urokinase plasminogen activator (uPA), providing a reference for the subsequent detection of the inhibitory activity of the recombinant protein of the CvT-SPN-bacteriostat gene.
[0065] Example 2
[0066] Prokaryotic expression and purification of the CvT-SPN-bacteriostat gene, a serine protease inhibitor from the teratocytes of Cottontail plutella xylostella.
[0067] 2.1 Construction of prokaryotic expression vector and protein expression of CvT-SPN-bacteriostat
[0068] (1) Primers were designed based on the open reading frame of the obtained CvT-SPN-bacteriostat sequence. The forward and reverse primers contained sequences with BamH I and Xho I restriction sites, respectively. The primer sequences are as follows:
[0069] CvT-SPN-bacteriostatF-BamHI:CAGGGGCCCCTGGGATCCATGCTTTATTTTGGAGCAAGAG,
[0070] CvT-SPN-bacteriostatR-XhoI:ACGATGCGGCCGCTCGAGTTATGTTTCTATGGGATTATACACTTG,
[0071] Using the above-mentioned CvT-SPN-bacteriostat plasmid as a template, PCR amplification was performed using 20 μl of KOD One enzyme system. The amplified PCR product was subjected to agarose gel electrophoresis. After electrophoresis, the results were observed in a UV analyzer and photographed. After the target band was observed, the target band was cut out and DNA gel recovery was performed.
[0072] (2) Prepare 50 μl of double enzyme digestion system according to the following volume to prepare the linearized expression vector: add 5 μl of 10× Cutsmart Buffer, 0.5 μl of each restriction endonuclease, 1 μg of PGEX-6P-1 prokaryotic expression vector, and finally add ddH2O to make up to 50 μl.
[0073] (3) Mix thoroughly by blowing gently with a pipette and incubate in a 37°C water bath for 1-2 hours to complete the enzyme digestion reaction.
[0074] (4) The linearized specific vector plasmid after the enzyme digestion reaction is subjected to gel fragment excision and recovery.
[0075] (5) Insert the target fragment into a specific vector using homologous recombination. Use the ClonExpress UltraOne Step Cloning Kit (Vazyme) and prepare the following experimental system: 5 μl 2× ClonExpress Mix, 100 ng linearized vector, 40.5 ng target gene fragment containing the vector nucleic acid fragment, and finally add ddH2O to make up the system to 10 μl. Mix thoroughly by gently pipetting, then react at 50°C for 5-15 minutes. After the reaction is complete, place the mixture on ice to complete the homologous recombination ligation.
[0076] (6) The ligation product was transformed into a competent medium and spread on a solid LB culture plate containing antibiotics. The culture was incubated at 37°C overnight. A single plaque was picked and shake-cultured. The universal primers pGEX5′ primer (GGGCTGGCAAGCCACGTTTGGTG) and pGEX3′ primer (CCGGGAGCTGCATGTGTCAGAGG) were used to detect the bacterial solution according to the method of 1.4 in Example 1. The positive clones were selected and sequenced. After confirmation, the sequence obtained was consistent with the target series SEQ ID No. 2, and the bacterial solution was stored for future use.
[0077] (7) The above-preserved bacterial liquid was expanded and cultured in a 50 ml conical flask for plasmid extraction.
[0078] (8) Take 1 μl of the recombinant plasmid diluted 10 times and transform it into the competent strain of Escherichia coli BL21 (DE3). Spread it on an LB medium plate containing ampicillin resistance and culture it at 37°C overnight. Perform bacterial liquid detection and select positive clones.
[0079] (9) Take 2 μl of the above-mentioned positive clone strain and add it to a 50 ml conical flask containing 15 ml of LB liquid medium containing antibiotics. Activate it overnight on a shaker at 37°C at 180 rpm. Then, expand the culture to about 100 ml in a 250 ml conical flask at a ratio of 1:100 with LB liquid medium containing antibiotics. Incubate it on a shaker at 37°C at 250 rpm for about 3 h until it reaches the logarithmic phase with an OD value of 0.6 to 0.8.
[0080] (10) Take three 15 ml sterile culture flasks and add 5 ml of logarithmic phase bacterial solution to each flask. Add 5 μl of 0 M, 0.5 M, and 1.0 M IPTG to make the final concentrations of IPTG 0 mM, 0.5 mM, and 1.0 mM, respectively.
[0081] (11) Place the above culture flask in a 16°C shaker at 100 rpm and culture overnight to induce protein expression.
[0082] (12) The bacterial liquid in the culture bottle was collected by centrifugation, and the obtained bacterial mass was washed with PBS and then Protein Extraction Reagent (Merck) was used for lysis, 100 μl of supernatant was added into 25 μl of 5× protein loading buffer, mixed, and then boiled in boiling water for 5 min. After centrifugation at 14,000 rpm, the supernatant was obtained as the analysis sample.
[0083] (13) The protein expression of the induced bacterial solution was detected by SDS-PAGE gel scanning and photographing. CvT-SPN-bacteriostat was expressed in large quantities in the supernatant under the conditions of 0.5 mM IPTG concentration, 16°C, and 100 rpm. These conditions were subsequently selected for the expansion and large-scale expression of CvT-SPN-bacteriostat.
[0084] 2.2 Purification of the prokaryotic expressed protein of the CvT-SPN-bacteriostat gene, a serine protease inhibitor from the teratocystis of Cottontail plutella xylostella
[0085] (1) According to Sepharose TM Protein was purified from the induced E. coli expressing CvT-SPN-bacteriostat using the 4Fast Flow (GE Healthcare) method. Specific steps were performed according to the kit instructions.
[0086] (2) The purified protein was concentrated and desalted using a 10 kDa ultrafiltration centrifuge tube, and then aliquoted and stored at -80 °C for later use.
[0087] (3) The results of the purified protein CvT-SPN-bacteriostat were detected by SDS-PAGE gel. Figure 3 As shown, the results showed that: as shown in lane 1, under the conditions of culture in a shaker at 16°C and 100 rpm, CvT-SPN-bacteriostat was not expressed when no inducer was added; as shown in lanes 2, 3, and 4, under the conditions of culture in a shaker at 16°C and 100 rpm, soluble protein samples could be obtained by adding IPTG at a final concentration of 0.5 mM; as shown in lane 5, the protein expression and purification method of this experiment could quickly obtain a large amount of soluble CvT-SPN-bacteriostat protein samples with high purity in a short time.
[0088] Example 3
[0089] Activity detection of the prokaryotic expression recombinant protein of the teratocyst serine protease inhibitor CvT-SPN-bacteriostat gene of Cottontail plutella xylostella.
[0090] 3.1 Inhibitory activity of the prokaryotically expressed recombinant protein of the CvT-SPN-bacteriostat gene, a serine protease inhibitor from the ectoderma plutellae, against commercial serine proteases
[0091] The proteases detected in this experiment were Bacillus licheniformis subtilisin A (Sigma) and bovine pancreatic trypsin (Sigma), and their corresponding substrates were Z-Gly-Gly-Leu p-nitroanilide (Sigma C3022) and Nα-Benzoyl-L-arginine 4-nitroanilide hydrochloride (Sigma B-3133), respectively. Different volumes of CvT-SPN-bacteriostat (2.0 mg / ml) recombinant protein were added to 50 mM Tris-HCl (50 mM NaCl, pH = 8.0) buffer. GST with the same concentration gradient as CvT-SPN-bacteriostat was used as a negative control. The same volume of PBS as CvT-SPN-bacteriostat was used as a blank control to achieve a molar ratio of CvT-SPN-bacteriostat or GST to protease of 0-3.0. The reaction was carried out at room temperature for 15 minutes. 1 mM chromogenic substrate was added to initiate the reaction. The reaction was continued at room temperature for another 10 minutes, and the OD was measured using a microplate reader (Thermo Fisher Scientific, USA). 405nm Measure every 5 minutes for 30 minutes. Residual enzyme activity percentage / % = 1-(1-Ai / A0) x 100% (Ai and A0 represent the absorbance values with and without the addition of recombinant protein, respectively). Each reaction was repeated three times, and a dose-dependent residual enzyme activity curve for the CvT-SPN-bacteriostat recombinant protein was plotted.
[0092] The test results are as follows Figure 4As shown, the negative control, GST, had no inhibitory effect on either serine protease. However, as the molar ratio of the recombinant serine protease inhibitor CvT-SPN-bacteriostat to the corresponding protease increased, the residual enzyme activity of subtilisin decreased. When the molar ratio of CvT-SPN-bacteriostat to subtilisin reached 3:1, the activity of subtilisin was inhibited by 71.4%. A 0.5-fold increase in the amount of CvT-SPN-bacteriostat produced a 33.4% inhibitory efficiency against trypsin. These results demonstrate that the recombinant serine protease inhibitor CvT-SPN-bacteriostat has potent inhibitory effects on subtilisin and trypsin. Subtilisin is a protease secreted by the Gram-positive bacterium Bacillus subtilis. Trypsin and chymotrypsin are both important digestive enzymes in insects and key serine proteases regulating human metabolism. Therefore, this recombinant serine protease inhibitor has potential application as a pest control agent and a human antibacterial and metabolic regulator.
[0093] 3.2 Inhibitory effect of the recombinant protein obtained by prokaryotic expression of the CvT-SPN-bacteriostat gene, a serine protease inhibitor of the ectoderma of Coleus plutellae, on the growth of pathogenic bacteria Escherichia coli and Staphylococcus aureus
[0094] (1) Gram-negative Escherichia coli and Gram-positive Staphylococcus aureus were shaken to the logarithmic phase using LB medium, and then diluted with fresh medium to OD 600 The diluted bacterial solution was divided into 96-well microtiter plates and purified CvT-SPN-bacteriostat protein was added to a final concentration of 100 ng / μL. 1 mg / ml ampicillin was added as a positive control, 1 mg / ml GST was added as a negative control, and sterile PBS buffer was added as a blank control. The 96-well microtiter plate was placed in a microtiter plate reader, the temperature was set to 37°C, and the OD was measured every 10 minutes. 600 , continuous measurement for 480 min, and each reaction was repeated 3 times.
[0095] (2) Specific experimental results are as follows Figure 5 and 6 The results showed that compared with the negative control, the growth of Escherichia coli and Staphylococcus aureus was significantly inhibited after adding the recombinant serine protease inhibitor CvT-SPN-bacteriostat. 600After 480 minutes of co-incubation with CvT-SPN-bacteriostat, the values decreased by 20.3% and 46.5%, respectively. The inhibitory effect of parasitic wasps on exogenous pathogens is beneficial to the growth and development of parasitic wasp larvae in the diamondback moth, providing a sequence reference for improving the biological control efficiency of parasitic wasps and obtaining new transgenic antibacterial crops. At the same time, Escherichia coli and Staphylococcus aureus are pathogenic bacteria for humans and various animals. Excessive levels of Escherichia coli in food and drinking water can cause gastrointestinal infections or urinary tract infections and other local tissue and organ infections. Staphylococcus aureus is a common foodborne pathogen that is widely present in the natural environment. Under appropriate conditions, it can produce enterotoxins, causing food poisoning and seriously affecting human health. The serine protease inhibitor CvT-SPN-bacteriostat in the present invention can provide a sequence reference and experimental basis for the development of human antibacterial drugs and food antibacterial agents.
Claims
1. CvT-SPN-bacteriostat, a serine protease inhibitor of the teratocytes of Cottontail plutella xylostella, the amino acid sequence of which is shown in SEQ ID No.
2.
2. A gene encoding the CvT-SPN-bacteriostat, a serine protease inhibitor of the teratocytes of Cottontail plutella xylostella according to claim 1.
3. The gene according to claim 2, characterized in that The nucleotide sequence is shown in SEQ ID No.
1.
4. A recombinant expression vector comprising the gene according to claim 2.
5. A recombinant expression cell comprising the recombinant expression vector according to claim 4, wherein: The host cell was Escherichia coli BL21.
6. Use of the CvT-SPN-bacteriostat, a serine protease inhibitor of Cotesia plutellae, according to claim 1, in biological control of Plutella xylostella.
7. Use of the CvT-SPN-bacteriostat, a serine protease inhibitor of the teratocytes of Cottontail plutellae, according to claim 1, in the preparation of antibacterial drugs; The pathogenic bacteria targeted by the antibacterial drug are Escherichia coli or Staphylococcus aureus.
8. Use of the CvT-SPN-bacteriostat, a serine protease inhibitor of Cottontail plutellae, according to claim 1, in the preparation of a food preservative.
Citation Information
Patent Citations
Cotesia vestalis serine protease inhibitor (CvT-SERPIN) gene and encoded protein thereof
CN105821050A
Cotesia plutellae teratocyte serine protease inhibitor CvT-SPI gene and application
CN107523572A