Molecular markers of programmed cell death in penaeus vannamei and applications thereof
By screening for SNP molecular markers A, B, C, and D in the programmed cell death protein gene of Litopenaeus vannamei, high efficiency and accuracy in disease-resistant breeding of Litopenaeus vannamei were achieved, solving the problem of disease-resistant breeding in existing technologies, improving disease resistance and reducing the use of antibiotics.
Patent Information
- Application Number
- CN202311621943.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-11-30
- Publication Date
- 2026-04-17
- Estimated Expiration
- 2043-11-30
AI Technical Summary
The lack of molecular markers related to resistance to Vibrio parahaemolyticus in Litopenaeus vannamei in existing technologies makes it difficult to carry out disease-resistant breeding effectively, and the misuse and abuse of antibiotics leads to the spread of drug-resistant strains.
Single nucleotide polymorphism (SNP) molecular markers A, B, C, and D in the programmed cell death protein 6-like gene of Litopenaeus vannamei were screened, and genotypes were determined by PCR amplification and sequencing. Individuals with AA, AA, TT, and GG genotypes were selected as reserve parents for breeding.
This study provides SNP molecular markers closely related to the resistance to Vibrio parahaemolyticus in Litopenaeus vannamei, improving the efficiency and accuracy of breeding. The selected individuals have stable genotypes, better disease resistance, and reduced antibiotic use.
Smart Images

Figure CN117568490B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of breeding technology for Litopenaeus vannamei, specifically relating to a molecular marker for programmed cell death protein in Litopenaeus vannamei and its application. Background Technology
[0002] South American white shrimp ( Litopenaeus Vannamei Litopenaeus vannamei, also known as white shrimp, is a farmed shrimp species in my country with high economic and nutritional value. Due to its thin shell, plump body, warm nature, and sweet taste, it is believed to have kidney-tonifying and aphrodisiac effects, making it very popular. However, in recent years, bacterial diseases have frequently broken out in Litopenaeus vannamei farming, causing serious economic losses. Furthermore, insufficient disease control technology has led to the misuse and abuse of antibiotics and the spread of drug-resistant strains, among other negative consequences. Vibrio infection, caused by Vibrio parahaemolyticus, is the most common and damaging bacterial disease in Litopenaeus vannamei farming.
[0003] Programmed death proteins, as pro-apoptotic factors, can also inhibit protein translation. Along with hemocyanin, chitinase, and heat shock protein 90, they play important roles in the immunity, O2 transport, energy metabolism, molting, and stress response of Litopenaeus vannamei. Therefore, programmed death proteins are very likely to become biomarkers for studying the ability of Litopenaeus vannamei to resist Vibrio parahaemolyticus.
[0004] With the development of molecular biology and genotyping technologies, molecular marker technology based on trait-related functional genes has become one of the key technologies in aquatic genetic breeding. Single nucleotide polymorphisms (SNPs) refer to DNA sequence polymorphisms caused by variations in a single nucleotide at the genomic level. SNPs have advantages such as large numbers, wide distribution, strong representativeness, good genetic stability, and ease of high-throughput and highly automated detection and analysis. In the breeding of Litopenaeus vannamei, SNP markers have been applied, and molecular markers related to ammonia nitrogen tolerance, nitrate tolerance, and growth traits have been reported. However, SNP markers related to resistance to Vibrio parahaemolyticus are rarely reported. Summary of the Invention
[0005] To address the aforementioned shortcomings, this invention discloses a molecular marker for programmed cell death protein in Litopenaeus vannamei and its application. Based on screening the programmed cell death protein 6-like gene of Litopenaeus vannamei, relevant SNP molecular markers are obtained. These SNP molecular markers are used as functional markers for the resistance of Litopenaeus vannamei to Vibrio parahaemolyticus and are applied to disease-resistant breeding of Litopenaeus vannamei.
[0006] This invention is achieved using the following technical solution:
[0007] A molecular marker for programmed cell death protein in Litopenaeus vannamei, comprising molecular marker A, molecular marker B, molecular marker C, and molecular marker D;
[0008] The molecular marker A is located at the 4689 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, denoted as D.4689 G>A. The base at this site is G or A, and the mutation type is G / G homozygous, A / G heterozygous, or A / A homozygous.
[0009] The molecular marker B is located at the 4698 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, denoted as D.4698 T>A. The base at this site is T or A, and the mutation type is T / T homozygous, T / A heterozygous, or A / A homozygous.
[0010] The molecular marker C is located at the 4742 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, denoted as D.4742 T>G. The base at this site is T or G, and the mutation type is T / T homozygous or T / G heterozygous.
[0011] The molecular marker D is located at the 4756 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, denoted as D.4756 G>T. The base at this site is G or T, and the mutation type is G / G homozygous, G / T heterozygous, or T / T homozygous.
[0012] The nucleotide sequence described in Sequence Listing 1 is the nucleotide sequence of the gene Programmed cell death protein 6-like.
[0013] The application of the above-mentioned molecular markers for programmed cell death proteins in Litopenaeus vannamei involves using molecular markers A, B, C, and D for selective breeding of Litopenaeus vannamei. Specifically, genomic DNA is extracted from the muscle tissue of the Litopenaeus vannamei to be tested, and then used as template DNA for PCR amplification and purification of the PCR amplification products. The obtained products are then sequenced to determine the genotypes of molecular markers A, B, C, and D.
[0014] When the genotype of molecular marker A is AA, that individual is selected as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker B is AA, that individual is selected as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker C is TT, that individual is selected as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker D is GG, that individual is selected as a backup parent for breeding Litopenaeus vannamei.
[0015] In the above PCR amplification and PCR product purification process, the primer set used to detect molecular markers of programmed cell death proteins in Litopenaeus vannamei includes primer F and primer R.
[0016] The sequence of primer F is: GAATGTTTGACAAAAAAGGCTCCG (Sequence 2 in the sequence listing);
[0017] The sequence of primer R is ATGGAGGACAATACAGCACTGAA (sequence 3 in the sequence listing).
[0018] The PCR amplification system consists of the following components: 2.0 μL of 10×Taq buffer, 0.4 μL of dNTPs (10 mmol / L each), 0.2 μL of Taq DNA polymerase (5 U / μL), 0.5 μL of primer F, 0.5 μL of primer R, 14.4 μL of ddH2O, and 2.0 μL of template DNA.
[0019] The PCR amplification reaction procedure includes the following steps:
[0020] S1. Pre-denaturate at 95℃ for 5 min;
[0021] S2. Perform 34 cycles of denaturation at 95℃ for 30s, annealing at 60℃ for 30s, and extension at 72℃ for 30s.
[0022] S3, extend at 72℃ for 5 minutes.
[0023] Compared with existing technologies, this technical solution has the following advantages:
[0024] This invention provides SNP molecular markers closely related to the Vibrio parahaemolyticus (VPS) resistance trait in Litopenaeus vannamei (SPV), which can be applied to the breeding of new VPS varieties resistant to VPS, thus promoting research and application in disease-resistant aquaculture of SPV. Using the method of this invention to breed VPS resistant to VPS results in individuals with stable genotypes and no genetic differentiation, and the breeding efficiency and accuracy are high, providing a solid foundation for research on the aquaculture and improvement of SPV. Attached Figure Description
[0025] Figure 1 This is the chi-square test result of the SNP site gene and genotype frequency of the programmed death protein described in this invention. Implementation
[0026] The present invention is further illustrated by the following examples, but these are not intended to limit the invention. Specific experimental conditions and methods not specified in the following examples are generally conventional methods well known to those skilled in the art.
[0027] Example: The screening process for molecular markers of programmed cell death proteins in Litopenaeus vannamei described in this invention is as follows:
[0028] (1) 245 whiteleg shrimp weighing approximately 20 grams were selected and temporarily held for 5 days. Then, each whiteleg shrimp was injected with a concentration of 7×10 6 100 μL of Vibrio parahaemolyticus cfu / mL was administered. To exclude deaths caused by injection, deaths were recorded starting 6 hours after the challenge. Sixty Pacific white shrimp that died first and 60 that survived 96 hours later were selected as samples for the Vibrio parahaemolyticus sensitive group and the Vibrio parahaemolyticus tolerant group.
[0029] (2) Five white shrimp were randomly selected from the sensitive group and the tolerant group respectively. Muscle tissue was extracted and genomic DNA was extracted using the conventional phenol-form extraction method. The obtained genomic DNA was stored at -20 °C for later use.
[0030] (3) Primers F and R were designed based on the sequence of the Programmed cell death protein 6 gene of Litopenaeus vannamei (gene accession number: LOC113805132). Then, SNP sites located in the Programmed cell death protein 6 gene were amplified and screened.
[0031] The sequence of primer F is: GAATGTTTGACAAAAAAGGCTCCG;
[0032] The sequence of primer R is ATGGAGGACAATACAGCACTGAA;
[0033] The PCR amplification system consists of the following components: 2.0 μL of 10×Taq buffer, 0.4 μL of dNTPs (10 mmol / L each), 0.2 μL of Taq DNA polymerase (5 U / μL), 0.5 μL of primer F, 0.5 μL of primer R, 14.4 μL of ddH2O, and 2.0 μL of template DNA;
[0034] The PCR amplification reaction procedure includes the following steps:
[0035] S1. Pre-denaturate at 95℃ for 5 min;
[0036] S2. Perform 34 cycles of denaturation at 95℃ for 30s, annealing at 60℃ for 30s, and extension at 72℃ for 30s.
[0037] S3, extend at 72℃ for 5 minutes;
[0038] (4) The PCR amplification products were purified and sequenced after detection by 1% agarose gel electrophoresis. The sequencing results were compared and analyzed using DNAstar software, including nucleotide sequence alignment and peak diagram analysis, to screen for relevant SNP sites. The PCR amplification product sequence of one sample is shown below, where position 212 is D.4689 G>A, position 221 is D.4698 T>A, position 265 is D.4742 T>G, and position 279 is D.4756 G>T:
[0039] ;
[0040] (5) Based on the selected SNPs, the Litopenaeus vannamei in the sensitive and tolerant groups were detected and genotyped according to the above method. The samples of different SNPs in the sensitive and tolerant groups were statistically analyzed, and the genotype frequency and allele frequency were calculated. Chi-square analysis was used to test independence. The specific results are shown in […]. Figure 1 .
[0041] according to Figure 1 Analysis revealed a significant correlation between the distribution of the four different genotypes (AA, AA, TT, and GG) corresponding to the four loci (D.4689 G>A, D.4698 T>A, D.4742 T>G, and D.4756 G>T) and their resistance to Vibrio parahaemolyticus (x̄ ± 0.5%). 2 =6.2206, P=0.0446), (x 2 =8.0000, P=0.0183), (x 2 =8.6195, P=0.0033), (x 2 =6.2471, P=0.0440), and these four genotypes have better resistance to Vibrio parahaemolyticus compared to other genotypes, and can be given priority as parents for breeding Litopenaeus vannamei to be resistant to Vibrio parahaemolyticus.
[0042] Furthermore, it should be understood that although this specification describes embodiments, not every embodiment contains only one independent technical solution. This narrative style is merely for clarity. Those skilled in the art should consider the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.
Claims
1. A molecular marker for programmed cell death protein in Penaeus vannamei, characterized by: The molecular markers for programmed cell death proteins in Litopenaeus vannamei include molecular marker A, molecular marker B, molecular marker C, and molecular marker D; The molecular marker A is located at the 4689 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, and the base at this site is G or A; The molecular marker B is located at the 4698 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, and the base at this site is either T or A; The molecular marker C is located at the 4742 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, and the base at this site is T or G; The molecular marker D is located at the 4756 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, and the base at this site is G or T; The application involves using molecular markers A, B, C, and D for the selective breeding of Litopenaeus vannamei with resistance to Vibrio parahaemolyticus.
2. The application of the molecular marker for programmed cell death proteins in Litopenaeus vannamei according to claim 1, characterized in that: Specifically, genomic DNA was extracted from the muscle tissue of the whiteleg shrimp to be tested, and then used as template DNA for PCR amplification and purification of the PCR amplification products. The obtained products were then sequenced to determine the genotypes of molecular markers A, B, C and D. When the genotype of molecular marker A is AA, that individual is selected as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker B is AA, that individual is selected as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker C is TT, that individual is selected as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker D is GG, that individual is selected as a backup parent for breeding Litopenaeus vannamei.
3. The application of the molecular marker for programmed cell death proteins in Litopenaeus vannamei according to claim 2, characterized in that: In the PCR amplification and PCR product purification process, the primer set used to detect molecular markers of programmed cell death proteins in Litopenaeus vannamei includes primer F and primer R; The sequence of primer F is: GAATGTTTGACAAAAAAGGCTCCG; The sequence of primer R is ATGGAGGACAATACAGCACTGAA.
4. The application of the molecular marker for programmed cell death proteins in Litopenaeus vannamei according to claim 3, characterized in that: The PCR amplification system consists of the following components: 2.0 μL of 10×Taq buffer, 0.4 μL of dNTPs, 0.2 μL of Taq DNA polymerase, 0.5 μL of primer F, 0.5 μL of primer R, 14.4 μL of ddH2O, and 2.0 μL of template DNA.
5. The application of the molecular marker for programmed cell death proteins in Litopenaeus vannamei according to claim 2, characterized in that: The PCR amplification reaction procedure includes the following steps: S1. Pre-denaturate at 95℃ for 5 min; S2. Perform 34 cycles of denaturation at 95℃ for 30s, annealing at 60℃ for 30s, and extension at 72℃ for 30s. S3, extend at 72℃ for 5 minutes.
Citation Information
Patent Citations
SNP marker related to vibrio parahaemolyticus infection resistance character of litopenaeus vannamei and application of SNP marker
CN114540509A
SNP marker on LvFREP2 gene related to disease resistance of litopenaeus vannamei, detection primer and application of SNP marker
CN114540510A