Bacitracin engineering strain with oxdC gene knocked out and preparation method and application thereof

Abstract

The present application provides a bacitracin-producing engineering bacterium with oxdC gene knocked out and a preparation method and application thereof, which adopts a genetic engineering means to knock out an oxdC gene in a genome of Bacillus licheniformis, and obtains a recombinant strain after the oxdC gene is knocked out, namely the bacitracin-producing engineering bacterium, and the nucleotide sequence of the oxdC gene is shown in SEQ ID NO. 1. The bacitracin-producing engineering bacterium has stronger fermentation production capacity and higher yield, and the bacitracin yield is increased by more than 16% compared with Bacillus licheniformis DW2.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of genetic engineering and fermentation engineering, in particular to a bacitracin engineering strain with oxdC gene knockout and a preparation method and application thereof. BACKGROUND

[0002] Bacillus licheniformis is an internationally recognized industrial microbial strain with biological safety (GRAS), which has the advantages of clear genetic background, strong robustness, stable traits, etc., and is widely used in the fermentation production of biological chemical products such as poly-γ-glutamic acid, licheniformin, phenylethanol, bacitracin, etc.

[0003] Bacitracin is a kind of polypeptide antibiotic synthesized by Bacillus subtilis and Bacillus licheniformis, which can strongly inhibit the growth of gram-positive bacteria and part of gram-negative bacteria, and has a synergistic effect when combined with other antibiotics, so it is widely used in feed additives and veterinary industry. The structure of bacitracin includes ornithine (Orn), D-phenylalanine (D-Phe), histidine (His), D-aspartic acid (D-Asp), asparagine (Asn), lysine (Lys), D-glutamic acid (D-Glu), cysteine (Cys), leucine (Leu), isoleucine (Ile) and valine (Val) 11 kinds of amino acids.

[0004] In recent years, the strategies for high-yield bacitracin mainly focus on enhancing the supply level of bacitracin precursor amino acids; there are also reports of improving bacitracin yield by modifying transcriptional regulators (such as PhoP, KipR, Lrps), but the mechanism of action of PhoP, KipR, Lrps transcription factors in bacteria is not clear, and there is no relevant report on the correlation between these transcription factors and OxdC (including OxdC protein, OxdC coding gene and OxdC regulatory object). In addition, the synthesis of secondary metabolites is usually affected by multiple levels of global cell metabolism, so many indirect factors that affect bacitracin yield need to be further explored.

[0005] Oxalate decarboxylase (Oxdc) belongs to the Cupin protein superfamily, which is a homogeneous polymerase containing Mn2+, which can catalyze the conversion of oxalic acid to formic acid and CO2 without cofactors. At present, there is no report on the relationship between oxalate decarboxylation reaction and bacitracin yield, and it is also impossible to infer the relationship between the expression level of oxalate decarboxylase and bacitracin synthesis. SUMMARY

[0006] One of the purposes of the present application is to provide a preparation method of bacitracin engineering bacteria with oxdC gene knocked out, which has stronger bacitracin fermentation production capacity and higher yield.

[0007] The preparation method of bacitracin engineering bacteria with oxdC gene knocked out is to knock out the oxdC gene in the genome of Bacillus licheniformis by genetic engineering means, and obtain the recombinant strain after the oxdC gene is knocked out (i.e. the bacitracin engineering bacteria), and the nucleotide sequence of the oxdC gene is shown in SEQ ID NO. 1.

[0008] The function of oxalate decarboxylase Oxdc is to catalyze the conversion of oxalic acid into formic acid and CO2. At the same time, oxalic acid has the effect of inhibiting microbial growth. Therefore, it is generally believed that knocking out the coding gene oxdC of oxalate decarboxylase Oxdc will affect the conversion of oxalic acid, resulting in an increase in oxalic acid and being not conducive to the growth of the strain, and further affecting the fermentation production of bacitracin by the strain, i.e. knocking out the oxdC gene is theoretically not conducive to the improvement of bacitracin yield. However, the present application first successfully knocks out the coding gene oxdC of oxalate decarboxylase Oxdc in the genome of Bacillus licheniformis by genetic engineering method, and unexpectedly finds that the recombinant strain obtained after knocking out the coding gene of oxalate decarboxylase Oxdc has stronger bacitracin fermentation production capacity compared with the original strain, which provides a new strategy for improving bacitracin yield.

[0009] Preferably, the Bacillus licheniformis is Bacillus licheniformis DW2 (Bacillus licheniformis DW2), which has been preserved in the China Center for Type Culture Collection located in Wuhan on October 12, 2011, and the preservation number is CCTCC NO: M2011344. Bacillus licheniformis DW2 is a kind of existing high-yield bacitracin strain, and the bacitracin yield of the recombinant strain obtained therefrom is higher.

[0010] Preferably, the knocking out of the oxdC gene in the genome of Bacillus licheniformis by genetic engineering means comprises the following steps:

[0011] (1) The upstream homologous arm and the downstream homologous arm of the oxdC gene are amplified by PCR using the genome of Bacillus licheniformis DW2 as a template;

[0012] (2) The upstream homologous arm and the downstream homologous arm of step (1) are connected together by overlap extension PCR to obtain a homologous arm fusion fragment;

[0013] (3) using restriction endonuclease BamHI and XbaI to double enzyme cut the homologous arm fusion fragment obtained in step (2), to obtain enzyme cutting fusion fragment A; meanwhile, using BamHI and XbaI to double enzyme cut the plasmid T2(2)-ori, to obtain linear plasmid fragment after enzyme cutting

[0014] Plasmid fragment

[0015] (4) linking the enzyme cutting fusion fragment A and the linear plasmid fragment obtained in step (3) through T4-DNA ligase, and transforming the enzyme linked product into E. coli DH5a through calcium chloride transformation method, taking kanamycin as a resistance screening marker, and obtaining positive transformants through colony PCR, and obtaining the knockout plasmid T2(2)-ori-oxdC of oxdC gene through sequencing;

[0016] (5) transforming the T2(2)-ori-oxdC constructed in step (4) into Bacillus licheniformis DW2, and obtaining positive transformants through kanamycin resistance screening;

[0017] (6) culturing the positive transformants verified correctly through colony PCR in step (5) for several times, and performing colony PCR detection, and screening to obtain positive single exchange combination strain in which the upstream arm of oxdC gene or the downstream arm of oxdC gene produces single exchange with the genomic DNA of Bacillus licheniformis DW2;

[0018] (7) culturing the positive single exchange combination strain obtained in step (6) for several times, and screening to obtain the recombinant strain after knocking out the oxdC gene through PCR method, namely the bacitracin engineering bacterium, and naming as DW2△oxdC.

[0019] The second purpose of the present application is to provide a bacitracin engineering bacterium with oxdC gene knocked out, which is a recombinant strain constructed by the preparation method of the bacitracin engineering bacterium with oxdC gene knocked out.

[0020] The third purpose of the present application is to provide the application of the bacitracin engineering bacterium with oxdC gene knocked out in bacitracin production, including seed culture and fermentation culture.

[0021] In the above-mentioned application, the fermentation medium formula used in the fermentation culture is 60-100 g / L soybean meal, 30-50 g / L corn starch, 4-8 g / L calcium carbonate and 0.5-2 g / L ammonium sulfate.

[0022] Compared with the prior art, the present application has the following technical effects:

[0023] The application breaks through the convention, and for the first time improves bacitracin yield by knocking out oxdC gene in Bacillus licheniformis, and provides a new strategy for high-yield bacitracin. Compared with Bacillus licheniformis DW2, the bacitracin yield of the Bacillus licheniformis recombinant strain DW2△oxdC constructed by the application is increased by more than 16%. The research results of the application show that the method of improving bacitracin yield by knocking out oxdC gene is very effective and feasible. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 It is an agarose gel electrophoresis diagram of the upstream homologous arm of the oxdC gene and the downstream homologous arm of the oxdC gene obtained in step (1), wherein lane M is a DNA marker, lane 1 is the upstream homologous arm of the oxdC gene, and lane 2 is the downstream homologous arm of the oxdC gene.

[0025] Figure 2 It is an agarose gel electrophoresis diagram of the homologous arm fusion fragment obtained in step (2), wherein lane M is a DNA marker, and lane 1 is the homologous arm fusion fragment.

[0026] Figure 3 It is a colony PCR verification diagram of the knockout vector T2(2)-ori-oxdC obtained in step (4), wherein lane M is a DNA marker, and lane 1 is a band of the colony PCR verification of the knockout vector T2(2)-ori-oxdC.

[0027] Figure 4 It is a colony PCR verification diagram of the positive transformant strain obtained in step (5), wherein lane M is a DNA marker, and lane 1 is a verification band of the positive transformant strain.

[0028] Figure 5 It is a verification band of the Bacillus licheniformis DW2△oxdC in which the oxdC gene is knocked out obtained in step (7), wherein lane M is a DNA marker, and lane 1 is a verification band of the Bacillus licheniformis DW2△oxdC.

[0029] In the above DNA marker lane, the molecular weights of the bands from top to bottom are 5000 bp, 3000 bp, 2000 bp, 1500 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp. DETAILED DESCRIPTION

[0030] The following examples are further illustrations of the present application and are not intended to limit the present application. The technical solutions described in the present application are conventional solutions in the art unless specifically stated otherwise; the reagents or materials described are from commercial channels unless specifically stated otherwise. Example 1

[0031] A bacitracin-producing engineering strain with oxdC gene knocked out is prepared by knocking out the oxdC gene in the genome of Bacillus licheniformis using genetic engineering methods to obtain a recombinant strain with the oxdC gene knocked out, i.e., the bacitracin-producing engineering strain. The nucleotide sequence of the oxdC gene is shown in SEQ ID NO. 1. The Bacillus licheniformis is Bacillus licheniformis DW2, which has been deposited at the China Center for Type Culture Collection in Wuhan on October 12, 2011, and the deposit number is CCTCC NO: M2011344.

[0032] The specific steps of knocking out the oxdC gene in the genome of Bacillus licheniformis using genetic engineering methods are as follows:

[0033] (1) According to the gene sequence of the oxdC gene in the genomic DNA sequence of Bacillus licheniformis DW2, upstream homologous arm primers (oxdC-F1, oxdC-R1) and downstream homologous arm primers (oxdC-F2, oxdC-R2) of the oxdC gene are designed; and the genomic DNA of Bacillus licheniformis DW2 is used as a template, and the upstream homologous arm primers and the downstream homologous arm primers of the oxdC gene are used for PCR amplification to obtain an upstream homologous arm fragment of the oxdC gene and a downstream homologous arm fragment of the oxdC gene (as shown in SEQ ID NO. 2, the upstream homologous arm fragment of the oxdC gene is 672 bp, and the downstream homologous arm fragment of the oxdC gene is 669 bp). Figure 1

[0034] The sequences of oxdC-F1, oxdC-R1, oxdC-F2, and oxdC-R2 are as follows:

[0035] oxdC-F1: GATCTTTTCTACGAGCTCATCATCAATGGAAAACGCTC,

[0036] oxdC-R1: TCCTGCAAGCCTGGCTGG GTGATATCCCCTCTTTCTC,

[0037] oxdC-F2: GAGAAAGAGGGGATATCAC CCAGCCAGGCTTGCAGGA,

[0038] ​oxdC-R2: CTGCAGCCCGGGGGATCC AATTCGGGAAACACCTTTA;

[0039] (2) Taking the upstream homologous arm fragment of oxdC gene and the downstream homologous arm fragment of oxdC gene as templates, and taking the upstream homologous arm primer oxdC-F1 and the downstream homologous arm primer oxdC-R2 as primers, the upstream homologous arm of oxdC gene and the downstream homologous arm of oxdC gene are connected together by overlap extension PCR to obtain a homologous arm fusion fragment (as shown in Figure 2 , the homologous arm fusion fragment is 1341 bp);

[0040] (3) The homologous arm fusion fragment in step (2) is double-enzyme cut by XbaI and BamHI restriction endonucleases to obtain an enzyme-cut fusion fragment. Meanwhile, the plasmid T2(2)-ori is prepared (wherein, the construction method of the plasmid T2(2)-ori is: 194-ori from pE194 plasmid, kanamycin resistance gene from pDG780 plasmid, and pUC-ori from plasmid pBluescript II SK(+)-X52328 are amplified by PCR reaction, and recovered and enzyme cut. The 194-ori, kanamycin resistance gene, and pUC-ori are connected in sequence. The construction method refers to the following literatures: Guo X H, Xiong Z, et al. (1991). Construction of Escherichia coli-Bacillus subtilis multifunctional shuttle vector [J]. Acta Biochimica Sinica. 7(3): 224-229 and Peng Q Z, Zhang W C, et al. (2002). Construction of Bacillus pumilus-Escherichia coli shuttle secretion expression vector [J]. Acta Biochimica Sinica. 18(4): 438-441), and the plasmid T2(2)-ori is double-enzyme cut by XbaI and BamHI restriction endonucleases to obtain a linear plasmid fragment (4250 bp); wherein, the restriction endonucleases XbaI and BamHI are both purchased from Beijing Zoman Biotechnology Co., Ltd.;

[0041] (4) The enzyme-cut gene fragment obtained in step (3) and the linear plasmid fragment obtained in step (3) are connected by T4 DNA ligase to obtain a connection product; then, the connection product is transformed into Escherichia coli DH5α by calcium chloride transformation method, and the transformants are screened in a culture medium containing kanamycin at 37°C, and the transformants are screened, and the transformants are verified by colony PCR with primers T2-F and T2-R (the primers used are: T2-F and T2-R). The PCR verification result of the transformants is: an electrophoretic band appears at 1629 bp (as shown in Figure 3 ), which indicates that the knockout vector is constructed successfully, and is named as: knockout vector T2(2)-ori-oxdC; wherein, the sequences of T2-F and T2-R are:

[0042] T2-F: ATGTGATAACTCGGCGTA,

[0043] T2-R: GCAAGCAGCAGATTACGC;

[0044] The knockout vector T2(2)-ori-oxdC is then transformed into B. licheniformis DW2 by electroporation, and the transformants are screened on a medium containing kanamycin at 37°C. The transformants are verified by colony PCR using primers T2-F and T2-R. If the PCR verification result of the transformants is that an electrophoresis band appears at 1629 bp, it indicates that the knockout vector T2(2)-ori-oxdC is successfully transformed into B. licheniformis DW2, and the transformants are positive transformants;

[0045] (5) The positive transformants obtained in step (4) are subcultured three times at 45°C on a medium containing kanamycin, each time for 12 h, and the single crossover strains are verified by colony PCR using primers T2-F and oxdC-KYR (or primers T2-R and oxdC-KYF). If the electrophoresis band is 1460 bp or 2615 bp, it indicates that the single crossover is successful (as shown in Figure 4 The sequences of the primers oxdC-KYF and oxdC-KYR are as follows:

[0046] oxdC-KYF: ATCGTCTAACAGGTCCCC,

[0047] oxdC-KYR: CAGGTAGACGCCGTAAGTC;

[0048] (6) The single crossover strains obtained in step (5) are inoculated into a medium at 37°C without kanamycin and subcultured for 3-6 times, and the transformants are verified by colony PCR using primers oxdC-KYF and oxdC-KYR. If the PCR verification result of the transformants is that an electrophoresis band appears at 1993 bp, it indicates that a gene back mutation occurs, and the transformants are B. licheniformis DW2; if an electrophoresis band appears at 1378 bp, it indicates that the oxdC gene is successfully knocked out in B. licheniformis DW2, and the transformants are positive transformants (as shown in Figure 5 Subsequently, the positive transformants are further verified by sequencing to obtain B. licheniformis DW2△oxdC with the oxdC gene knocked out.

[0049] Then, the applicant also uses the above-constructed B. licheniformis DW2△oxdC to ferment bacitracin. The application of B. licheniformis DW2△oxdC in the production of bacitracin includes seed culture and fermentation culture.

[0050] The specific steps of the seed fermentation are as follows: first, the Bacillus licheniformis DW2△oxdC is activated, that is, 1% (volume percentage) of the seed is inoculated into a 5 mL LB culture medium, and then the seed is cultured at 230 r / min and 37°C for 12 hours; then, 1% (volume percentage) of the seed liquid after the seed activation is inoculated into the seed culture medium, and then the seed is cultured at 230 r / min and 37°C for 12 hours, so as to obtain the seed culture liquid (the seed culture medium is the LB culture medium, and the specific formula is as follows: 8-10 g / L peptone, 3-5 g / L yeast extract, 7-10 g / L sodium chloride, and pH 7.2).

[0051] The specific steps of the fermentation culture are as follows: 20 mL of the fermentation culture medium with different formulas (the specific formula is shown in Table 1, and the pH of the fermentation culture medium used in each example in Table 1 is natural) is added into a 250 mL triangular flask, then 3% (volume percentage) of the seed liquid is inoculated into the fermentation culture medium, the rotation speed is 230 r / min, the temperature is 37°C, and the fermentation culture is performed for 48 hours, so as to obtain the fermentation liquid.

[0052] The inventors of the present application use the high performance liquid chromatography (HPLC) method to determine the bacitracin yield in the fermentation liquid produced in the above examples. The determination conditions are as follows: an Agilent 1200 liquid chromatograph is used for detection; the chromatographic column is Hypersil BDS C18 (5 μm, 4.6 mm x 250 mm); the mobile phase is A:B = 35:65 (A phase: 100 mL of pH 6.0 phosphate buffer is added to 300 mL of water and mixed uniformly; B phase: 520 mL of methanol and 40 mL of acetonitrile are mixed uniformly); the flow rate is 1.0 mL / min; the column temperature is 30°C; the ultraviolet detector wavelength is 254 nm; and the injection amount is 20 μL. The bacitracin yield in the fermentation liquid produced is calculated according to the standard curve of the bacitracin standard (see Table 2).

[0053] Table 1

[0054]

[0055] Table 2

[0056]

[0057] As can be seen from Table 2, under the same fermentation conditions, the bacitracin yield in the fermentation liquid of the Bacillus licheniformis DW2△oxdC of the present application is obviously improved (increased by more than 16%) compared with the Bacillus licheniformis DW2 of the prior art, which indicates that the technical scheme of the present application has important application value in improving the bacitracin yield of the Bacillus licheniformis.

[0058] Any simple derivations or replacements made by those skilled in the art without departing from the concept of the present application shall be considered as falling within the protection scope of the present application.

Claims

1. A method for preparing a bacillomycin-producing engineered bacterium with a knockout oxdC gene, which comprises the following steps: knocking out the oxdC gene in the genome of Bacillus licheniformis by genetic engineering to obtain a recombinant strain with the knockout oxdC gene, i.e., the bacillomycin-producing engineered bacterium, wherein the nucleotide sequence of the oxdC gene is shown in SEQ ID NO.

1.

2. The method of claim 1, wherein the preparation of the bacitracin engineering bacteria in which the oxdC gene is knocked out is characterized by: The bacillus licheniformis is bacillus licheniformis (DW2) which has been preserved in the China Center for Type Culture Collection in Wuhan on October 12, 2011, and the preservation number is CCTCC NO: M2011344. Bacillus licheniformis ) DW2, which has been preserved in the China Center for Type Culture Collection in Wuhan on October 12, 2011, and the preservation number is CCTCC NO: M2011344.

3. The method of claim 2, wherein the preparation of the bacitracin engineering bacteria in which the oxdC gene is knocked out, is characterized by, The method for knocking out the oxdC gene in the genome of Bacillus licheniformis by genetic engineering comprises the following steps: (1) amplifying the upstream homologous arm and the downstream homologous arm of the oxdC gene by PCR using the genome of Bacillus licheniformis DW2 as a template; (2) connecting the upstream homologous arm and the downstream homologous arm of step (1) together by overlap extension PCR to obtain a homologous arm fusion fragment; (3) double-digesting the homologous arm fusion fragment obtained in step (2) with restriction endonucleases BamHI and XbaI to obtain a digested fusion fragment A; and double-digesting plasmid T2(2)-ori with BamHI and XbaI to obtain a linear plasmid fragment after digestion; (4) linking the digested fusion fragment A and the linear plasmid fragment obtained in step (3) with T4-DNA ligase, transforming the ligation product into Escherichia coli DH5α by the calcium chloride transformation method, taking kanamycin as a resistance screening marker, and obtaining positive transformants by colony PCR, and obtaining the knockout plasmid T2(2)-ori-oxdC of the oxdC gene by sequencing; (5) transforming T2(2)-ori-oxdC constructed in step (4) into Bacillus licheniformis DW2, and obtaining positive transformants by kanamycin resistance screening; (6) culturing the positive transformants verified by colony PCR in step (5) for several times, detecting by colony PCR, and screening positive single crossover recombinant strains in which the upstream arm of the oxdC gene or the downstream arm of the oxdC gene produces single crossover with the genomic DNA of Bacillus licheniformis DW2; (7) culturing the positive single crossover recombinant strains obtained in step (6) for several times, and screening the recombinant strain with the knockout oxdC gene, i.e., the bacillomycin-producing engineered bacterium, by PCR, which is named DW2△oxdC.

4. A bacitracin engineering bacterium with oxdC gene knocked out, characterized in that: The bacillomycin-producing engineered bacterium with the knockout oxdC gene is obtained by the method for preparing the bacillomycin-producing engineered bacterium with the knockout oxdC gene according to any one of claims 1 to 3.

5. Use of the bacitracin engineering bacteria according to claim 4 in the production of bacitracin, characterized in that: The method comprises seed culture and fermentation culture.

6. The use of the bacitracin engineering bacteria according to claim 5 in bacitracin production, characterized in that: The fermentation medium used in the fermentation culture comprises 60-100 g / L soybean meal, 30-50 g / L corn starch, 4-8 g / L calcium carbonate, and 0.5-2 g / L ammonium sulfate.

Images