Use of doxorubicin hydrochloride-dna tetrahedra-iron nanoparticle complex for the preparation of a medicament for cancer
The preparation of a doxorubicin hydrochloride-DNA tetrahedron-iron-based nanoparticle complex solved the problems of drug targeting and side effects in the treatment of cancer, achieving highly efficient targeted delivery to tumor cells and significant cytotoxicity, with good anti-tumor effects.
Patent Information
- Application Number
- CN202311870378.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-29
- Publication Date
- 2026-04-14
- Estimated Expiration
- 2043-12-29
AI Technical Summary
Current doxorubicin hydrochloride treatments for cancer suffer from poor drug targeting, limited tissue penetration, and significant side effects. Traditional iron-based nanoparticles are rapidly metabolized in vivo, leading to poor therapeutic efficacy.
The Fe3O4-PEI@TDN-DOX complex was formed by loading doxorubicin hydrochloride onto a DNA tetrahedral framework nucleic acid and then combining it with modified iron-based nanoparticles. This process utilizes electrostatic adsorption technology to improve the drug's targeting and therapeutic efficacy.
It achieves highly efficient targeted delivery to tumor cells and significant cytotoxicity, significantly inhibits tumor cell proliferation, promotes tumor cell apoptosis, and has good biocompatibility and anti-tumor effects.
Smart Images

Figure CN117797270B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the pharmaceutical field, specifically relating to the use of an doxorubicin hydrochloride-DNA tetrahedron-iron-based nanoparticle complex in the preparation of drugs for cancer. Background Technology
[0002] Cancer is a leading cause of death worldwide, with breast cancer being one of the most common cancers among women. Its highly aggressive nature and lack of specific targeted therapies pose a significant challenge to the medical field.
[0003] Currently, cancer treatment methods include surgical procedures, radiation therapy, and chemotherapy.
[0004] Doxorubicin hydrochloride (DOX) is a commonly used chemotherapy treatment. It is an antitumor antibiotic effective against various cancers, including breast cancer, sarcoma, lung cancer, bladder cancer, and others. DOX has broad-spectrum antitumor activity, producing extensive biochemical effects on the body and exhibiting strong cytotoxicity. Precisely delivering DOX to the vicinity of cancer cells to maximize its effect while minimizing damage to normal cells is a current research hotspot. DOX has several limitations, including poor drug resistance, limited tissue penetration, and non-selective distribution, leading to unsatisfactory clinical outcomes and various side effects such as immunosuppression, cardiotoxicity, myelosuppression, neuropathy, and myalgia.
[0005] Ferroprelation, a non-apoptotic form of cell death discovered in recent years, is caused by an increase in toxic lipid peroxides (ROS) due to the accumulation of intracellular iron. Tumor cells, due to their high metabolic rate, have higher iron content than normal cells and are more sensitive to ferroptosis. Inducing ferroptosis in tumor cells for cancer treatment is a current research hotspot. Traditional methods for inducing ferroptosis focus on using small molecule inducers. For example, Erastin has been reported as a ferroptosis inducer, which can directly inhibit systemic xc- to reduce glutathione (GSH) levels, ultimately leading to the peroxidation of abundant unsaturated fatty acids in the tumor cell membrane, thereby causing tumor cell death. Ferroprelation has become a promising strategy for cancer treatment, providing a new avenue for tumor therapy. Currently, the methods for inducing ferroptosis mainly focus on using small molecule inducers. Iron-based nanoparticles can also promote ferroptosis in tumor cells to a certain extent, but their poor water solubility, low cell targeting, and rapid metabolism in vivo make it difficult for them to achieve the desired effect.
[0006] To address the aforementioned issues, it is of great significance to develop drug systems that can achieve high drug targeting, reduce drug toxicity and side effects, and significantly improve the therapeutic effect of drugs. Summary of the Invention
[0007] The purpose of this invention is to provide the use of doxorubicin hydrochloride-DNA tetrahedron-iron nanoparticle complex in the preparation of medicaments for cancer.
[0008] The present invention provides a complex formed by mixing doxorubicin hydrochloride, iron-based nanoparticles and DNA tetrahedral framework nucleic acid; wherein the ratio of DNA tetrahedral framework nucleic acid, doxorubicin hydrochloride and iron-based nanoparticles is (0.5-5) nmol:(5-100) μg:(0.01-1) mg.
[0009] Furthermore, the ratio of the DNA tetrahedral framework nucleic acid, doxorubicin hydrochloride, and iron-based nanoparticles is 1 nmol:(25-45) μg:0.2 mg; preferably, the ratio is 1 nmol:35 μg:0.2 mg.
[0010] Furthermore, the iron-based nanoparticles are polyethyleneimine-modified iron(III) oxide nanoparticles.
[0011] Furthermore, the DNA tetrahedral framework nucleic acid is formed by base complementation of 4 single-stranded DNA molecules, and the sequences of the 4 single-stranded DNA molecules are shown in SEQ ID NO. 1 to 4;
[0012] Furthermore, the preparation method of the tetrahedral framework nucleic acid includes the following steps: maintaining four DNA single strands at 85-105℃ for 5-15 min, and then maintaining them at 2-8℃ for 10-30 min.
[0013] The present invention also provides a method for preparing the above-mentioned complex.
[0014] The method includes the following steps:
[0015] 1) Incubate four single-stranded DNA molecules at 85–105°C for 5–15 min, then at 2–8°C for 10–30 min to obtain DNA tetrahedral framework nucleic acid;
[0016] 2) Doxorubicin hydrochloride and DNA tetrahedral framework nucleic acid were incubated at 2-8°C for 24 hours to obtain doxorubicin hydrochloride-DNA tetrahedral framework nucleic acid;
[0017] 3) Mix doxorubicin hydrochloride-DNA tetrahedral framework nucleic acid with iron-based nanoparticles and incubate at room temperature for 30 minutes to obtain the final product.
[0018] The present invention also provides the use of the above complex in the preparation of antitumor drugs.
[0019] Furthermore, the antitumor drug is an anti-breast tumor drug.
[0020] The present invention also provides an antitumor drug, which is prepared by using the above-mentioned antitumor complex as the active ingredient and adding pharmaceutically acceptable excipients.
[0021] Furthermore, the antitumor drug is an anti-breast tumor drug.
[0022] This invention provides the use of doxorubicin hydrochloride-DNA tetrahedral-iron-based nanoparticle complexes in the preparation of drugs for cancer. The invention involves assembling four single-stranded DNA molecules into a tetrahedral framework nucleic acid (TDN), then loading the anticancer drug doxorubicin hydrochloride (DOX) onto the TDN to obtain DNA tetrahedral framework nucleic acid-doxorubicin hydrochloride (TDN-DOX). Subsequently, TDN-DOX is combined with PEI-modified iron-based nanomaterials via electrostatic adsorption to form the doxorubicin hydrochloride-DNA tetrahedral-iron-based nanoparticle complex (Fe3O4-PEI@TDN-DOX). This Fe3O4-PEI@TDN-DOX complex exhibits a significant inhibitory effect on tumor angiogenesis, providing an innovative strategy for the synergistic treatment of cancer through chemoprevention and ferroptosis. Fe3O4-PEI@TDN-DOX demonstrates excellent biocompatibility and effective cytotoxicity in both in vitro and in vivo experiments, effectively inhibiting tumor cell proliferation and promoting tumor cell apoptosis, showing promising application prospects in the preparation of antitumor drugs.
[0023] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.
[0024] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following examples. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description
[0025] Figure 1(A) Schematic diagram of the preparation process of Fe3O4-PEI@TDN-DOX; (B) PAGE results of ssDNA and TDN; (C) HPCE results verifying the synthesis of TDN; (D) Agarose gel electrophoresis results showing complexes in different proportions. According to calculations, the ratio of Fe3O4-PEI to TDN-DOX in lanes 3 to 7 is 1:1, 1:2, and up to 1:5, respectively. (E, G) Results of dynamic light scattering (DLS) measurements of TDN, TDN-DOX, and Fe3O4-PEI@TDN-DOX; (F) Atomic force microscopy (AFM) image of Fe3O4-PEI; (H) Transmission electron microscopy (TEM) results of TDN, TDN-DOX, and Fe3O4-PEI@TDN-DOX.
[0026] Figure 2 Results of Fe3O4-PEI@TDN-DOX drug release and cellular uptake; (A) Gel images of DOX and encapsulation efficiency of TDN at different ratios. (B) Stability assessment of TDN-DOX at 4°C and room temperature for different time periods. (C) Quantitative analysis of cellular uptake by flow cytometry. (D) For Figure 2 C statistical analysis. (E) CLSM images of cellular uptake. (F) Fe at different pH values (pH = 5.5 or 7.4). 2+ Cumulative release of DOX. (G) Cumulative release of DOX in TDN-DOX at different pH values (pH = 5.5 or 7.4). Statistical analysis: *p < 0.05, **p < 0.01, ***p < 0.001.
[0027] Figure 3 (A) Results of in vitro antitumor efficacy and ferroptosis cytotoxicity experiments. Data are presented as mean ± SD (n = 3). (B) Comparison of cytotoxicity experiment results. (C, D) Protein expression levels and semi-quantitative analysis. (E) Oxidative damage markers (MDA) and GSH results. (F) Cell morphological changes observed by transmission electron microscopy. (G) ROS levels detected by fluorescence microscopy. (H) Quantitative analysis of ROS levels. (I) For Figure 3 Statistical analysis of H; (J) Changes in cell morphology after Fe3O4-PEI and Fe3O4-PEI; TEM results of Fe3O4-PEI@TDN-DOX. Statistical analysis: *p<0.05, **p<0.01, ***p<0.001.
[0028] Figure 4In vivo antitumor activity and safety assessment of 4T1 tumor-bearing mice. (A) Experimental procedures for in vivo antitumor study in 4T1 tumor-bearing mice. (B) Visible 4T1 tumors removed from 4T1 tumor-bearing mice after 20 days. (C) Tumor volume-time plot. Data are expressed as mean ± SD (n = 4). (D) Mouse weight-time plot. Data are expressed as mean ± SD (n = 4). (E) Tumor weight. Data are expressed as mean ± SD (n = 4). (F) H&E staining of tumor tissue. (G) Liver and kidney function indicators. Data are expressed as mean ± standard deviation (n = 4). Statistical analysis: *p < 0.05, **p < 0.01, ***p < 0.001.
[0029] Figure 5 Animal experiment results. (A, B) Immunohistochemical analysis results of CD31 and KI67; (C, D) Ki67 staining results. Figure 5 E. Specific indicators of kidney and liver function; Detailed Implementation
[0030] The raw materials and equipment used in this invention are all known products, obtained by purchasing commercially available products.
[0031] Polyethyleneimine-modified iron tetroxide nanoparticles (Fe3O4-PEI) were purchased from Nanjing Jike Biotechnology Co., Ltd., product number JK-01-003.
[0032] Doxorubicin hydrochloride (DOX), CAS number: 25316-40-9.
[0033] Example 1
[0034] I. Experimental Methods (I) Preparation of Fe3O4-PEI@TDN-DOX Complex
[0035] 1. Preparation of tetrahedral framework nucleic acids (TDN)
[0036] Four single-stranded DNA strands (ssDNA: S1, S2, S3, S4) were dissolved in TM buffer (10 mM Tris-HCl, 50 mM MgCl2, pH 8.0) in equimolar ratio, and maintained at 95°C for 10 min, then at 4°C for 20 min to obtain tetrahedral framework nucleic acid, named TDN.
[0037] The sequences of the four DNA single strands are as follows:
[0038] S1 (SEQ ID NO.1):
[0039] ATTTATCACCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGA ACATTCCTAAGTCTGAA-3';
[0040] S2 (SEQ ID NO.2):
[0041] 5'-ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGAT TCAGACTTAGGAATGTTCG-3';
[0042] S3 (SEQ ID NO.3):
[0043] 5'-ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGAC GGGAAGAGCATGCCCATCC-3';
[0044] S4 (SEQ ID NO.4):
[0045] 5'-ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG-3'.
[0046] 2. Preparation of TDN-DOX complex
[0047] 25, 30, 35, 40, and 45 μg of DOX were mixed with 1 ml of a 1000 nmol / L solution of TDN (1 nmol) (using TM buffer as the solvent), and incubated at 4°C for 24 hours to obtain TDN-DOX.
[0048] The encapsulation efficiency of DOX and TDN at different ratios was measured by measuring absorbance after ultrafiltration, as shown below. Figure 2 As shown in Figure A, it can be seen that when the amount of DOX is 35 μg, the encapsulation efficiency of TDN-DOX can reach over 80%. Furthermore, the PAGE gel image shows that the loading capacity on TDN is close to its maximum limit at a DOX amount of 35 μg. Therefore, TDN-DOX prepared with 35 μg of DOX and 1 ml of 1000 nM TDN (1 nmol) was selected for subsequent experiments.
[0049] 3. Preparation of Fe3O4-PEI@TDN-DOX complex
[0050] The steps for synthesizing Fe3O4-PEI@TDN-DOX are as follows: Figure 1 As shown in Figure A.
[0051] 200 μl of Fe3O4-PEI (0.2 mg) at a concentration of 1 mg / ml was mixed with 1 ml of TDN-DOX (containing 1 nmol of TDN) at a concentration of 1000 nM and incubated at room temperature for half an hour. Fe3O4-PEI and TDN-DOX were then electrostatically adsorbed to obtain Fe3O4-PEI@TDN-DOX.
[0052] (II) Characterization of Fe3O4-PEI@TDN-DOX complex
[0053] ssDNA and TDN were detected by polyacrylamide gel electrophoresis (PAGE), and the results are as follows: Figure 1 As shown in B. From Figure 1 As shown in Figure B, the bands from left to right correspond to S1, S1+S2, S1+S2+S3, and TDN, respectively. The synthesized TDN matches the 200bp band in the gel image, proving that TDN was successfully synthesized.
[0054] High-performance capillary electrophoresis (HPCE) was used to detect ssDNA and TDN, and the results are as follows: Figure 1 As shown in C.
[0055] The zeta potentials of TDN, Fe3O4-PEI, and Fe3O4-PEI@TDN-DOX were detected using dynamic light scattering (DLS). The experimental results are as follows: Figure 1 E and Figure 1 As shown in G.
[0056] Figure 1 As can be seen from E, the negative charge of TDN is approximately -7.85±1.37mV, and the positive charge of Fe3O4 PEI is approximately 27.4±1.74mV, indicating that Fe3O4-PEI and TDN-DOX can be electrostatically adsorbed and bound. At the same time, the Zeta potential change of Fe3O4-PEI@TDN-DOX is 33.5±1.76mV, indicating that Fe3O4-PEI@TDN-DOX was successfully synthesized.
[0057] The results of agarose gel electrophoresis of TDN-DOX and Fe3O4-PEI@TDN-DOX are as follows: Figure 1 As shown in Figure D, the electronegativity of TDN-DOX reversed after successful binding with Fe3O4-PEI. This reversal caused Fe3O4-PEI@TDN-DOX to shift in the opposite direction to TDN-DOX, further proving the successful synthesis of Fe3O4-PEI@TDN-DOX.
[0058] Figure 1 F, Figure 1From left to right, H represents atomic force microscopy (AFM) and transmission electron microscopy (TEM) images of TDN, Fe3O4-PEI, and Fe3O4-PEI@TDN-DOX, respectively, to determine the morphology of the materials; and through... Figure 1 E, Figure 1 G determines the size distribution of TDN, Fe3O4-PEI, and Fe3O4-PEI@TDN-DOX. Combined with... Figure 1 E- Figure 1 As can be seen from H, the TDN is triangular with a size of approximately 15 nm; the Fe3O4-PEI is circular with a size of approximately 9 nm; the Fe3O4-PEI@TDN-DOX is formed by multiple TDN-DOXs surrounding the Fe3O4PEI, and its size is relatively large, approximately 45 nm. The changes in the size and morphology of the complex indicate that the Fe3O4-PEI@TDN-DOX was successfully synthesized. The structure of Fe3O4-PEI@TDN-DOX is as follows: Figure 1 As shown in Figure A.
[0059] The following experimental examples demonstrate the beneficial effects of this invention.
[0060] Experiment Example 1: In vitro experiment
[0061] I. Experimental Methods
[0062] (I) Detection of substance uptake by mouse breast cancer cells (4T1 cells)
[0063] Cy5 fluorescence was labeled in the S1 single strand of TDN. Log-phase 4T1 cells were seeded on confocal plates overnight. After equilibration for 1 hour in FBS-free medium, 4T1 cells were cultured for 12 hours each in 100 nM S1, 100 nM TDN-DOX (equivalent to 3.5 mg / L DOX), Fe3O4-PEI@TDN-DOX (equivalent to 100 nM TDN and 20 mg / L Fe3O4-PEI), and 3.5 mg / L DOX. Residual Cy5 was then washed three times with PBS to remove as much as possible. Cells were cold-fixed in 4% paraformaldehyde (PFA) for 30 minutes and stained with phalloidin and DAPI. Cells were then collected by confocal microscopy and flow cytometry to detect DOX fluorescence intensity and quantify the efficiency of DOX entry into cells. Meanwhile, 3D reconstruction of the confocal images was performed using Image J Pro Plus, and quantitative results of fluorescence intensity were analyzed using Flow Jo.
[0064] (II) Cytotoxicity experiments and promotion of ferroptosis
[0065] 1. Cytotoxicity and intracellular ROS tests in each group
[0066] 4T1 cells in the logarithmic phase (1×10⁻⁶) 5 The samples were cultured overnight in 96-well plates. Then, fresh culture medium containing 50-300 nM TDN, 12.5-75 mg / L Fe3O4-PEI, 3.5 mg / L DOX, 100 nM TDN-DOX (where the final DOX concentration is equivalent to 3.5 mg / L), and Fe3O4-PEI@TDN-DOX (where the final TDN concentration is equivalent to 100 nM and the final Fe3O4-PEI concentration is equivalent to 20 mg / L) was incubated for 24 hours before subsequent experimental detection.
[0067] (1) Cytotoxicity was tested using the CCK-8 kit (Med Chem Express, Monmouth Junction, NJ, USA), and the results were detected at 450 nm using an enzyme-linked immunosorbent assay (ELISA) reader.
[0068] (2) Using 2',7'-dichlorodihydrofluorescein diacetate (DCFH-DA) as a fluorescent indicator of ROS, ROS in cells of each group was detected by confocal microscopy and flow cytometry.
[0069] 2. Western blotting to assess the expression levels of ferroptosis-related proteins.
[0070] (1) Logarithmic growth phase 4T1 cells were seeded in six-well plates overnight under standard conditions. 4T1 cells were incubated for 12 hours in fresh medium with a final concentration of 100 nM TDN, 20 mg / L Fe3O4-PEI, a final concentration of 3.5 mg / L DOX, a final concentration of 100 nM TDN-DOX (where the final concentration of DOX is equivalent to 3.5 mg / L), and Fe3O4-PEI@TDN-DOX (where the final concentration of TDN is equivalent to 100 nM, the final concentration of Fe3O4-PEI is equivalent to 20 mg / L, and the final concentration of DOX is equivalent to 3.5 mg / L).
[0071] Total protein was extracted using a total protein extraction kit. Protein samples were then separated using SDS-PAGE and transferred to a polyvinylidene fluoride (PVDF) membrane. The membrane was incubated with a primary antibody and visualized using an enhanced Bio-Rad chemiluminescence detection system (GAPDH was used as an internal reference protein to normalize target protein expression).
[0072] II. Experimental Results
[0073] 1. Take-up of various substances by mouse breast cancer cells (4T1 cells)
[0074] After adding 100 nM S1, TDN-DOX, and Fe3O4-PEI@TDN-DOX to 4T1 cells and culturing for 12 hours, the experimental results of cell uptake of various substances are as follows: Figure 2 C- Figure 2 D, from Figure 2 As can be seen from D, the uptake of TDN-DOX and Fe3O4-PEI@TDN-DOX by cells was significantly higher than that in S1, while the uptake of Fe3O4-PEI@TDN-DOX by cells was slightly lower than that of TDN-DOX.
[0075] DOX exhibits high therapeutic efficacy against various solid tumors by binding to DNA and blocking DNA synthesis. Due to its small molecule free diffusion mechanism, free DOX rapidly enhances cellular uptake. Flow cytometry analysis of DOX cellular uptake showed no statistically significant difference between Fe3O4-PEI@TDN-DOX and free DOX.
[0076] 2. Cytotoxicity test results
[0077] (1) Cytotoxicity test results
[0078] Cytotoxicity test results as follows Figure 3 As shown in Figure A, after 24 hours of culture, the TDN vector had no significant effect on 4T1 cells at concentrations ranging from 50 nM to 300 nM, indicating its excellent biocompatibility. When Fe3O4-PEI was used alone, at concentrations of 10–40 mg / L, cytotoxicity increased with increasing Fe3O4-PEI concentration.
[0079] The following solutions were incubated in fresh culture medium for 24 hours at final concentrations of 100 nM TDN, 20 mg / L Fe3O4-PEI, 3.5 mg / L DOX, 100 nM TDN-DOX (where the final DOX concentration was equivalent to 3.5 mg / L), and Fe3O4-PEI@TDN-DOX (where the final TDN concentration was equivalent to 100 nM, the final Fe3O4-PEI concentration was equivalent to 20 mg / L, and the final DOX concentration was equivalent to 3.5 mg / L). The cytotoxicity test results are as follows: Figure 3As shown in B and Table 1, TDN has no inhibitory effect on 4T1 cells. When DOX is used alone, the inhibition rate of 4T1 cells is only 0.28, and the inhibition rate of Fe3O4-PEI on 4T1 cells is 0.34. The total inhibition rate of TDN, DOX and Fe3O4-PEI is only 0.61. However, when Fe3O4-PEI@TDN-DOX is used, the cell inhibition rate reaches 0.76, which is an increase of 0.15, and the improvement rate reaches 24.6%. Therefore, TDN, DOX and Fe3O4-PEI in the Fe3O4-PEI@TDN-DOX complex have a synergistic effect. Fe3O4-PEI@TDN-DOX has stronger cytotoxicity than using Fe3O4-PEI, DOX and TDN-DOX alone at a final concentration.
[0080] Table 1. Cytotoxicity results of each reagent on 4T1 cells (6 replicates per group)
[0081]
[0082] (2) Results of Western blot analysis on the expression levels of ferroptosis-related proteins
[0083] The changes in relevant proteins during this process were assessed using Western blotting experiments to determine the extent of ferroptosis. Figure 3 C- Figure 3 D).
[0084] Twenty-four hours after interaction with cells, the expression levels of GPX4 and SLC7A11 were significantly reduced, indicating that the intracellular redox balance was significantly disrupted.
[0085] Increased ACSL4 expression and the activity of ACSL4 are related to lipid peroxidation sensitivity. Its upregulation indicates that cells are more sensitive to lipid peroxidation and are more susceptible to oxidative stress. In 4T1 cells treated with Fe3O4-PEI@TDN-DOX, ACSL4 expression was the highest, significantly higher than in other groups.
[0086] Results of glutathione (GSH) and MDA levels in 4T1 cells are as follows: Figure 3 E shows that the Fe3O4-PEI@TDN-DOX group had a significantly lower GSH and a significantly higher MDA compared to the other groups, further confirming that Fe3O4-PEI@TDN-DOX had the strongest ability to promote ferroptosis in 4T1 cells.
[0087] Figure 3 G~ Figure 3As can be seen from the results, the ROS produced by the Fe3O4-PEI@TDN-DOX group was significantly higher than that of other groups. This indicates that the 4T1 cells in the Fe3O4-PEI@TDN-DOX group were in a more vulnerable state, with increased oxidative stress levels, ultimately leading to cell death. The changes in cell morphology after treatment with different groups were observed using TEM. Figure 3 J) It can be observed that the cells in the Fe3O4-PEI@TDN-DOX group have obvious ferroptosis characteristics, specifically manifested as smaller mitochondria, increased membrane density, and reduced cristae, further confirming that ferroptosis was strongest in the 4T1 cells of the Fe3O4-PEI@TDN-DOX group.
[0088] Experiment Example 2, Animal Experiment
[0089] I. Experimental Methods
[0090] (I) Animal Modeling
[0091] Six-week-old female balb / c mice were purchased from Dossy Laboratory Co., Ltd. (Chengdu, China). All animal experiments were approved by the Research Ethics Committee of West China Hospital of Stomatology, Sichuan University, and conducted in accordance with laboratory animal laws.
[0092] Add 5×10⁻⁶ ppm of FBS-free RPMI medium to 100 μL of FBS-free RPMI medium. 6 4T1 cell suspension was subcutaneously injected into the right abdomen of mice to establish a 4T1 tumor-bearing mouse model. When the tumor volume reached 90-100 mm... 3 (1 / 2 × longest diameter × shortest diameter) 2 At that time, a 4T1 tumor-bearing mouse model was successfully constructed.
[0093] The 4T1 tumor-bearing mice were randomly divided into the following four groups (n=4 per group):
[0094] (1) Ctrl group: physiological saline;
[0095] (2) DOX group: DOX saline solution;
[0096] (3) TDN-DOX group: TDN-DOX physiological saline solution;
[0097] (4) Fe3O4-PEI@TDN-DOX group: Fe3O4-PEI@TDN-DOX physiological saline solution;
[0098] Administer via tail vein injection, 100 μL each time, for 2-4 days using the same concentration of dox as the standard, 35 μg / ml; administer every other day for 20 days.
[0099] On the last day, the mice were euthanized, and their major organs (heart, liver, spleen, lungs, and kidneys) and tumor sections were stained with hematoxylin and eosin (H&E) and analyzed by immunohistochemistry to assess the side effects.
[0100] Simultaneously, mouse blood was collected to obtain serum samples for liver and kidney function tests. Figure 5 Various indicators in E.
[0101] (II) Experimental Results
[0102] Results of tumor volume changes in different groups ( Figure 4 C), the final tumor weight diagram (4E) shows that the final tumor weight and tumor volume of the Fe3O4-PEI@TDN-DOX group were significantly lower than those of other groups. The experimental results indicate that the anti-tumor effect of Fe3O4-PEI@TDN-DOX is significantly better than that of other groups.
[0103] Meanwhile, there was no significant difference in body weight among the 4T1 tumor-bearing mice in all groups. Figure 4 D). Changes in major organs (heart, liver, spleen, lungs, and kidneys) and tumors before and after treatment were observed through histological and immunohistochemical staining. H&E staining ( Figure 4 F) showed that the tumor cells in the Ctrl group were densely packed and morphologically intact, while the Fe3O4-PEI@TDN-DOX group exhibited obvious nuclear fragmentation and aggregation. Compared with the Ctrl, DOX, and TDN-DOX groups, TUNEL staining showed more pronounced apoptosis in the Fe3O4-PEI@TDN-DOX group. Figure 4 G and Figure 4 H). Cell adhesion molecule-1 (CD31) was used to assess the level of tumor angiogenesis, with the presence of dark brown indicating a positive result. Immunohistochemical analysis of CD31 showed a significant reduction in the number of tumor microvessels in the Fe3O4-PEI@TDN-DOX group, indicating a significant inhibitory effect on tumor angiogenesis. Figure 5 A and Figure 5 B). Ki67 reflects the level of cell proliferation or growth activity. Ki67 staining results showed that the Fe3O4-PEI@TDN-DOX group had significantly fewer brown-yellow positive cells than other groups, indicating that Fe3O4-PEI@TDN-DOX significantly inhibited tumor cell proliferation. Figure 5 (C and D). These results demonstrate that Fe3O4-PEI@TDN-DOX exhibits remarkable efficacy in inhibiting tumor growth.
[0104] Simultaneously, this invention evaluated the biocompatibility and potential side effects of the drug. After ten doses, specific indicators of renal and hepatic function abnormalities were detected in both the DOX and TDN-DOX groups. Figure 5(As shown in E), while the indicators of the Fe3O4-PEI@TDN-DOX group are more similar to those of the brine group, indicating that Fe3O4-PEI@TDN-DOX has good biocompatibility.
[0105] The cell uptake experiments described above have demonstrated that Fe3O4-PEI@TDN-DOX showed no significant statistical difference compared to free DOX. However, in vivo experiments in mice have confirmed that the antitumor effect of Fe3O4-PEI@TDN-DOX was significantly better than that of other groups.
[0106] This invention provides the use of doxorubicin hydrochloride-DNA tetrahedron-iron-based nanoparticle complexes in the preparation of drugs for cancer. The invention involves assembling a DNA tetrahedral framework nucleic acid (TDN) from four single-stranded DNA molecules, then loading the anticancer drug doxorubicin hydrochloride (DOX) onto the TDN to obtain DNA tetrahedron-DNA tetrahedron-DOX (TDN-DOX). Subsequently, TDN-DOX is combined with PEI-modified iron-based nanomaterials via electrostatic adsorption to form the doxorubicin hydrochloride-DNA tetrahedron-iron-based nanoparticle complex (Fe3O4-PEI@TDN-DOX). This Fe3O4-PEI@TDN-DOX complex exhibits a significant inhibitory effect on tumor angiogenesis, providing an innovative strategy for the synergistic treatment of cancer through chemoprevention and ferroptosis. Fe3O4-PEI@TDN-DOX demonstrates excellent biocompatibility and effective cytotoxicity in both in vitro and in vivo experiments, effectively inhibiting tumor cell proliferation and promoting tumor cell apoptosis, showing promising application prospects in the preparation of antitumor drugs.
Claims
1. A complex, characterized in that, It is a complex formed by mixing doxorubicin hydrochloride, iron-based nanoparticles, and DNA tetrahedral framework nucleic acid; the ratio of the DNA tetrahedral framework nucleic acid, doxorubicin hydrochloride, and iron-based nanoparticles is 1 nmol: (25~45) μg: 0.2 mg; the iron-based nanoparticles are polyethyleneimine-modified iron oxide nanoparticles; the DNA tetrahedral framework nucleic acid is formed by base pairing of 4 single-stranded DNA molecules, and the sequences of the 4 single-stranded DNA molecules are shown in SEQ ID NO. 1~4.
2. The complex according to claim 1, characterized in that: The ratio of the DNA tetrahedral framework nucleic acid, doxorubicin hydrochloride, and iron-based nanoparticles is 1 nmol: 35 μg: 0.2 mg.
3. The complex according to any one of claims 1-2, characterized in that, The method for preparing the tetrahedral framework nucleic acid includes the following steps: maintaining four DNA single strands at 85~105℃ for 5~15 min, and then maintaining them at 2~8℃ for 10~30 min.
4. A method for preparing the complex according to any one of claims 1-3, characterized in that, The method includes the following steps: (1) Hold four DNA single strands at 85~105℃ for 5~15 min, and then at 2~8℃ for 10~30 min to obtain DNA tetrahedral framework nucleic acid; (2) Doxorubicin hydrochloride and DNA tetrahedral framework nucleic acid were incubated at 2-8°C for 24 hours to obtain doxorubicin hydrochloride-DNA tetrahedral framework nucleic acid; (3) Mix the doxorubicin hydrochloride-DNA tetrahedral framework nucleic acid with iron-based nanoparticles and incubate at room temperature for 30 min to obtain the final product.
5. Use of the complex according to any one of claims 1-3 in the preparation of an anti-breast tumor drug.
6. An anti-breast tumor drug, characterized in that, It is prepared using the complex described in any one of claims 1-3 as the active ingredient, plus pharmaceutically acceptable excipients.
Citation Information
Patent Citations
Targeted anti-tumor drug system for drug-resistant tumor cells and construction method thereof
CN109620969A
Nano delivery system for targeted inhibition of triple negative breast cancer siRNA (small interfering ribonucleic acid) combined drug as well as preparation method and application of nano delivery system
CN115025045A