Rapeseed bnaREM1.3 gene and its encoded protein in regulating crop drought resistance

CN117844860BActive Publication Date: 2026-06-26HUAZHONG AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
HUAZHONG AGRI UNIV
Filing Date
2023-12-15
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

Rapeseed growth is inhibited under drought conditions, and existing technologies lack effective means of regulating drought-resistant genes, which affects yield and growth.

Method used

The BnaREM1.3 gene of rapeseed was cloned and highly expressed, or loss-of-function mutants were created using CRISPR/Cas9 technology. Gene editing was then performed in rapeseed using Agrobacterium-mediated genetic transformation to regulate its drought resistance.

Benefits of technology

It significantly improves or reduces the drought resistance of rapeseed seedlings and provides important germplasm resources for drought-resistant breeding and related drug development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117844860B_ABST
    Figure CN117844860B_ABST
Patent Text Reader

Abstract

The application discloses a Brassica napus BnaREM1.3 gene and application of a coded protein thereof in regulation of drought resistance of crops. Overexpression strains of the BnaREM1.3 gene are obtained, and it is found that the drought resistance of the overexpression strains is significantly improved compared with wild type. Meanwhile, mutant strains of the BnaREM1.3 gene are obtained by using CRISPR / Cas9 technology, and it is found that the drought resistance of the mutant strains is significantly reduced compared with the wild type. The above results show that the Brassica napus BnaREM1.3 gene can be used to create Brassica napus with different drought resistance and stable heredity, and the BnaREM1.3 gene provides important gene resources and germplasm resources for drought resistance breeding of the Brassica napus, and has a wide application prospect in molecular design breeding of the Brassica napus.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology and relates to the application of a BnaREM1.3 gene and its encoded protein in regulating drought resistance in rapeseed. Background Technology

[0002] Rapeseed (Brassica napus, AACC, 2n=38, hereinafter referred to as rapeseed) is my country's largest oilseed crop, accounting for over 47% of oilseed oil production and is one of the most important sources of edible vegetable oil. my country's rapeseed planting area is approximately 110 million mu (8.7 million hectares), of which winter rapeseed in the Yangtze River basin accounts for about 100 million mu (6.6 million hectares) and spring rapeseed in the north about 10 million mu (6.6 million hectares). Major rapeseed producing areas are susceptible to seasonal or persistent droughts, severely threatening rapeseed growth, development, and yield. In 2022, my country's average temperature was higher than normal, and the Yangtze River basin experienced a historically rare continuous drought from summer to autumn, causing severe losses to rapeseed production. Therefore, identifying drought-resistant genes in rapeseed and analyzing its drought-resistant regulatory mechanisms is of great significance for achieving high and stable rapeseed yields.

[0003] When plants are subjected to drought stress during the seedling stage, their root-to-shoot ratio increases, and both aboveground and underground morphology change. Aboveground changes mainly include leaf wilting, decreased leaf water potential and water content, reduced aboveground biomass, and decreased plant height. Underground root changes include root enlargement and increased branching. These changes severely inhibit normal plant growth and development and even affect yield. Plant resistance to drought stress is a complex biological process closely related to multiple biological pathways. Currently, a large number of drought-resistant genes have been reported in the model plant Arabidopsis thaliana, while research on drought-resistant genes in rapeseed is still relatively limited. Creating rapeseed with different drought resistances using genetic engineering can provide important genetic and germplasm resources for rapeseed resistance breeding.

[0004] The protein Remorin, initially discovered in tomato leaves and measuring approximately 34 kDa, was initially named pp34. Later, due to its structural characteristic of binding to the plasma membrane via a coiled-coil structure, resembling that of the marine fish Remora, which adheres to the surface of other large marine organisms, it was named Remorin. Remorin (REM) is a plant-specific membrane lipid nanodomain localized protein with a highly conserved C-terminus containing a coiled-coil domain and a non-conserved N-terminus; the diversity of the N-terminus determines its functional diversity. It interacts with detergent-resistant membranes to form a major component of lipid rafts, which are cholesterol- and sphingomyelin-rich microdomains on the plasma membrane closely related to membrane signal transduction. With the deepening of research on Remorin proteins, they have been identified in an increasing number of plants, and their functions have been elucidated. Similar to the functional diversity of lipid rafts, Remorin proteins play important roles in plant biological evolution, growth and development, and disease and stress resistance signal transduction.

[0005] Remorin proteins exhibit diverse functions. Firstly, they participate in plant evolutionary processes. Researchers have identified Remorin proteins in bryophytes and ferns, but not in algae, suggesting their emergence is a result of plant adaptation to terrestrial environments. Remorin proteins are involved in plant growth and development. In legumes such as alfalfa and Japanese lotus, Remorin interacts with symbiotic receptor-like protein kinases, essential for nodulation. Remorin can also induce reactive oxygen species and upregulate the levels of proteins related to programmed cell death in tobacco. Furthermore, Remorin proteins are involved in plant disease resistance, stress tolerance, and signal transduction. Currently, plant Remorin proteins have been found to regulate the intercellular movement of viruses such as rice stripe virus, rice blast, tomato bacterial wilt, early-maturing pear scab resistance, potato bacterial wilt, pepper bacterial wilt, and tobacco late blight, thus affecting plant disease resistance. This is due to the interaction between Remorin proteins and microorganisms. Furthermore, Remorin proteins can influence plant stress resistance by synergistically regulating signal transduction with plant hormones. Salicylic acid can regulate lipid distribution through Remorin proteins, thereby mediating plasmodesmata closure and hindering viral movement between cells. This is one of the important reasons why Remorin proteins participate in the regulation of biotic stress. Rice Remorin proteins can also coordinate the signal transduction of abscisic acid and brassinolide by binding to somatic embryogenesis receptor kinases. Remorin proteins can also regulate plant responses to abiotic stresses, such as Populus euphratica's role in regulating cadmium tolerance and salt tolerance in Arabidopsis thaliana.

[0006] There are 16 Remorin proteins in Arabidopsis thaliana. Only four of these have had their functions validated: AtREM1.2, AtREM1.3, AtREM4.1, and AtREM4.2. The remaining 12 genes have not yet been validated. The four validated genes are primarily involved in virus defense, plant hormone signal transduction, seed germination, and phosphorylation in Arabidopsis. Based on their terminal sequences, Remorin proteins can be divided into six groups: Group 1, Group 2, Group 3, Group 4, Group 5, and Group 6. The naming convention is as follows: the protein listed first in the first subgroup (Group 1) is AtREM1.1, and so on. Group 1 Remorin proteins are further divided into two subgroups based on the N-terminal proline content: Group 1a (8.9%) and Group 1b (14.4%). Transcripts from the Group 1b subgroup can be induced to express by various abiotic stresses, including low temperature, abscisic acid treatment, and the microorganism *Pseudomonas syringae*. Group 2 Remorin proteins have only been identified in *Alfalfa* and *Populus simonii*, and studies suggest that these proteins may be closely related to nodulation in leguminous plants. The silent *Alfalfa bursa-pastoris* MtREM2.2 gene can reduce the number of root nodules and growth malformation. Group 3 Remorin proteins lack an N-terminal domain, and their role in plants remains unclear. Group 4 Remorin proteins have a longer N-terminus, and studies indicate that they may participate in signal transduction between plant hormones. The rice OsREM4.1 protein can bind to the brassinolide receptor to coordinate the interaction between abscisic acid and brassinolide signals in rice. Group 5 Remorin proteins are similar to Group 3, but research on them is limited; only *Alfalfa* Remorin proteins are expressed in seeds. Group 6 Remorin proteins are mainly expressed in meristematic tissues and may be involved in plant growth and development. Studies have also shown that the ZmREM6.3 gene in maize can confer quantitative resistance to maize leaf burn, bacterial wilt and common rust, proving that this group of Remorin proteins may also be involved in the regulation of plant disease resistance.

[0007] Currently, there are no studies on the classification and function of Remorin proteins and their gene family members in rapeseed. Overexpression of the rapeseed BnaREM1.3 homolog SIREM1.3 in tomato inhibits the movement of potato virus X. Similarly, salicylic acid can reduce viral movement between plant cells by mediating plasmodesmata permeability through lipid remodeling dependent on rice OsREM1.3 protein. The BnaREM1.3 homolog AtREM1.3 can also promote the formation of Arabidopsis hypersensitivity-induced immune complexes in its membrane microdomains, participating in plant immune processes. Furthermore, AtREM1.3 can induce Arabidopsis protein phosphorylation, regulating protein-protein interactions. Notably, the rapeseed BnaREM1.3 homolog AtREM1.3 can be induced in Arabidopsis seed germination and low-temperature resistance, suggesting its potential involvement in plant growth, development, and tolerance regulation.

[0008] This invention cloned the BnaREM1.3 gene from rapeseed and highly expressed it in rapeseed, resulting in a significant increase in drought resistance during the seedling stage. Simultaneously, by creating mutants of the BnaREM1.3 gene using CRISPR Cas9 technology, the drought resistance during the seedling stage of rapeseed was significantly reduced. These results indicate that the BnaREM1.3 gene plays a crucial role in regulating drought resistance during the seedling stage of rapeseed, making it a promising candidate for developing new drought-resistant germplasm in rapeseed. Summary of the Invention

[0009] The purpose of this invention is to provide the application of the BnaREM1.3 gene in the breeding of transgenic plants with different drought resistance.

[0010] The rapeseed BnaREM1.3 gene involved in this invention encodes a Remorin protein, with one copy each on chromosomes A4 and A5, and two copies on chromosome CO4. These are BnaA04.REM1.3 (BnaA04g26460D), BnaA05.REM1.3 (BnaA05g05140D), BnaC04.REM1.3a (BnaC04g04520D), and BnaC04.REM1.3b (BnaC04g50490D). The nucleotide and amino acid sequences of BnaC04.REM1.3a are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively. Its nucleotide sequence length is 579 bp, and the gene encodes 192 amino acids.

[0011] The applicant used Agrobacterium-mediated genetic transformation to transfer the BnaC04.REM1.3a (BnaC04g04520D) gene into an overexpression vector initiated by a constitutive promoter and then transformed it into the rapeseed genome, obtaining rapeseed germplasm resources overexpressing BnaC04.REM1.3a. Simultaneously, CRISPR / Cas9 gene editing technology was used to obtain rapeseed germplasm resources with loss of function of the BnaREM1.3 gene.

[0012] Next, the drought resistance of overexpression and mutant transformed materials was measured, and it was found that BnaREM1.3 positively regulates the drought resistance of rapeseed.

[0013] The expression vectors described in this invention refer to any vectors known in the prior art that can be used for expression in plants. Expression vectors suitable for the genetic transformation described in this invention include, but are not limited to, 35S-pCAMBIA1300S, PKSE401 (provided by the research group of Chen Qijun, China Agricultural University), etc.

[0014] The drought-resistant rapeseed obtained by this invention shows no significant difference from normal plants during its vegetative and reproductive growth stages. This germplasm resource has a very important application prospect in rapeseed drought-resistant breeding.

[0015] The low drought-resistant rapeseed obtained by this invention can also be used as a test subject for the research and development of plant drought-resistant technologies or related drugs. Attached Figure Description

[0016] Sequence listing SEQ ID NO:1 is the nucleotide sequence of the gene BnaC04.REM1.3a isolated from Brassica napus, with a sequence length of 579 bp; sequence listing SEQ ID NO:2 is the amino acid sequence of the gene BnaC04.REM1.3a isolated from Brassica napus, encoding 192 amino acids.

[0017] Figure 1 Plasmid map of the overexpression vector 35S-pCAMBIA1300S.

[0018] Figure 2 Cloning and detection of overexpressing plants of the BnaC04.REM1.3a gene. A shows the cloning of the BnaC04.REM1.3a gene; B shows the qRT-PCR detection of transformed single plants; C shows the Western blot detection of transformed single plants. * indicates P<0.05 in Student's first test.

[0019] Figure 3Obtaining and identifying BnaREM1.3 mutants from rapeseed. sgRNA1 and sgRNA2 are located in the third and fourth exons of the gene BnaREM1.3, respectively. The editing status of the target sites of the two mutants obtained: CR1 and CR2 are both triple mutants with edited BnaA04.REM1.3, BnaA05.REM1.3, and BnaC04.REM1.3a.

[0020] Figure 4 : Identification of drought resistance phenotypes in rapeseed BnaREM1.3 overexpression and mutants. A is the phenotypic diagram of drought resistance experiment; B is the survival statistics after three independent replicate experiments (n=20). * indicates P<0.05 in Student's t test, ** indicates P<0.01 in Student's t test, and *** indicates P<0.001 in Student's t test. Detailed Implementation

[0021] The present invention is further defined below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions as described in the reference book *Molecular Cloning: A Laboratory Guide* (New York: Cold Spring Harbor Laboratory, 1989), or according to the methods recommended in the manufacturer's operating manual.

[0022] Example 1: Cloning of the BnaC04.REM1.3a gene

[0023] REM1.3 encodes a remorin protein, with one copy each on chromosomes A4 and A5 of the rapeseed, and two copies on chromosome C04. These are BnaA04.REM1.3 (BnaA04g26460D), BnaA05.REM1.3 (BnaA05g05140D), BnaC04.REM1.3a (BnaC04g04520D), and BnaC04.REM1.3b (BnaC04g50490D). The CDS and amino acid sequences of BnaC04.REM1.3a are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively, including the complete ORF reading frame and the start codon ATG, encoding a total of 192 amino acids. These four copies have a high degree of homology. The homology between BnaC04.REM1.3a and the other three copies is as follows: (BnaC04.REM1.3b) 89.21%, (BnaA04.REM1.3) 89.56%, and (BnaA05.REM1.3) 98.27%.

[0024] (1) RNA extraction

[0025] Total RNA was extracted using TransZol (catalog number ET101) from TransGen Biotech. Leaves of the 'Double 11' variety of Brassica napus were ground in liquid nitrogen. 100 mg of the ground sample was transferred to a 1.5 mL centrifuge tube, and 1 mL of TransZol was added. The mixture was vigorously inverted several times to ensure thorough mixing, and allowed to stand at room temperature for 5 minutes. 0.2 mL of chloroform was added, and the mixture was vigorously shaken for 15 seconds and incubated at room temperature for 3 minutes. The mixture was then centrifuged at 10000 x g at 4°C for 15 minutes. At this point, the sample separated into three layers: a colorless aqueous phase (upper layer), a middle layer, and a pink organic phase (lower layer). The colorless aqueous phase was transferred to a new centrifuge tube, and 0.5 mL of isopropanol was added. The mixture was inverted to mix, and incubated at room temperature for 10 minutes. The mixture was then centrifuged at 10000 x g at 4°C for 10 minutes. The supernatant was discarded, and a gel-like precipitate formed on the sides and bottom of the tube. 1 mL of chloroform was added... Prepare the solution with 75% ethanol (using DEPC-treated water) and vortex vigorously; centrifuge at 7500xg for 5 minutes at 4°C; discard the supernatant and allow the precipitate to air dry at room temperature; dissolve the precipitate in 50-100 μL of RNA lysate; incubate at 55°C for 10 minutes. Determine the RNA concentration using 1 μL of the extracted total RNA under Nanodrop conditions, and assess RNA purity based on 1.8 < OD260 / OD280 < 2.0. Simultaneously, perform 1 μL of the solution on 1% Agrose electrophoresis to check RNA integrity.

[0026] (2) cDNA synthesis

[0027] The reverse transcription used is full-gold. One-Step gDNA Removal and cDNA Synthesis SuperMix (catalog number AE311). Using 1 μg total RNA as a template, add 1 μL of Anchored Oligo(dT)18 Primer and 10 μL of 2×ES Reaction Mix sequentially. Add 1 μL of RT / RI Enzyme Mix, 1 μL of gDNARemover, and RNase-free water to a final volume of 20 μL. Gently mix the mixture and incubate at 42°C for 30 min. This step synthesizes first-strand cDNA and removes gDNA. Inactivate the cDNA by heating at 85°C for 5 seconds. RT / RI and gDNA Remover. Add 180 μL of RNase-free water to dissolve the synthesized cDNA and set aside for later use.

[0028] (3) Amplification of the BnaC04.REM1.3a gene

[0029] Primers were designed based on the CDS sequence obtained from the above analysis. Using the cDNA of *Brassica napus* 'Double 11' as a template, the forward primer *BnaREM1.3-KpnⅠ-F* sequence was 5'-GCGggtaccATGGCGGAGGAGCAAAAA-3', and the reverse primer *BnaREM1.3-PstⅠ-R* sequence was 5'-GCGctgcagTTATTTGTCGTCGTCGTCCTTGTAGTCCATGAAACATCCACAAGTCGC-3'. This amplified a fragment containing the flag tag, the full-length CDS of *BnaC04.REM1.3a*. I-5 was used... TM PCR amplification was performed using 2× High-Fidelity Master Mix (TSINGKE Biologica technology). The PCR amplification system is as follows:

[0030]

[0031]

[0032] PCR amplification program: 98℃ total denaturation for 1 min; 98℃ denaturation for 15 sec, 58℃ annealing for 15 sec, 72℃ extension for 30 sec, 34 circles; 72℃ total extension for 5 min.

[0033] The amplified product was detected by agarose gel electrophoresis, and the full-length 579bp BnaC04.REM1.3a was obtained. The product was recovered by gel extraction using the Tiangen Agarose Gel Extraction Kit (http: / / www.tiangen.com / ).

[0034] Example 2: Construction of the BnaC04.REM1.3a gene overexpression transformation vector

[0035] (1) The BnaC04.REM1.3a fragment obtained above was double-digested with the rapid restriction endonucleases KpnI and PstI. The double digestion system is as follows:

[0036]

[0037] The enzyme digestion reaction was carried out in a water bath at 37°C for 1 hour. The digestion products were recovered using Tiangen's DNA purification kit.

[0038] (2) The enzyme digestion product was ligated into the plant expression vector 35S-pCAMBIA1300S, which contains a constitutive expression promoter and an antibiotic marker.

[0039] The connection method is as follows:

[0040]

[0041] Connection reaction conditions: overnight at 4°C.

[0042] (3) Transformation of Escherichia coli DH5α, the transformation method is as follows:

[0043] Add 5 μL of the ligation product to 50 μL of DH5α competent cells, mix well, and incubate on ice for 30 min; incubate at 42℃ for 1.5 min, then on ice for 3 min; add 400 μL of antibiotic-free liquid LB medium, and activate at 37℃ in a shaker at 150 rpm for 45-60 min; spread 200 μL of the activated bacterial solution onto solid LB medium with the corresponding antibiotic, and incubate upside down at 37℃ for 12-16 h. Positive clones were then screened, and plasmids were extracted and digested for identification. Three positive clones were selected for sequencing. The results showed that the CDS sequence of the BnaC04.REM1.3a gene was successfully ligated into the vector, thus successfully constructing the plant expression vector 35S-pCAMBIA1300S-BnaC04.REM1.3a for transformed plants. The plasmid map of the 35S-pCAMBIA1300S vector is shown below. Figure 1 As shown.

[0044] (4) The correctly constructed recombinant plasmid vector was introduced into Agrobacterium strain GV3101, and positive single clones were selected and stored at -80℃. The introduction method is as follows:

[0045] a. Cleaning the electrostatic precipitator: First wash with pure water, then wash with ultrapure water, discard the water, then wash with anhydrous ethanol (using a 1mL pipette tip to blow away the ethanol), discard the anhydrous ethanol, and place it on a clean bench to air dry.

[0046] b. Take 20 μL of Agrobacterium competent cells GV3101;

[0047] c. Take 0.8 μL of the correctly constructed recombinant plasmid and add it to 20 μL of competent cells. Gently aspirate and mix to avoid generating air bubbles.

[0048] d. Place the washed and dried electric rotary cup in ice to pre-cool it, and then pump the above mixture in against the cup wall;

[0049] e. Adjust the electric rotary instrument to 1800V;

[0050] f. Remove the electric rotary cup from the ice and wipe the outside of the electric rotary cup clean with absorbent paper;

[0051] g. Place the electric rotary cup into the instrument, press the "push" button twice in succession, and you will hear a "beep" sound after a few seconds, indicating success;

[0052] h. After successful electric shock, add 400 μL of antibiotic-free LB to the electric transfer cup, mix well by pipetting, and transfer to a sterile centrifuge tube;

[0053] i. Activate at 28℃ for about 1 hour, take 100 μL and spread it on a plate containing the corresponding resistance, seal it with sealing film, invert it in a 28-degree incubator and incubate for 2 days, then pick up spots for detection.

[0054] (5) Agrobacterium colony detection

[0055] Select colonies and incubate them in double-antibiotic LB solution at 28°C for 1 hour. Take an appropriate amount of bacterial solution for PCR detection and preserve the positive Agrobacterium solution.

[0056] Example 3: Construction of the BnaREM1.3-CRISPR vector

[0057] The BnaREM1.3 mutant of rapeseed was created using the CRISPR-Cas9 system developed by Chen Qijun's team at the College of Biological Sciences, China Agricultural University. The experimental procedures are as follows:

[0058] (1) Log in to the website http: / / www.genome.arizona.edu / crispr / CRISPRsearch.html and screen for target sites GCAGA ...

[0059] (2) Design primers

[0060] DT1-BsF:ATATATGGTCTCGATTGGCAGAAGAGAAGAGAGCAAGTT

[0061] DT1-F0:TGGCAGAAGAGAAGAGAGCAAGTTTTAGAGCTAGAAATAGCDT2-R0:AACTTGACTTCTCACTCTCTTCCAATCTCTAGTCGACTCTACDT2-BsR:ATTATTGGTCTCGAAACTTGACTTCTCACTCTCTTCCAA

[0062] (3) PCR amplification: Four-primer PCR amplification was performed using pCBC-DT1T2 diluted 100-fold as a template. DT1-BsF and DT2-BsR were at normal primer concentrations; DT1-F0 and DT2-R0 were diluted 20-fold. The amplification system was as follows:

[0063]

[0064] PCR amplification program: 98℃ total denaturation for 1 min; 98℃ denaturation for 15 sec, 56℃ annealing for 25 sec, 72℃ extension for 25 sec, 34 circles; 72℃ total extension for 5 min.

[0065] (4) Purify and recover the PCR product, and establish the following restriction-ligation system:

[0066]

[0067]

[0068] Reaction conditions: 5 hours at 37℃, 5 minutes at 50℃, 10 minutes at 80℃

[0069] (5) Transformation of *E. coli* DH5α: Transform 5 μL of *E. coli* competent cells and screen using Kans plate. Positive clones are screened using the following method:

[0070] U626-IDF + U629-IDR = 726bp colony identification by PCR, followed by sequencing of U626-IDF and U629-IDF. The correctly sequenced vector is the CRISPR vector BnaREM1.3.

[0071] Colony PCR and sequencing primers:

[0072] U626-IDF:TGTCCCAGGATTAGAATGATTAGGC

[0073] U629-IDF:TTAATCCAAACTACTGCAGCCTGAC

[0074] U629-IDR:AGCCCTCTTTCTTTCGATCCATCAAC

[0075] (rc:GTTGATGGATCGAAAGAAGAGGGCT)

[0076] (6) The correctly constructed recombinant plasmid vector was introduced into Agrobacterium strain GV3101, and positive single clones were selected and stored at -80°C. The transformation method was the same as in Example 2.

[0077] Example 4 Genetic Transformation Experiment

[0078] (1) Genetic transformation of rapeseed

[0079] Genetic transformation of rapeseed was performed on the constructed BnaC04.REM1.3a overexpression vector and CRISPR vector using Agrobacterium-mediated transformation. The recipient used for rapeseed transformation in this invention was Brassica napus (Westar). For detailed operation procedures, please refer to the reference: An efficient Agrobacterium-mediated transformation method using hypocotyl as explants for Brassica napus.

[0080] (2) Identification of overexpression-transformed single plants

[0081] Genomic DNA was extracted from the rapeseed overexpression transformation plants. The insertion of the exogenous gene fragment was detected by PCR. The overexpression backbone vector in this invention was 35S-pCAMBIA1300S. Primers pCAMBIA1300S Primer-P1 (5'-CCAGGCTTTACACTTTATGC-3') were designed on the backbone vector. PCR was performed using the backbone primers and exogenous fragment primers (pCAMBIA1300S Primer-P1 and BnaREM1.3-KpnⅠ-F, BnaREM1.3-PstⅠ-R sequences are shown in Example 1). Transgenic seedlings were detected at the PCR level. The PCR system was: Taq polymerase Mix 5 μL; pCAMBIA1300S Primer-P1 (10 μmol / L) 0.5 μL; BnaREM1.3-KpnⅠ-F (10 μmol / L) 0.5 μL; gDNA 1 μL; ddH2O 3 μL. PCR conditions: 94℃ total denaturation for 5 min; 94℃ denaturation for 30 sec, 558℃ annealing for 30 sec, 72℃ extension for 30 sec, 34 circles; 72℃ total extension for 5 min.

[0082] qRT-PCR was performed on the transgenic positive rapeseed seedlings obtained by PCR to detect gene expression levels. RNA was extracted from the seeds of the transformed single plants and cDNA was synthesized (method as in Example 1). Quantitative primers were designed using Primer 5 software, with product sizes between 100bp and 200bp. After design, BLAST alignment with a reference sequence was performed to ensure the specificity of primers qREM-F (5'-AAAACCCATTGAGGAGGCCA-3') and qREM-R (5'-GTGCCTTGTTCTCAGCCTTTG-3'). BnaACTIN7-L (5'-CGCGCCTAGCAGCATGAA-3') and BnaACTIN7-R (5'-GTTGGAAAGTGCTGAGAGATGCA-3') were used as internal control primers for qRT-PCR in Brassica napus (see Zhou et al 2012: BnMs3 is required for tapetal differentiation and degradation, microspore separation, and pollen-wall biosynthesis in Brassica napus). The reaction system was as follows:

[0083]

[0084] Reaction program: 94℃ for 30 s; 94℃ for 10 s, 60℃ for 15 s, 72℃ for 30 s, 45 cycles; melting curves were plotted. qRT-PCR was performed on a Bio-Rad CFX96 Real-Time System.

[0085] Standardization was performed based on the internal reference primers, and the quantitative variation among different replicates was measured using delta-deltaathreshold cycle-relative quantification (2). -ΔΔCT The method was used to calculate the results. Finally, the analysis yielded rapeseed overexpression transformation plants OE3, OE6, and OE8 (…). Figure 2 ).

[0086] (3) Identification of CRISPR-transformed single plants

[0087] CRISPR-transformed rapeseed plants were sequenced and screened for mutants. First, the Cas9 protein was identified using primers Cas9-F (5'-AGACCGTGAAGGTTGTGGAC-3') and Cas9-R (5'-TAGTGATCTGCCGTGTCTC-G-3'). Cas9 protein-positive plants were then subjected to specific amplification of the target gene and sequenced for identification. The specific amplification method for the target gene was as follows: BnaA05.REM1.3 was specifically amplified using primers C-REM1.3-A05-F (5'-GGCTTACTTATGTGAACCTCTCCAT-3') and C-REM1.3-A05C04a-R (5'-TTAGAAACATCCACAAGTCGCC-3'); BnaC0 was specifically amplified using primers C-REM1.3-C04a-F (5'-CTGCTTTGCTTCTAAAGCAAAC-3') and C-REM1.3-A05C04a-R (5'-TTAGAAACATCCACAAGTCGCC-3'). 4. REM1.3; BnaA04.REM1.3 was specifically amplified using primers C-REM1.3-A04-F (5'-GCGGTAGTTATACGTTTTCAATG-3') and C-REM1.3-A04C04b-R (5'-TTAGAAACATCCACAAGTCGCC-3'); BnaC04.REM1.3b was specifically amplified using primers C-REM1.3-C04b-F (5'-GCCTTCCTAATTGAAGCGG-3') and C-REM1.3-A04C04b-R (5'-TTAGAAACATCCACAAGTCGCC-3'). The amplification method was the same as shown in Example 4(2).

[0088] The amplified target fragment was sequenced using PCR products. The sequencing results were analyzed using the DSDecode online website (http: / / skl.scau.edu.cn / dsdecode / ) to determine the editing status of the target site. Sequencing results showed that two independent mutant lines (CR1 and CR2) with edited BnaREM1.3 were obtained. The BnaA04.REM1.3, BnaA05.REM1.3, and BnaC04.REM1.3a of both mutants were all edited (…). Figure 3 ).

[0089] (4) Analysis of drought-resistant phenotypes in the transformed plants

[0090] Simultaneously, homozygous mutant, overexpression, and wild-type seeds were harvested from the field and planted in a greenhouse for seedling drought experiments. The greenhouse temperature was kept constant at 25℃, and the light / dark cycle was 16h / 8h. The experiment included a control group and a treatment group, with at least 20 seedlings planted in each line for sampling and survival rate statistics. Both groups of seedlings were watered normally until they reached 3 weeks of age. Then, watering in the treatment group was stopped, and drought treatment began, while the control group received a sufficient water supply. Seven days after drought treatment, phenotypic observation, photography, and sampling were conducted. Drought stress was continued on the seedlings in the treatment groups until most of the lines exhibiting drought sensitivity died. All drought-treated groups were then rehydrated, and survival rates were recorded. The experiment was repeated three times to verify phenotypic and survival rates. Survival rate = number of surviving seedlings / total number of seedlings.

[0091] Indoor drought experiments showed that under normal water supply conditions, 3-week-old seedlings showed no significant difference in growth. After drought stress treatment, both mutant lines exhibited more severe wilting compared to the wild type. Conversely, the two overexpression lines showed stronger drought resistance. After a period of continued treatment, rehydration was performed, and seedling survival was assessed 3 days later. Three days after rehydration, compared to the wild type, the overexpression lines showed more surviving plants, while the mutant lines showed more plant deaths. Figure 4 A). The drought experiment was repeated three times, and the survival rate was recorded each time. The results showed that, compared with wild-type plants, the survival rate of overexpression plants was significantly increased, while the survival rate of mutant plants was significantly decreased. Figure 4 B).

[0092] In conclusion, the gene BnaREM1.3 plays an important role in regulating drought resistance in rapeseed.

[0093] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the description herein, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. Application of the rapeseed BnaREM1.3 gene and its encoded protein in regulating rapeseed drought resistance, wherein the nucleotide sequence of the rapeseed BnaREM1.3 gene is shown in SEQ ID NO:1, and the BnaREM1.3 gene positively regulates rapeseed drought resistance.

2. A method for improving the drought resistance of rapeseed, characterized in that: Using Agrobacterium-mediated genetic transformation, a plant expression vector containing the rapeseed BnaREM1.3 gene was transformed into the rapeseed genome to obtain rapeseed varieties overexpressing the BnaREM1.3 gene. The nucleotide sequence of the rapeseed BnaREM1.3 gene is shown in SEQ ID NO:

1.

3. The method for improving the drought resistance of rapeseed as described in claim 2, characterized in that: The plant expression vector is 35S-pCAMBIA1300S, which contains a constitutive expression promoter and an antibiotic marker.

4. A method for reducing the drought resistance of rapeseed, characterized in that: Using Agrobacterium-mediated genetic transformation, a CRISPR / Cas9 plant gene editing vector targeting the BnaREM1.3 gene of rapeseed was transformed into the rapeseed genome to obtain rapeseed varieties with loss of function of the BnaREM1.3 gene. The nucleotide sequence of the rapeseed BnaREM1.3 gene is shown in SEQ ID NO:

1.

5. The method for reducing drought resistance in rapeseed as described in claim 4, characterized in that: The CRISPR / Cas9 plant gene editing vector is PKSE401.