Method for identifying the genetic relationship and ploidy of hybrid kelp polyploid
By using kelp microsatellite molecular marker (SSR) technology, and employing PCR amplification and electrophoresis detection, the accuracy issues of kelp polyploid kinship and ploidy identification have been resolved, thereby improving kelp breeding efficiency and the reliability of germplasm resource research.
Patent Information
- Application Number
- CN202410245969.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-03-05
- Publication Date
- 2026-03-20
- Estimated Expiration
- 2044-03-05
AI Technical Summary
Existing technologies are insufficient to accurately identify the kinship and ploidy of kelp polyploids. In particular, the small size and large number of kelp chromosomes lead to a high failure rate in chromosome counting methods, and the application of flow cytometry is limited by the difficulty in purifying kelp protoplasts.
Using molecular biology techniques based on kelp microsatellite molecular markers (SSRs), the phylogenetic relationships and ploidy of hybrid kelp polyploids were identified by screening and utilizing SSR markers for PCR amplification and electrophoresis detection.
It enables accurate identification of kelp polyploids, improves breeding efficiency and the reliability of germplasm resource research, and is especially suitable for kelp polyploid breeding.
Smart Images

Figure CN117844970B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of seaweed molecular genetic engineering, and particularly relates to a method for identifying the genetic relationship and ploidy of hybrid kelp polyploids. BACKGROUND
[0002] Kelp is a cold water alga, which is naturally distributed in high latitude sea areas with low water temperature, and belongs to cold zone and sub-cold zone alga. In the late 1950s, Chinese algologists solved a series of technical problems in kelp raft cultivation and carried out genetic improvement. On the basis of genetic research, new varieties suitable for the conditions of China's sea areas were bred. At present, the research on kelp polyploidy technology has become a trend.
[0003] Polyploidy is formed by doubling of chromosomes in cells. As one of the methods for improving crop germplasm, polyploidy breeding technology has been widely used in terrestrial higher plants and aquatic economic animals, and economic benefits have been achieved. By using the low fertility of polyploids, the reproductive energy can be converted into growth, so that the growth is rapid, the growth cycle is prolonged, and the individual is increased. Therefore, the research on kelp polyploidy technology provides a new way to improve kelp germplasm.
[0004] At present, there are two methods for determining the ploidy of plant polyploids. One is to count chromosomes by using conventional pressing method and wall-removing hypotonic method. This method is relatively direct, but because the chromosomes of kelp are small in number and there are differences in chromosome preparation methods, the chromosome counting method is not only tedious, but also the number of kelp chromosomes is controversial, which will increase the failure rate of counting method. The other is to use flow cytometry to study polyploidy from the molecular biology level. The DNA content of the control sample and the experimental sample is determined by flow cytometry, and the ploidy of polyploidy is inferred by comparing the DNA content. The sample on the flow cytometer generally uses kelp protoplast suspension or cell nucleus suspension, but the content of kelp alginate is high, which makes it difficult to purify kelp protoplasts or cell nuclei, and the quantity does not meet the requirements, thereby limiting the application of this technology in the determination of kelp polyploidy. SUMMARY
[0005] The technical problem to be solved by the present application is to provide a method for identifying the genetic relationship and ploidy of hybrid kelp polyploids. Based on the molecular biology technology of kelp microsatellite molecular markers (SSR), the genetic relationship of kelp hybrid combinations is identified, and the ploidy of hybrid kelp polyploids is accurately identified from the molecular level.
[0006] The technical scheme of the present application is as follows:
[0007] A method for identifying the genetic relationship and ploidy of hybrid kelp polyploids,
[0008] First, the cultivation of hybrid kelp polyploid: kelp young sporophytes are induced to obtain kelp diploid filaments, the gender of the kelp induced filaments is determined to determine the gender role of the kelp induced filaments in hybrid combination, and hybrid kelp polyploids are obtained through hybridization experiments;
[0009] Second, the screened SSR markers are used for PCR amplification of the parents of the hybrid combination and the cultivated hybrid kelp polyploid offspring, and the PCR amplification is detected by electrophoresis, thereby identifying the genetic relationship of the hybrid kelp polyploid and identifying the ploidy of the hybrid kelp polyploid;
[0010] Among them, the screened kelp SSR markers require that the DNA of the parents of the hybrid combination is amplified by PCR using the SSR markers and detected by electrophoresis, and there are bands that can distinguish the parents of the hybrid combination. At the same time, the screened kelp SSR markers require that the parents of different ploidy in the hybrid combination are amplified by PCR using the SSR markers, and the number of allelic bands corresponding to the ploidy of the parents is amplified at the same SSR site, and the multiple allelic bands of the site do not coincide when detected by electrophoresis.
[0011] The preferred steps are as follows:
[0012] First step: Cultivation of hybrid kelp polyploid:
[0013] (1) Induction of kelp diploid filaments
[0014] The kelp young spore explants are placed in a culture container, culture solution is added, and the culture is carried out in a light incubator.
[0015] (2) Gender determination to determine the gender role of kelp induced filaments in kelp hybrid combination
[0016] The kelp induced filaments are amplified by PCR using the female and male specific primers provided by the molecular biology laboratory, and the PCR amplification bands are detected by electrophoresis, and negative controls and kelp female and male gamete positive controls are set to ensure the accuracy of gender determination.
[0017] (3) Cultivation of hybrid kelp polyploid
[0018] Hybridization of kelp induced filaments with normal kelp haploid gametes or with kelp induced filaments and cultivation of hybrid kelp polyploid offspring are carried out.
[0019] Second step, molecular identification of the genetic relationship and ploidy of hybrid kelp polyploid:
[0020] (1) Screening of kelp SSR markers
[0021] Extract DNA of the parents and offspring of the kelp hybrid combination respectively; select several pairs of SSR primers to detect the bands of the parents of the hybrid combination, and select at least three pairs of SSR primers capable of distinguishing the parents; the selected SSR primers require that the parents of the hybrid combination use the SSR primers for PCR reaction, and can amplify non-coincident allelic bands; the selected SSR primers also require to meet the following requirements: using the selected kelp SSR primers to perform PCR amplification on the parents of different ploidy in the hybrid combination, at the same SSR primer site, the number of allelic bands corresponding to the ploidy of the parents should be amplified respectively, and the multiple allelic bands at the site do not coincide when detected by electrophoresis;
[0022] (2) Using kelp SSR markers to identify the genetic relationship and ploidy of the hybrid kelp polyploid
[0023] If the selected SSR primers are used for PCR amplification on the parents and offspring of the kelp hybrid combination, the hybrid kelp polyploid offspring has the corresponding multiple allelic bands amplified by the parents at the SSR site, then the genetic relationship between the hybrid kelp polyploid and the parents is determined, and the ploidy of the hybrid kelp polyploid is also determined.
[0024] Compared with the prior art, the present application has the following beneficial effects:
[0025] First, after obtaining the kelp diploid filament, the gender of the kelp induced filament is identified by using molecular biology methods and kelp gametophyte male and female specific primers, and negative control and kelp female and male gametophyte control are set to ensure the accuracy of gender identification. Since the kelp induced filament is observed by microscope, it is basically a mixture of male and female, and the proportion of female and male in the kelp induced filament of different varieties is not fixed. Some varieties of kelp induced filament have a high proportion of females, while some varieties of kelp induced filament have a high proportion of males. Through gender identification, the gender role of the kelp induced filament in the hybrid combination is determined to improve the breeding efficiency.
[0026] Second, the genetic relationship of the kelp hybrid combination is identified by kelp SSR markers. First, SSR primers capable of amplifying and significantly distinguishing the parents are selected. The SSR primers meeting the conditions should be at least three pairs, and the experimental results should be consistent to ensure the reliability of the genetic relationship identification. If the offspring has the same allelic bands as the parents at the site, the genetic relationship between the parents and the offspring can be determined, and the success of the hybridization is proved. The identification of the genetic relationship can determine the reliability of the source of the hybrid kelp polyploid, and is also a prerequisite for ensuring the accuracy of the ploidy identification result of the hybrid kelp polyploid.
[0027] Third, the use of kelp SSR markers to identify hybrid kelp polyploidy. In identifying the relationship between the parents and offspring of kelp hybrid combinations, the screened SSR primers are required to be able to distinguish the parents of the kelp hybrid combination, i.e. using the screened SSR primers to amplify the parents of the hybrid kelp polyploid, requiring the amplification of non-coincident alleles of the male and female parents at the same SSR site. If further distinction is required, the screened kelp SSR primers are used to PCR amplify the parents of different ploidy in the hybrid combination, and the number of alleles corresponding to their ploidy is required to be amplified at the same SSR primer site, and the multiple alleles of the site are detected by 6% denaturing polyacrylamide gel electrophoresis. The screened SSR primers are used to detect their hybrid offspring, and if the offspring have the corresponding multiple alleles amplified by the parents after amplification, it can be proved that the hybridization is successful, and the ploidy of the hybrid kelp polyploid can be accurately and intuitively identified. This method of molecular identification of the ploidy of the hybrid kelp polyploid is especially suitable for kelp polyploid hybrid breeding. This method provides technical support and convenience for improving and enriching the research of kelp germplasm resources, especially the research of kelp polyploid breeding. BRIEF DESCRIPTION OF DRAWINGS
[0028] Figure 1 is the PCR amplification result diagram of 20 female characteristic kelp induced filaments (numbered 1-20 in the figure) and 20 male characteristic kelp induced filaments (numbered 21-40 in the figure) of Dongfang No. 2 kelp induced filaments in the invention embodiment.
[0029] Figure 2 is a real picture of an individual of the hybrid offspring of the female Dongfang No. 2 kelp induced filament and the male gametophyte of Japanese true kelp in the invention embodiment.
[0030] Figure 3 is a picture of 6% denaturing polyacrylamide gel electrophoresis detection of the relationship and ploidy identification of the hybrid offspring of the female Dongfang No. 2 kelp induced filament and the male gametophyte of Japanese true kelp using the screened 3 pairs of SSR markers in the invention embodiment. DETAILED DESCRIPTION
[0031] The basic steps of the invention are as follows:
[0032] First step, cultivation of hybrid kelp polyploid:
[0033] (1) Induction of kelp diploid filament
[0034] Put the young spore of kelp in the culture dish, add 2% PESI culture solution and culture in the light incubator; replace the culture solution regularly and examine under microscope, brown filamentous mass can be seen around the kelp explant; peel off the filamentous mass from the explant with sterilized blade and culture to the required amount for normal seedling cultivation;
[0035] (2) Gender identification to determine the gender role of kelp induced filamentous body in kelp hybridization combination
[0036] PCR amplify the kelp induced filamentous body with the female and male specific primers provided by the molecular biology laboratory, and detect the PCR amplified bands by 1.5% agarose gel electrophoresis, while setting negative control, kelp female and male gametophyte positive control to ensure the accuracy of gender identification.
[0037] (3) Cultivation of hybrid kelp polyploids
[0038] Hybridize the kelp induced filamentous body with normal kelp haploid gametophyte or with kelp induced filamentous body and obtain hybrid kelp polyploid offspring through cultivation.
[0039] Second step, molecular identification of the genetic relationship and ploidy of hybrid kelp polyploids:
[0040] (1) Screening of kelp SSR markers
[0041] Extract the DNA of the parents and offspring of the kelp hybridization combination to ensure the quality of the DNA; select several pairs of SSR primers to detect the parent bands of the hybridization combination, and screen out several pairs of SSR primers (at least 3 pairs) that can distinguish the parents; the screened SSR primers require that the father and mother of the hybridization combination can amplify non-coincident allelic bands using the SSR primers; to achieve the purpose of distinguishing ploidy, the screened SSR primers also require, for example, in the experiment of selecting kelp induced diploid filamentous body and kelp haploid gametophyte as the parents of the hybridization combination, the kelp induced diploid filamentous body requires two non-coincident allelic bands at the site when amplified by the primer, the kelp haploid gametophyte requires one allelic band at the site when amplified by the primer, and the above three allelic bands at the site are non-coincident; that is, using the screened kelp SSR primers to PCR amplify the parents of different ploidy in the hybridization combination, the number of allelic bands corresponding to the ploidy at the same SSR primer site should be amplified, and the multiple allelic bands at the site should be non-coincident when detected by 6% denaturing polyacrylamide gel electrophoresis.
[0042] (2) Genetic relationship identification and ploidy identification of hybrid kelp polyploids using kelp SSR markers
[0043] The parent and offspring individuals of the kelp hybrid combination are subjected to PCR amplification by using the screened SSR primer, and the offspring has the same allele bands as the parent after amplification, that is, the hybrid kelp polyploid offspring has the corresponding multiple allele bands amplified by the parent and the female parent at the same time, so that the genetic relationship between the hybrid kelp polyploid and the parent can be determined, and the ploidy of the hybrid kelp polyploid can also be determined. If the hybrid kelp polyploid offspring has no site in common with the parent, has redundant or missing sites, it is considered that they have no genetic relationship.
[0044] The application will be further described below in combination with examples.
[0045] Determination of ploidy of offspring of hybridization between female filamentous body induced from kelp Dongfang No. 2 and male gametophyte of Japanese true kelp (Dong2 filamentous female x S. jap 1206001, 2021, 52 # combinations of kelp hybrid breeding experiments
[0046] 1. Induction of diploid filamentous body of kelp Dongfang No. 2
[0047] The kelp Dongfang No. 2 young spore explant is placed in a culture dish, 2% PESI seawater culture solution is added, and then culture is carried out in a light incubator, the culture temperature is 15℃, the light intensity is 36µmol / (m 2 ·s), and the light cycle is 10L:14D; the PESI seawater culture solution is replaced every 10 days for the first two months; every 30 days for the 3rd to 4th months; and then every 60 days, until brown filamentous body groups can be seen around the kelp Dongfang No. 2 explant under a microscope, which is the kelp filamentous body group obtained by inducing kelp Dongfang No. 2 somatic cells.
[0048] 2. Obtaining of single cell clone group of kelp Dongfang No. 2 induced filamentous body
[0049] The induced filamentous body group is peeled off from the kelp Dongfang No. 2 young spore explant with a sterilized blade, cut into multiple cell groups, transferred into a 100mL conical flask, and placed in a light incubator for expansion culture, the culture solution is 2% PESI seawater culture solution, the culture temperature is 10℃, the light intensity is 25µmol / (m 2 ·s), and the light is on for 24h every day, the PESI seawater culture solution is replaced every 10 days, and the culture is carried out to the conventional preservation amount. Under 100x microscope (OLYMPUS CX22LED), the kelp Dongfang No. 2 induced filamentous body is examined, and it is found that part of the cells of the induced filamentous body are thick, showing female characteristics; part of the cells of the induced filamentous body are small, showing male characteristics, but the induced filamentous body showing female characteristics is obviously more than the induced filamentous body showing male characteristics.
[0050] Take the East No. 2 kelp induced filament with 400 mesh screen silk filter to remove the culture solution, using a sterile thick glass plate repeatedly grinding filament, the ground filament with PESI seawater medium rinse to 400 mesh screen silk and filter, the filtrate into the culture dish (φ9 cm), under 100x lens using elongated capillary glass tube needle pick single cell, placed on the cover glass on the sterilization of small cover glass, once again mirror confirmed that the water droplet only target single cell, the small cover glass with sterilized forceps into the test tube in advance into the final concentration of 2% PESI seawater medium, female characteristic cells and male characteristic cells were picked 20, the culture temperature was 10℃, the light intensity was 20µmol / (m 2 ·s), every day 24h light, until the test tube grow out visible brown filamentous small clone group, only then began to replace the culture medium every 20 days, regular expansion, culture to conventional breeding amount.
[0051] 3, gender identification to determine the role of kelp induced filament in hybrid combination
[0052] Using plant genomic DNA extraction kit (Tiangen, China) to extract the genomic DNA of kelp induced filament, using 1% agarose gel electrophoresis and ultraviolet spectrophotometer to detect its quality and concentration, according to the measured sample quality and concentration, the sample was diluted to 50 ng / μL, -20℃ for reserve.
[0053] The female and male specific primers HFM4 (F: CATGCCGCGACAT ACTGATA, R: ACCCTTCAGGGGCTCAAGTA) and Hxt (F: GTGGCC AGCCTACACTCACT, R: CCTTCTCGTAGCG TTCCTTG) were used to amplify the 20 female characteristic kelp induced filament clones and the 20 male characteristic kelp induced filament clones, and negative control and female and male gametophyte positive controls were set to ensure the accuracy of gender identification. The PCR reaction system was 2x EasyTaq PCR SuperMix (+dye) 10 μL, 10 μmol / L upper and lower primers 0.5 μL each, 50 ng template DNA 1 μL, and ddH2O up to 20 μL. The PCR reaction program was 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 58°C annealing for 1 min, 72°C extension for 1 min, 40 cycles; 72°C extension for 10 min, 4°C incubation. The amplification products were electrophoresed on a 1.5% agarose gel. The electrophoresis results showed that the 20 female characteristic kelp induced filament clones all amplified female specific bands, while the 20 male characteristic kelp induced filament clones all amplified female and male specific bands, and the negative control and positive controls all amplified normally. This indicates that the 20 female characteristic kelp induced filament clones are pure female, while the 20 male characteristic kelp induced filament clones are a mixture of female and male, indicating that female induced filaments dominate in the East No. 2 kelp induced filaments.
[0054] Figure 1 The 20 female characteristic kelp induced filament clones (Fig. 1-20) and the 20 male characteristic kelp induced filament clones (Fig. 21-40) of East No. 2 kelp induced filament separation were identified by female and male specific primers HFM4 and Hxt. Y represents the negative control; ♀ represents the female positive control; ♂ represents the male positive control; 1-20 are the 20 female characteristic kelp induced filament clones of East No. 2 kelp induced filament separation, and 21-40 are the 20 male characteristic kelp induced filament clones of East No. 2 kelp induced filament separation; M is the marker I. The negative control does not appear to be amplified, indicating that the gender identification reaction system is not contaminated; the female positive control amplifies the target band, and the female target band is about 550 bp; the male positive control also amplifies the target band, and the male target band is about 320 bp; only the female target band is amplified for No. 1-20, so the No. 1-20 filament is the female of East No. 2 kelp induced filament; the female and male target bands are amplified for No. 21-40, so the No. 21-40 filament contains both female and male filaments, and is a mixture of female and male, which further indicates that the female induced filament dominates in the East No. 2 induced filament. Trans DNA Maker I. The negative control does not appear to be amplified, indicating that the gender identification reaction system is not contaminated; the female positive control amplifies the target band, and the female target band is about 550 bp; the male positive control also amplifies the target band, and the male target band is about 320 bp; only the female target band is amplified for No. 1-20, so the No. 1-20 filament is the female of East No. 2 kelp induced filament; the female and male target bands are amplified for No. 21-40, so the No. 21-40 filament contains both female and male filaments, and is a mixture of female and male, which further indicates that the female induced filament dominates in the East No. 2 induced filament.
[0055] 4. Cultivation of hybridized laminaria multivalent
[0056] In mid-to-late August 2020, female induced filament of Dongfang No. 2 and male haploid gametophyte of Japanese true laminaria were selected as the parents of hybridization combination to carry out hybridization and obtain laminaria sporophyte offspring through cultivation. The specific operation is as follows: 0.10 g (dry weight) of female induced filament of Dongfang No. 2 and 0.05 g (dry weight) of male gametophyte of Japanese true laminaria were weighed and mixed into appropriate amount of pre-cooled sterilized seawater, resuspended and mixed uniformly, cut for 30-60 s by a tissue crusher, filtered through a 400 mesh silk screen, uniformly attached to a 10-meter nylon rope woven seedling screen, and placed on a glass slide for preliminary microscopic observation, placed in a white water tank in the Muping refrigerator, the water temperature was 6-10℃, the initial light intensity was 40 µmol / (m 2 ·s), the light intensity was increased by 6-8 µmol / (m 2 ·s) every 7 days, the light-dark ratio was 12L:12D, and the nutrient salt was N / P culture solution (N:P=10:1). In the first month of seedling culture, the culture solution was replaced twice a week, the seedling screen was washed once a week from the 8th row of sporophytes and the water was replaced twice, from about 0.5 mm of sporophytes, the seedling screen was washed twice a week and the water was replaced three times, the seedling screen was agitated every day to remove air bubbles, and when the sporophytes grew to about 1-2 cm, they were taken out of the tank in mid-to-late October and placed in the sea experimental area for growth, and were labeled.
[0057] The preparation method of the N / P culture solution is as follows: 121 g of sodium nitrate is weighed, dissolved in sterilized seawater, and then diluted to 500 ml with sterilized seawater to obtain a sodium nitrate solution; 17.5 g of potassium dihydrogen phosphate is weighed, dissolved in sterilized seawater, and then diluted to 1000 ml with sterilized seawater to obtain a potassium dihydrogen phosphate solution; 1 ml of the sodium nitrate solution and 1 ml of the potassium dihydrogen phosphate solution are measured and added to 4000 ml of sterilized seawater, and then shaken to obtain the N / P nutrient solution.
[0058] Figure 2 No. 2 and No. 7 are the individuals No. 2 and No. 7 of the hybrid offspring of the female induced filament of Dongfang No. 2 laminaria and the male gametophyte of Japanese true laminaria taken back from the growth experimental sea area in August 2022.
[0059] 5. Screening of laminaria SSR primers
[0060] The plant genomic DNA extraction kit (Tiangen, China) was used to extract the DNA of the female induced filament of Dongfang No. 2 and the male gametophyte of Japanese true laminaria, and 1% agarose gel electrophoresis and ultraviolet spectrophotometer were used to detect the quality and concentration of the DNA. According to the measured quality and concentration of the sample, the sample was diluted to 50 ng / µL and stored at -20℃ for standby use.
[0061] Three pairs of SSR primers which could amplify and distinguish the parents were screened from the kelp microsatellite marker library constructed by the molecular biology laboratory, which were zpsj7 (F: CGTCGTCCATGTCTTTTCCT, R: TCCATCTATTCATGCTCGCG), zpsj35 (F: CACCCACGATCTAATCCCC, R: GTCGTGGAAAGGCAGAGAC), zpsj54 (F: GCTGCGAAGGTGATTTCA, R: AGCTGTTACAAATGGGGC). The PCR reaction system was as follows: 2 × EasyTaq PCR SuperMix (+dye) 10 μL, 10 μmol / L upper and lower primers 0.5 μL each, 50 ng of template DNA 1 μL, and ddH2O was added to 20 μL. The PCR reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 1 min, 72℃ extension for 1 min, 40 cycles; 72℃ extension for 10 min, 4℃ incubation. The amplification products were detected by 1.5% agarose gel electrophoresis and 6% denaturing polyacrylamide gel electrophoresis, respectively.
[0062] 6. Using the screened kelp SSR primers to identify the genetic relationship while identifying the ploidy of the hybrid kelp
[0063] In mid-April 2021, 17 strains of spore body samples of the kelp hybrid combination were retrieved from the sea experimental area and labeled as No. 1-17 (consistent with the sea area number). The DNA of the 17 strains of spore body offspring was extracted using the Tian Gen plant genome DNA extraction kit to ensure the quality of the DNA. The zpsj7, zpsj35, and zpsj54 three pairs of SSR primers were used for PCR amplification in the hybrid combination parents and offspring. The PCR reaction system and reaction conditions were the same as those in the SSR primer screening in Example 5. Generally, the spore body offspring of the kelp hybrid combination amplified by the SSR primer has the same allelic band as the parent, which contains both the maternal allelic band and the paternal allelic band, and can determine the genetic relationship between the parent and the offspring. If the offspring does not match the parent band, they are considered to have no genetic relationship. After PCR amplification and 6% denaturing polyacrylamide gel electrophoresis detection, the results showed that 13 of the 17 hybrid kelp spores, No. 1-7, No. 10, No. 12-16, were the offspring of the female induced filamentous body of Dongfang No. 2 and the haploid male gametophyte of Japanese true kelp, which had the same allelic band as the parent. No. 8, No. 9, No. 11, and No. 17 were not the offspring of the parent. Compared with the parent, the four kelp spores had deletions or appeared allelic bands that were not amplified in the parent. Moreover, the amplification results of the three pairs of SSR primers were consistent.
[0064] The 3 pairs of SSR primers zpsj7, zpsj35 and zpsj54 screened out were used to amplify the female of the induced filament of Dongfang 2, and 2 non-coincident allelic bands were amplified at the 3 SSR loci, which was consistent with the fact that the female of the hybrid combination was diploid. The 3 pairs of SSR primers were used to amplify the male gametophyte of Japanese true kelp, and 1 allelic band was amplified, which was consistent with the fact that the male parent was haploid. The 3 allelic bands of each SSR locus were non-coincident. The 13 hybrid kelp polyploids of the hybrid offspring of the female of the induced filament of Dongfang 2 and the haploid male gametophyte of Japanese true kelp, i.e. Nos. 1-7, 10, 12-16, had 3 allelic bands of the female and male parents at the 3 different SSR loci, which not only indicated that the 13 kelp sporophytes were the offspring of the hybrid combination, but also confirmed that the 13 kelp sporophytes were triploid hybrid kelp and polyploid kelp. The ploidy of the polyploid kelp was identified at the molecular level by using the kelp microsatellite molecular marker, which was not only intuitive but also more accurate.
[0065] The 3 pairs of SSR primers zpsj7, zpsj35 and zpsj54 screened out were used to amplify the female of the induced filament of Dongfang 2, and 2 non-coincident allelic bands were amplified at the 3 SSR loci, which was consistent with the fact that the female of the hybrid combination was diploid. The 3 pairs of SSR primers were used to amplify the male gametophyte of Japanese true kelp, and 1 allelic band was amplified, which was consistent with the fact that the male parent was haploid. The 3 allelic bands of each SSR locus were non-coincident. The 13 hybrid kelp polyploids of the hybrid offspring of the female of the induced filament of Dongfang 2 and the haploid male gametophyte of Japanese true kelp, i.e. Nos. 1-7, 10, 12-16, had 3 allelic bands of the female and male parents at the 3 different SSR loci, which not only indicated that the 13 kelp sporophytes were the offspring of the hybrid combination, but also confirmed that the 13 kelp sporophytes were triploid hybrid kelp and polyploid kelp. The ploidy of the polyploid kelp was identified at the molecular level by using the kelp microsatellite molecular marker, which was not only intuitive but also more accurate. # The genetic relationship and ploidy of the hybrid offspring of the female of the induced filament of Dongfang 2 and the male gametophyte of Japanese true kelp were identified by using the 3 pairs of SSR markers screened out. Figure 3 The picture of 6% denaturing polyacrylamide gel electrophoresis for the genetic relationship and ploidy identification of the hybrid offspring of the female of the induced filament of Dongfang 2 and the male gametophyte of Japanese true kelp by using the 3 pairs of SSR markers screened out. In the figure, ♀ represents the female parent amplification band of the 52 # combination of the kelp hybrid breeding experiment, and ♂ represents the male parent amplification band of the 52 # combination of the kelp hybrid breeding experiment; it can be seen from the figure that the female parent, the female of the induced filament of Dongfang 2, was diploid, and the male parent, the male gametophyte of Japanese true kelp, was haploid. 4 strains, i.e. Nos. 8, 9, 11 and 17, were not the offspring of the parents, and 13 strains, i.e. Nos. 1-7, 10, 12-16, had the same allelic bands as the parents at the 3 SSR loci, which proved that the 13 kelp sporophytes were not only the offspring of the female of the induced filament of Dongfang 2 and the haploid male gametophyte of Japanese true kelp, but also triploid; the amplification results of the 3 pairs of SSR primers were consistent.
Claims
1. A method for identifying the phylogenetic relationship and ploidy of hybrid kelp polyploids, characterized in that: Step 1: Cultivation of hybrid kelp polyploids: (1) Induction of diploid filaments of kelp No. 2 The explants of larval spores of Kelp No. 2 were placed in a culture container, culture medium was added, and cultured in a light incubator. (2) Sex determination to identify the sex role of kelp-induced filaments in kelp hybridization combinations PCR amplification of kelp induced filaments was performed using specific primers for female and male kelp gametophytes provided by the molecular biology laboratory, and the PCR amplification bands were detected by electrophoresis. At the same time, negative controls and positive controls for female and male kelp gametophytes were set up to ensure the accuracy of sex identification. (3) Cultivation of hybrid kelp polyploids Female kelp induced filaments of Dongfang No. 2 and haploid male gametophytes of Japanese true kelp were selected as parents for hybridization and kelp sporophyte progeny were obtained through cultivation; Step 2: Phylogenetic and molecular identification of polyploid hybrid kelp: (1) Screening of SSR primers for kelp DNA was extracted from the parents and offspring of the kelp hybrid combination. Three pairs of SSR primers (zpsj7, zpsj35, and zpsj54) were selected to detect the parental bands of the hybrid combination. The primer sequence for zpsj7 was F: CGCCGTCCATGTCTTTTCCT, R: TCCATCTATTCATGCTCGCG; the primer sequence for zpsj35 was F: CACCCACGATCTAATCCCC, R: GTCGTGGAAAGGCAGAGAC; and the primer sequence for zpsj54 was F: GCTGCGAAGGTGATTTCA, R: AGCTGTTACAAATGGGGC. (2) Identification of kinship and ploidy of hybrid kelp polyploids using kelp SSR primers The three pairs of SSR primers zpsj7, zpsj35, and zpsj54 selected were used for PCR amplification in the parent and offspring individuals of the kelp hybrid combination. Each locus simultaneously showed three allele bands from the parent hybrid combination, indicating that the kelp sporophyte is a descendant of the hybrid combination and confirming that the kelp sporophyte is a triploid hybrid kelp, which is a polyploid kelp.
Citation Information
Patent Citations
Kelp gametophyte DNA solution preparation method and sex determination method
CN108531478A
Cultivation method and application of tetraploid hybrid kelp
CN117296702A