Wheat seed dormancy gene ta cdpk5-6b, caps marker thereof and application thereof

By developing the wheat seed dormancy gene TaCDPK5-6B and its CAPS marker, the problem of reduced yield and quality caused by wheat ear sprouting was solved, and effective identification of ear sprouting resistance and gene editing breeding were achieved, thereby improving the wheat seed's resistance to ear sprouting.

CN117987429BActive Publication Date: 2026-04-21ANHUI AGRICULTURAL UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202410339060.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-03-25
Publication Date
2026-04-21
Estimated Expiration
2044-03-25

AI Technical Summary

Technical Problem

In existing technologies, wheat seeds are prone to germination in the ear under rainy or humid conditions, which leads to reduced yield and quality. There is a lack of effective seed dormancy genes and molecular markers for breeding to resist germination in the ear.

Method used

The wheat seed dormancy gene TaCDPK5-6B and its CAPS marker were discovered and validated. By designing specific primers and restriction endonucleases, a CAPS marker capable of distinguishing between pre-sprouting resistance and susceptibility was developed for identifying pre-sprouting resistance in wheat varieties.

Benefits of technology

This method effectively distinguishes and identifies the germination resistance of wheat varieties, provides genetic resources for breeding highly resistant germination varieties through gene editing, reduces the germination level of wheat seeds, and improves the ability to resist germination.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117987429B_ABST
    Figure CN117987429B_ABST
Patent Text Reader

Abstract

The application discloses a wheat seed dormancy gene TaCDPK5-6B, a CAPS marker and application thereof, relates to the technical field of plant genetic breeding, and the nucleotide sequence of the wheat seed dormancy gene TaCDPK5-6B is shown as SEQ ID NO. 1. The application finds that the wheat seed dormancy gene TaCDPK5-6B can promote wheat seed germination, the deletion of the wheat seed dormancy gene TaCDPK5-6B can reduce the wheat seed germination level, two CAPS markers for identifying wheat ear germination resistance / sensitivity are designed, the two CAPS markers are significantly related to seed dormancy, and the seed germination index GI of a family carrying an HMC21 genotype is significantly smaller than the GI of a family carrying a J411 genotype. The two CAPS markers developed by the application can effectively distinguish wheat varieties of ear germination resistance / sensitivity types.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetics and breeding technology, specifically to a wheat seed dormancy gene TaCDPK5-6B and its CAPS marker and application. Background Technology

[0002] Wheat is an important source of protein, dietary fiber, B vitamins, minerals, and other phytochemicals in the human diet. However, if prolonged rainy or humid weather occurs during the wheat harvest season, the seeds are highly susceptible to germination directly on the wheat ears, a phenomenon known as ear sprouting or ear budding. Severe ear sprouting significantly reduces yield, quality, and seed viability. In cases of severe germination and rotting, the seeds become unsuitable even for animal feed, causing substantial economic losses to agricultural production.

[0003] Seed dormancy is closely related to resistance to pre-sprouting. Wheat varieties with high seed dormancy levels have stronger resistance to pre-sprouting, and vice versa. Therefore, the most effective way to reduce the damage caused by pre-sprouting is to breed new wheat varieties with high seed dormancy levels that are resistant to pre-sprouting. Thus, identifying seed dormancy genes and developing molecular markers is of great significance for breeding new wheat varieties resistant to pre-sprouting through gene aggregation breeding. However, there are relatively few seed dormancy-related genes identified in wheat, including TaVp-1, TaMFT / TaPHS1, TaMKK3-A, TaSdr, TaQsd1, TaMyb10-D, and Tapi4K-2A, which seriously hinders the progress of molecular aggregation breeding for wheat resistance to pre-sprouting. Summary of the Invention

[0004] To overcome the shortcomings of the prior art, the purpose of this invention is to provide a wheat seed dormancy gene TaCDPK5-6B and its CAPS marker and application.

[0005] The present invention achieves the above objectives through the following technical solutions:

[0006] This invention provides the application of the wheat seed dormancy gene TaCDPK5-6B in regulating plant seed dormancy and germination. The nucleotide sequence of the wheat seed dormancy gene TaCDPK5-6B is shown in SEQ ID NO.1. The wheat seed dormancy gene TaCDPK5-6B promotes wheat seed germination, and the deletion of the wheat seed dormancy gene TaCDPK5-6B reduces the level of wheat seed germination.

[0007] As a further optimization of the present invention, the plant is wheat, rice or Arabidopsis thaliana.

[0008] A CAPS marker designed based on the wheat seed dormancy gene TaCDPK5-6B for identifying wheat spike germination resistance / susceptibility, the CAPS marker comprising:

[0009] Primers used to amplify the nucleotide sequences of two polymorphic sites, CDPK5-6B-1516 at position -1516 and CDPK5-6B-1166 at position -1166, in the regulatory region of the TaCDPK5-6B gene. The base type of the polymorphic site CDPK5-6B-1516 is G or A, and the base type of the polymorphic site CDPK5-6B-1166 is T or C.

[0010] Restriction endonucleases used to verify the base type of the polymorphic site of CDPK5-6B-1516;

[0011] Restriction endonuclease used to verify the base type of the polymorphic site of CDPK5-6B-1166.

[0012] As a further optimization of the present invention, the restriction endonuclease used to verify the CDPK5-6B-1516 base type is MboI, and the restriction endonuclease used to verify the CDPK5-6B-1166 base type is BtgI.

[0013] As a further optimization of the present invention, the two polymorphic sites are located on the promoter of the TaCDPK5-6B gene.

[0014] An application of the above-mentioned CAPS marker in identifying wheat varieties resistant to or susceptible to bud break: when the base types of CDPK5-6B-1516 and CDPK5-6B-1166 are A and C, respectively, the wheat is a bud break resistant variety; when the base types of CDPK5-6B-1516 and CDPK5-6B-1166 are G and T, respectively, the wheat is a bud break susceptible variety.

[0015] As a further optimization of the present invention, the promoter sequence of the TaCDPK5-6B gene in wheat resistant to pre-sprouting (Hongmangchun 21, HMC21, resistant to pre-sprouting and resistant to PHS) is shown in SEQ ID NO.2; and the promoter sequence of the TaCDPK5-6B gene in wheat susceptible to pre-sprouting (Jing 411, J411, susceptible to pre-sprouting and PHS) is shown in SEQ ID NO.3.

[0016] A method for identifying wheat ear germination resistance / susceptibility using the aforementioned CAPS markers comprises the following steps:

[0017] S1. Extract total RNA from wheat seeds and reverse transcribe it into cDNA;

[0018] S2. Using the nucleotide sequence composed of the upstream and downstream bases at the positions of CDPK5-6B-1516 and CDPK5-6B-1166 as the amplification template, CAPS primers were designed and PCR amplification was performed to obtain an amplification product containing two polymorphic sites.

[0019] S3. Verify the genotype of CDPK5-6B-1516 using the restriction endonuclease MboI, and verify the genotype of CDPK5-6B-1166 using the restriction endonuclease BtgI. If the genotypes of CDPK5-6B-1516 and CDPK5-6B-1166 are A and C respectively, the wheat is a variety resistant to ear sprouting. If the genotypes of CDPK5-6B-1516 and CDPK5-6B-1166 are G and T respectively, the wheat is a variety susceptible to ear sprouting.

[0020] As a further optimization of the present invention, the CAPS primer is:

[0021] SEQ ID NO.8: CDPK5-6B-1516-F: 5'GAGGCTTACTAGGGACACGA 3';

[0022] SEQ ID NO. 9: CDPK5-6B-1516-R: 5'CAACAAAGAAAAGACGGAAG 3'.

[0023] SEQ ID NO.10: CDPK5-6B-1166-F: 5'TCAACAAAGAAAAGACGGA 3';

[0024] SEQ ID NO. 11: CDPK5-6B-1166-R: 5'TCTTCTGCTGCCCCTG 3'.

[0025] The present invention has the following beneficial effects:

[0026] 1) This invention discovered a gene, TaCDPK5-6B, related to seed dormancy and germination. The germination rate of wild-type J411 wheat seeds was higher than that of mutant taCDPK5-6B-j411 wheat seeds. The relative expression level of TaCDPK5-6B in wild-type J411 wheat seeds was significantly higher than that in mutant taCDPK5-6B-j411 wheat seeds. This indicates that the TaCDPK5-6B gene can release wheat seed dormancy and promote wheat seed germination. The deletion of the wheat seed dormancy gene TaCDPK5-6B will reduce the germination level of wheat seeds. This discovery provides a new gene resource for breeding wheat varieties with high resistance to pre-harvest sprouting through gene editing methods.

[0027] 2) This invention is based on the G / A base variation at position 1516 and the T / C base variation at position 1166 of the wheat seed dormancy gene TaCDPK5-6B, which caused changes in the cis element. Specific primers were designed and CAPS markers (TaCDPK5-6B-1516 and TaCDPK5-6B-1166) were developed. These CAPS markers were then used to detect and determine wheat spike germination resistance. In particular, the recombinant inbred line population constructed using J411 and HMC21 verified that the two CAPS markers developed in this invention were significantly associated with seed dormancy. Specifically, the germination index (GI) of families carrying the HMC21 genotype was significantly lower than that of families carrying the J411 genotype, indicating that the two CAPS markers developed in this invention can effectively distinguish wheat varieties with spike germination resistance / susceptibility (or strong / weak dormancy) types. Attached Figure Description

[0028] Figure 1 This is a graph showing the expression analysis of the TaCDPK5-6B gene at different infiltration stages;

[0029] Figure 2 This is a diagram showing the differences in the nucleotide sequence of the promoter region of the TaCDPK5-6B gene in the resistant / susceptible budding materials (Jing 411 (J411, susceptible to budding and PHS) and Hongmangchun 21 (HMC21, resistant to budding and PHS)).

[0030] Figure 3 This is an agarose gel electrophoresis pattern;

[0031] Figure 4 This is a graph of validation experimental data (seed germination index GI) showing a significant correlation between the CAPS marker TaCDPK5-6B-1516 and seed dormancy and resistance to pre-harvest germination.

[0032] Figure 5 This is a graph showing the validation experiment data (seed germination index GI) showing a significant correlation between the CAPS marker TaCDPK5-6B-1166 and seed dormancy and resistance to pre-harvest germination.

[0033] Figure 6 This is a diagram showing the mutation sites of the wheat EMS mutant TaCDPK5-6B-j411. Figure 6 A) Expression analysis of TaCDPK5-6B gene in TaCDPK5-6B-j411 and Jing411 seeds (Figure A) Figure 6 B), TaCDPK5-6B-j411 and Jing411 seeds, wheat ear germination phenotype ( Figure 6 C) Germination rate diagrams of TaCDPK5-6B-j411 and Jing411 seeds ( Figure 6 D). Detailed Implementation

[0034] The present application will now be described in further detail with reference to the accompanying drawings. It should be noted that the following specific embodiments are only used to further illustrate the present application and should not be construed as limiting the scope of protection of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.

[0035] 1. Materials

[0036] Unless otherwise specified, the methods used in this embodiment are conventional methods known to those skilled in the art, and the reagents and materials used are commercially available products.

[0037] 2. Method

[0038] 2.1 Identification and Analysis of the Wheat Gene TaCDPK5-6B

[0039] 2.1.1 Transcriptome data analysis of wheat gene TaCDPK5-6B

[0040] Seeds of wheat varieties Jing 411 (J411, susceptible to pre-budding and PHS) and Hongmangchun 21 (HMC21, resistant to pre-budding and PHS) were soaked in water, and seed samples were collected at different soaking times (1h-6h-9h-12h-36h). Transcriptome sequencing was used to analyze the transcriptome data of Jing 411 (J411, susceptible to pre-budding) and Hongmangchun 21 (HMC21, resistant to pre-budding). A gene TaCDPK5-6B related to seed dormancy was identified, and the expression pattern of TaCDPK5-6B in the two varieties at different soaking times was studied. The nucleotide sequence of TaCDPK5-6B is shown in SEQ ID NO.1.

[0041] Analysis of the RNA-seq data of wheat varieties Jing 411 (J411, susceptible to pre-budding and PHS) and Hongmangchun 21 (HMC21, resistant to pre-budding and PHS) yielded the following results: Figure 1 As shown in A, Figure 1 A. The relative expression levels of TaCDPK5-6B in wheat varieties J411 and HMC21 seeds after immersion for 1 h, 6 h, 9 h, 12 h, and 36 h; *P<0.05, **P<0.01; This indicates that the expression level of TaCDPK5-6B in wheat seeds was significantly increased after immersion for 6 h, 9 h, 12 h, and 36 h compared to 1 h. Furthermore, the relative expression level of TaCDPK5-6B in J411 seeds was significantly higher than that in HMC21 seeds. It is speculated that TaCDPK5-6B may be involved in regulating wheat seed dormancy and germination.

[0042] 2.1.2 qRT-PCR analysis of wheat gene TaCDPK5-6B

[0043] Quantitative real-time PCR (qRT-PCR) is a method that uses fluorescent chemicals to measure the total amount of product after each polymerase chain reaction (PCR) cycle in a DNA amplification reaction. The basic principle is to add a fluorescent group to the PCR reaction system, monitor the entire PCR process in real time by accumulating fluorescence signals, and finally quantify unknown templates using a standard curve. The fluorescent substances used in qRT-PCR include fluorescent probes and fluorescent dyes. This experiment uses SYBR fluorescent dye. The principle is that a certain amount of SYBR fluorescent dye is added to the PCR reaction system. SYBR dye specifically incorporates into the DNA double strand and emits a fluorescent signal, while SYBR dye molecules not incorporated into the strand do not emit any fluorescent signal, thus ensuring that the increase in fluorescence signal is completely synchronized with the increase in PCR product. SYBR only binds to double-stranded DNA; therefore, the specificity of the PCR reaction can be determined by using a melting curve.

[0044] Total RNA was extracted from seeds of wheat varieties J411 and HMC21 and reverse transcribed into cDNA (using the PrimeScript RT-Reagent Kit for cDNA First-Strand Synthesis (Takara Biotechnology, Dalian, China)). Real-time PCR was performed according to the instructions of the SYBR Premix Ex Taq GC Kit (Takara Biotechnology, Dalian, China). The PCR primer sequences, PCR reaction system, and PCR reaction procedure are as follows:

[0045] PCR amplification primer sequences:

[0046] SEQ ID NO.16: TaActin-F:CCTCTCTGCGCCAATCGT

[0047] SEQ ID NO.17: TaActin-R:TCAGCCGAGCGGGAAATTGT

[0048] SEQ ID NO.18: TaCDPK5-6B-F:ATGGAGTTGCTCCTGATCGT

[0049] SEQ ID NO.19: TaCDPK5-6B-R:ACCGCTATTGTCTGTGTCCA

[0050] PCR reaction system: The total volume was 20 μL, including 10 μL of SYBR Advantage Premix (2×), 2.0 μL of reverse transcribed cDNA, and 7.2 μL of ddH2O. 0.4 μL each of 10 μM forward and reverse primers for mRNA quantification were added.

[0051] PCR reaction program: For quantification, the mRNA quantification program was 95℃ for 2 min, 95℃ for 10 sec, and 60℃ for 30 sec, with 40 fluorescence quantification cycles. The PCR process was run on a 7500 Real-Time PCR System (Bio-Rad Laboratories, Shanghai, China). Actin was selected as the internal control gene for mRNA, with 4 replicates per sample. The Ct values ​​for each group of samples were calculated using a 2-... △△Ct The algorithm calculates the changes in relative expression levels in a loop.

[0052] Analysis of qRT-PCR test data of wheat varieties Jing 411 (J411) and Hongmangchun 21 (HMC21) seeds, results are as follows: Figure 1 As shown in B, Figure 1 B. Relative expression levels of TaCDPK5-6B in J411 and HMC21 seeds after immersion for 1 h, 6 h, 9 h, 12 h, and 36 h; *P<0.05, **P<0.01; This indicates that the expression level of TaCDPK5-6B in wheat seeds is significantly higher after immersion for 6 h and 9 h compared to 1 h. Furthermore, the relative expression level of TaCDPK5-6B in J411 seeds is significantly higher than that in HMC21 seeds, consistent with the results of transcriptome sequencing analysis. This suggests that TaCDPK5-6B is involved in regulating dormancy and germination in wheat seeds.

[0053] 2.2 Development of CAPS markers for the TaCDPK5-6B gene

[0054] Cleaved Amplified Polymorphism Sequences (CAPS), also known as RFLP-PCR, works by screening for nucleotide sequences containing known restriction enzyme sites and designing corresponding specific PCR primers. The DNA fragment at that site is then amplified using these primers. The amplified product is then digested with a restriction endonuclease that specifically recognizes the site. Gel electrophoresis separates the digested fragments, and staining and analysis of site changes are performed. CAPS markers are co-dominant markers, relatively simple to use, and can be detected directly by agarose gel electrophoresis. However, CAPS markers require suitable restriction endonucleases, making their development a significant undertaking.

[0055] 2.2.1 Cloning of candidate genes

[0056] Based on the wheat genome sequence, the full-length TaCDPK5-6B gene and its regulatory region sequence were obtained. Using this as a template, Primer Premier 5.0 was used to analyze the sequence. https: / / www.PremierBiosoft.com Software-designed specific primers (as shown in SEQ ID NO. 4-5) were used for fragment amplification. Full-length gene cloning was then performed in the germination-susceptible material J411 and the germination-resistant material HMC21. The specific primer sequences are as follows:

[0057] SEQ ID NO.4: TaCDPK5-6B-F: 5'ACCGTGTTTTGATGGCTCC 3';

[0058] SEQ ID NO. 5: TaCDPK5-6B-R: 5'TCATTTGGCGAGCATCTA 3'.

[0059] PCR amplification was performed using the high-fidelity enzyme Fastpfu, which has high amplification efficiency and speed, according to the following reaction system: 10 μL 5×PCR Buffer (15 mM MgCl2), 5 μL dNTPmix (2.5 mM), 2 μL upstream primer (10 μM), 2 μL downstream primer (10 μM), 4 μL template DNA (50-100 ng / μL), 1 μL Fastpfu (2.5 U / μL), and distilled water to a final volume of 50 μL.

[0060] Reaction procedure: 95℃ pre-denaturation for 2 min, 95℃ denaturation for 20 s, annealing at the primer's required annealing temperature for 20 s, extension at 72℃ (extension time can be calculated based on fragment length and Fastpfu amplification efficiency of 2-4 kb / min), repeat the denaturation-annealing-extension three-step cycle 35 times, supplement the extension at 72℃ for 5 min, and store the product at 4℃.

[0061] Add 2 μL of 6× DNA loading buffer to the PCR product and perform electrophoresis on a 1.5% agarose gel. After electrophoresis, cut off the gel block containing the target fragment and recover and purify the target fragment using the agarose gel DNA recovery kit purchased from Kangwei Century Biotechnology Co., Ltd., following the instructions (https: / / www.cwbiotech.com / uploads / websitepdf / 216c4037-3eae-4ac2-b86a-762277a7adc1.pdf).

[0062] Add 1 μL of plasmid (Blunt-zero, purchased from TransGen Biotech, http: / / www.transgen.com.cn / ) and 4 μL of PCR purification product to a sample tube, ligate at 25°C for 20 min, and cool at 12°C. Remove the ligated sample and add 50 μL of competent cells (Trans-T, stored at -80°C before use) to a UV-sterilized workbench. Mix gently and incubate on ice for 20 min. After completion, transfer the sample to a water bath and heat shock at 42°C for 45 s, then immediately place it on ice for 2 min. On a sterile workbench, add 950 μL of SOC medium (formula per 100 mL: 2 g tryptone, 0.5 g yeast extract, 0.06 g NaCl, 0.02 g KCl, 0.2033 g MgCl2·6H2O, 0.2465 g MgSO4·7H2O, 0.36 g glucose, 100 mL ultrapure water) to the sample and incubate at 37°C for 1–1.5 h. Next, on a sterile workbench, evenly spread 100–200 μL of the bacterial culture onto LB solid medium containing kanamycin (formula per 100 mL: 1 g tryptone, 0.5 g yeast extract, 0.5 g NaCl, 1.5 g agar powder, 100 μL kanamycin solution, 100 mL ultrapure water) and incubate at 37°C for 15–16 h. Once the bacterial colonies have grown to a suitable size, add 6 μL of sterile water to each PCR sample well. Using a pipette with a maximum volume of 10 μL, transfer the bacteria into the well, gently mix, and then add 4 μL to a centrifuge tube containing 1000 μL of LB liquid medium (per 100 mL: 1 g tryptone, 0.5 g yeast extract, 0.5 g NaCl, 100 μL kanamycin solution, 100 mL ultrapure water). Incubate the centrifuge tube at 37°C for 4–6 hours. Simultaneously, using the remaining 2 μL of bacterial culture in each well as a template, perform PCR detection using the universal primer M13 for bacterial sequencing. If the PCR reaction result is positive and contains the target fragment, the sample can be sent for sequencing.

[0063] The M13 primer sequence is as follows:

[0064] SEQ ID NO.6:M13-F:5'CAGGAAACAGCTATGACCATGAT 3'

[0065] SEQ ID NO.7:M13-R:5'GTAAAACGACGGCCAGTGC 3'

[0066] 2.2.2 Sequence analysis of candidate genes

[0067] The alignment and structural analysis of the candidate gene sequencing results were performed using DNAMAN software (https: / / www.lynnon.com / dnaman.html); the promoter sequence of the candidate gene TaCDPK5-6B in the resistant-sprouting material HMC21 is shown in SEQ ID NO.2, and the promoter sequence in the susceptible-sprouting material J411 is shown in SEQ ID NO.3.

[0068] Comparison of resistant / susceptible germination materials revealed a large number of sequence differences (e.g. Figure 2 As shown in the figure, the aCDPK5-6B gene has no sequence variation in the coding region (CDS), but multiple sequence variations occur in the promoter region, and some of these variations cause changes in cis elements. For example, a G / A single nucleotide mutation at promoter -1516 bp causes two additional CAAT-box elements in J411; a T / C single nucleotide mutation at promoter -1166 bp causes one additional G-box element in J411. Based on these two sequence variations, Primer Premier 5.0 (… http: / / www.premierbiosoft.com Software-designed specific primers (as shown in SEQ ID NO. 8-11) were developed into CAPS tags, namely TaCDPK5-6B-1516 and TaCDPK5-6B-1166.

[0069] SEQ ID NO.8: CDPK5-6B-1516-F: 5'GAGGCTTACTAGGGACACGA 3';

[0070] SEQ ID NO. 9: CDPK5-6B-1516-R: 5'CAACAAAGAAAAGACGGAAG 3'.

[0071] SEQ ID NO.10: CDPK5-6B-1166-F: 5'TCAACAAAGAAAAGACGGA 3';

[0072] SEQ ID NO. 11: CDPK5-6B-1166-R: 5'TCTTCTGCTGCCCCTG 3'.

[0073] 2.2.3 Amplification, enzyme digestion, and electrophoresis of CAPS markers

[0074] PCR amplification system: 1 μL 2.5 mM dNTP, 0.25 μL 10 μM primer, 1 μL 10×EasyTaq Buffer, 0.5 U EasyTaq, 100 ng DNA template, and bring the volume up to 10 μL with double-distilled water.

[0075] PCR amplification program: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s; annealing for 30 s at 62℃ with a 0.3℃ decrease per cycle; 72℃ extension for 30 s, 40 cycles; 72℃ extension for 8 min.

[0076] Post-amplification restriction enzyme digestion system: 5 μL PCR product, 1 μL 10×CutSmart Buffer, 0.5 μL restriction enzyme, and bring the volume to 10 μL with double-distilled water. The specific restriction enzymes used for digestion are as follows:

[0077] CDPK5-6B-1516: Restriction endonuclease MboI;

[0078] CDPK5-6B-1166: Restriction endonuclease BtgI.

[0079] Enzyme digestion procedure: After digestion at 37℃ for 8 hours, add 3 μL of 6×DNA Loading Buffer to the sample, and take 5 μL of the digested product for typing by 2.5% agarose gel electrophoresis.

[0080] like Figure 3 As shown, Jing 411 carries the susceptible germination alleles TaCDPK5-6B-1516-G and TaCDPK5-6B-1166-T, while Hongmangchun 21 carries the resistant germination alleles TaCDPK5-6B-1516-A and TaCDPK5-6B-1166-C. The nucleotide sequences of the amplification products of the TaCDPK5-6B-1516-A and TaCDPK5-6B-1166-C alleles are shown in SEQ ID NO.12 (nucleotide sequence of TaCDPK5-6B-1516-A in anti-sprouting material) and SEQ ID NO.14 (nucleotide sequence of TaCDPK5-6B-1166-C in anti-sprouting material), while the nucleotide sequences of the amplification products of the TaCDPK5-6B-1516-G and TaCDPK5-6B-1166-T alleles are shown in SEQ ID NO.13 (nucleotide sequence of TaCDPK5-6B-1516-G in susceptible-sprouting material) and SEQ ID NO.15 (nucleotide sequence of TaCDPK5-6B-1166-T in susceptible-sprouting material).

[0081] 2.2.4 Validation of CAPS markers in the J411 / HMC21 recombinant inbred line population

[0082] From 2014 to 2021, 50 seeds each from Jing 411, Hongmangchun 21, and 176 recombinant inbred line families were collected 5 and 15 days after wheat harvest, with two replicates. The seeds were evenly placed, groove-side down, in 11cm diameter petri dishes, and 10mL of sterile water was added. Germination was carried out for 3 days at 20℃ under 14h (daytime) / 10h (nighttime) conditions. The number of germinated seeds (n1) on day 1, n2 on day 2, and n3 on day 3, and the number of remaining ungerminated seeds (n0) were recorded. The germination index was calculated using the following formula:

[0083] The calculation formula is: GI=(3*n1+2*n2+n3) / 3*(n1+n2+n3+n0).

[0084] In 176 families from the J411 / HMC21 recombinant inbred line, the Manny-Whitney test (U-test) was used to analyze the correlation between J411 (TaCDPK5-6B-1516-G and TaCDPK5-6B-1166-T) and HMC21 allelic types (TaCDPK5-6B-1516-A and TaCDPK5-6B-1166-C) and seed dormancy traits. The correlation was analyzed using IBM SPSS Statistics 20. www.spss.com The software is complete;

[0085] The CAPS marker TaCDPK5-6B-1516 was significantly associated with seed dormancy and anti-germination traits using 176 families from the J411 / HMC21 recombinant inbred line population (JH-RILs). The results are as follows: Figure 4 As shown in Table 1:

[0086] Table 1

[0087]

[0088]

[0089] Note: 14GI-5 and 14GI-15 represent the seed germination index (GI) measured 5 days and 15 days after harvest in 2014, respectively; 15GI-5 and 15GI-15 represent the seed germination index (GI) measured 5 days and 15 days after wheat harvest in 2015, respectively; 16GI-5, 16GI-15, and 16GI-30 represent the seed germination index (GI) measured 5 days, 15 days, and 30 days after harvest in 2016, respectively; 17GI-5 and 17GI-15 represent the seed germination index (GI) measured 5 days and 15 days after harvest in 2017, respectively; mean ± standard deviation, **P<0.01.

[0090] **This indicates that the two different alleles of the TaCDPK5-6B-1516 marker were highly significantly correlated with the trait at the 0.01 level.

[0091] The CAPS marker TaCDPK5-6B-1166 was significantly associated with seed dormancy and anti-germination traits using 176 families from the J411 / HMC21 recombinant inbred line population (JH-RILs). The results are as follows: Figure 5 As shown in Table 2:

[0092] Table 2

[0093]

[0094]

[0095] Note: 14GI-5 and 14GI-15 represent the seed germination index (GI) measured 5 days and 15 days after harvest in 2014, respectively; 15GI-5 and 15GI-15 represent the seed germination index (GI) measured 5 days and 15 days after wheat harvest in 2015, respectively; 16GI-5, 16GI-15, and 16GI-30 represent the seed germination index (GI) measured 5 days, 15 days, and 30 days after wheat harvest in 2016, respectively; 17 GI-5 and 17GI-15 represent the seed germination index (GI) measured 5 days and 15 days after wheat harvest in 2017, respectively; 18GI-5 represents the seed germination index (GI) measured 5 days after wheat harvest in 2018; 19GI-5 represents the seed germination index (GI) measured 5 days after wheat harvest in 2019; 21GI-5 and 17GI-15 represent the seed germination index (GI) measured 5 days and 15 days after wheat harvest in 2021, respectively. Mean ± standard deviation, **P < 0.01.

[0096] **This indicates that the two different alleles of the TaCDPK5-6B-1166 marker were highly significantly correlated with the trait at the 0.01 level.

[0097] According to Table 1-2 and Figure 4-5 The data results show that the differences in seed germination index (GI) among wheat varieties carrying two allelic variants, TaCDPK5-6B-1516-G and TaCDPK5-6B-1516-A and TaCDPK5-6B-1166-T and TaCDPK5-6B-1166-C, respectively, are all highly significant (P < 0.05 or 0.01), verifying the effectiveness of the two CAPS (TaCDPK5-6B-1516 and TaCDPK5-6B-1166) developed in this invention.

[0098] 2.3 Determination of germination rate of wheat with TaCDPK5-6B mutant

[0099] EMS-induced mutants (named taCDPK5-6B-j411, 6B_527877871_E) under the background of Jing 411 (wheat) were ordered from Borui Biotechnology Co., Ltd. to verify the role of TaCDPK5-6B in seed dormancy and germination. The M5 generation wheat EMS mutant taCDPK5-6B-j411 (6B_527877871_E) under the background of J411 was planted at the Dayangdian Experimental Station of Anhui Agricultural University (31°58′N, 117°240′E). Genomic DNA was extracted from wild-type (J411) and mutant plants, and the target gene was amplified by PCR. Finally, it was determined that the plants were homozygous mutants.

[0100] Wheat seeds were sampled 35 days after flowering (35 DPA), disinfected with 0.1% sodium hypochlorite solution for 15 min, and then washed with sterile water 5 times, each time for 3 min. Thirty healthy seeds were selected and placed in a petri dish lined with sterile germination paper, with the ventral groove facing down, in triplicate. Germination tests were conducted in an incubator with a daytime temperature of 22℃, a nighttime temperature of 20℃, 16 hours of light, 8 hours of darkness, and a relative humidity of 70%. The germination test lasted for 3 days, and the germination rate and germination index were observed and recorded. Plants with obvious and stable phenotypes were planted again, and the germination test was repeated. Photos were taken and stored.

[0101] The results are as follows Figure 6 As shown, the mutation sites of the wheat J411 background EMS mutant taCDPK5-6B-j411 ( Figure 6 A); Expression analysis of TaCDPK5-6B in seeds of mutant taCDPK5-6B-j411 and wild-type J411 (A) Figure 6 B); Germination phenotypes of seeds and whole ears of mutant taCDPK5-6B-j411 and wild-type J411 (B); Figure 6 C, seeds and whole ears germinate after 3 days and 5 days respectively; germination rate of taCDPK5-6B-j411 and J411 seeds on day 3 ( Figure 6 D); It can be seen that the germination rate of wild-type J411 wheat seeds is higher than that of mutant taCDPK5-6B-j411 wheat seeds. The relative expression level of TaCDPK5-6B in wild-type J411 wheat seeds is significantly higher than that in mutant taCDPK5-6B-j411 wheat seeds. This indicates that the TaCDPK5-6B gene can release dormancy in wheat seeds and promote germination, while the deletion of the TaCDPK5-6B gene affects the germination of wheat seeds.

[0102] 3. Conclusion

[0103] This application used transcriptome sequencing to identify a candidate seed dormancy gene, TaCDPK5-6B. qRT-PCR was used to detect the relative expression levels of TaCDPK5-6B at different seed infiltration stages in two wheat varieties, Jing 411 (J411, weak dormancy / susceptible to ear budding) and Hongmangchun 21 (HMC21, strong dormancy / resistant to PHS), which showed significant differences in seed dormancy / ear budding resistance levels. The results showed that the relative expression level of TaCDPK5-6B in the weak dormancy variety J411 was significantly higher than that in HMC21, consistent with the transcriptome sequencing results, thus verifying the close relationship between TaCDPK5-6B and seed dormancy.

[0104] Cloning and sequencing results in J411 and HMC21 showed that the TaCDPK5-6B gene had no sequence variations in the coding region (CDS), but multiple sequence variations occurred in the promoter region, and some of these variations caused changes in cis elements. For example, a single G / A mutation at the promoter-1516 bp resulted in two additional CAAT-box elements in J411; a single T / C mutation at the promoter-1166 bp resulted in one additional G-box element in J411.

[0105] Based on the two sequence variations mentioned above, this application developed two CAPS markers, TaCDPK5-6B-1516 and TaCDPK5-6B-1166. Using a population of recombinant inbred lines constructed with J411 and HMC21, the two CAPS markers were found to be significantly associated with seed dormancy. Specifically, the germination index (GI) of families carrying the HMC21 genotype was significantly lower than that of families carrying the J411 genotype, indicating that the two CAPS markers developed in this invention can effectively distinguish between wheat varieties with strong / weak dormancy (or resistant / susceptible to PHS).

[0106] Further seed dormancy phenotype determination of the EMS mutant TaCDPK5-6B of wheat J411 background using the TaCDPK5-6B gene revealed that the seed germination rate of this mutant was significantly lower than that of wild-type J411, confirming that the TaCDPK5-6B gene has the function of regulating seed dormancy. This provides important gene resources and molecular markers for creating new germplasm resistant to pre-sprouting and breeding new varieties resistant to pre-sprouting through transgenic or gene editing pathways.

[0107] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. Use of a CAPS marker based on the wheat seed dormancy gene TaCDPK5-6B for identifying wheat varieties resistant or susceptible to pre-harvest sprouting, characterized in that, The nucleotide sequence of the wheat seed dormancy gene TaCDPK5-6B is shown in SEQ ID NO.

1. The CAPS marker includes CDPK5-6B-1516 at position -1516 and CDPK5-6B-1166 at position -1166 in the TaCDPK5-6B gene regulatory region. The base type of CDPK5-6B-1516 is G or A, and the base type of CDPK5-6B-1166 is T or C. When the base types of CDPK5-6B-1516 and CDPK5-6B-1166 are A and C respectively, the wheat is a variety resistant to ear sprouting; when the base types of CDPK5-6B-1516 and CDPK5-6B-1166 are G and T respectively, the wheat is a variety susceptible to ear sprouting.

2. Use according to claim 1, characterized in that, The two polymorphic sites are located on the promoter of the TaCDPK5-6B gene.

3. Use according to claim 2, characterized in that, The promoter sequence of the TaCDPK5-6B gene in wheat resistant to pre-sprouting is shown in SEQ ID NO.2; the promoter sequence of the TaCDPK5-6B gene in wheat susceptible to pre-sprouting is shown in SEQ ID NO.

3.

4. A method for identifying the resistance or susceptibility of a wheat ear to sprouting using a CAPS marker based on the wheat seed dormancy gene TaCDPK5-6B, characterized in that, The specific steps are as follows: S1. Extract total RNA from wheat seeds and reverse transcribe it into cDNA; The nucleotide sequence of the wheat seed dormancy gene TaCDPK5-6B is shown in SEQ ID NO.

1. The CAPS marker includes CDPK5-6B-1516 at position -1516 and CDPK5-6B-1166 at position -1166 in the TaCDPK5-6B gene regulatory region. The base type of CDPK5-6B-1516 is G or A, and the base type of CDPK5-6B-1166 is T or C. S2. Using the nucleotide sequence composed of upstream and downstream nucleotides at the positions of CDPK5-6B-1516 and CDPK5-6B-1166 as the amplification template, CAPS primers were designed and PCR amplification was performed to obtain an amplification product containing two polymorphic sites. S3. Verify the base type of CDPK5-6B-1516 using the restriction endonuclease MboI, and verify the base type of CDPK5-6B-1166 using the restriction endonuclease BtgI. If the base types of CDPK5-6B-1516 and CDPK5-6B-1166 are A and C respectively, the wheat is a variety resistant to ear sprouting; if the base types of CDPK5-6B-1516 and CDPK5-6B-1166 are G and T respectively, the wheat is a variety susceptible to ear sprouting.

5. The method of claim 4, wherein, The CAPS primers are: SEQ ID NO.8: CDPK5-6B-1516-F: 5' GAGGCTTACTAGGGACACGA 3'; SEQ ID NO.9: CDPK5-6B-1516-R: 5' CAACAAAGAAAAGACGGAAG 3'; SEQ ID NO.10: CDPK5-6B-1166-F: 5' TCAACAAAGAAAAGACGGA 3'; SEQ ID NO. 11: CDPK5-6B-1166-R: 5' TCTTCTGCTGCCCCTG 3'. SEQ ID NO. 12: CDPK5-6B-1166-F: 5' GAGGAGGAGGAGGAGG

Citation Information

Patent Citations

  • Gene TaCDPK21-7A for regulating dormancy and pre-harvest sprouting resistance of plant seeds as well as InDel marker and application of gene TaCDPK21-7A

    CN118325949A