Application of Rice DSR1 Mutant Protein and Its Encoding Gene in Rice Breeding

Abstract

The present invention discloses the application of a rice DSR1 mutant protein and a coding gene thereof in rice breeding, and belongs to the field of gene engineering technology. The DSR1 mutant protein comprises an amino acid sequence as shown in SEQ ID No.2, and the coding gene comprises a nucleotide sequence as shown in SEQ ID No.1. The present invention also discloses the application of a rice DSR1 mutant protein and a coding gene in improving drought resistance of rice. The present invention studies show that compared with wild-type plants, the mutant plants have increased drought resistance, but unchanged disease resistance, indicating that the DSR1 mutant protein positively regulates plant drought resistance and does not affect disease resistance, and develops associated molecular markers, revealing that the DSR1 mutant protein and its coding gene and SNP molecular markers are of great significance for identifying and breeding drought-resistant and disease-resistant rice varieties.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to the application of rice DSR1 mutant protein and its encoding gene in rice breeding. Background Art

[0002] Drought and fungal diseases both cause large-scale crop yield reductions, so cultivating drought-tolerant and disease-resistant crops is one of the main goals of the planting industry. The prior art has reported a number of genes related to plant drought tolerance, including effector molecule genes and regulatory genes, which are derived from crops such as rice, wheat, corn, soybeans, and model plants Arabidopsis and halophytes. Some of them have been used as target genes for crop stress tolerance genetic engineering, and drought-tolerant rice, corn, soybeans, etc. have been successfully cultivated. However, since drought tolerance and disease resistance often cannot be taken into account at the same time, some gene application barriers are caused, so it is necessary to clone new genes that do not affect crop disease resistance when improving crop drought tolerance to meet the needs of breeding. However, there is no research report on new genes that improve drought tolerance and do not affect disease resistance. Summary of the invention

[0003] The purpose of the present invention is to provide a rice DSR1 mutant protein and an encoding gene thereof for use in rice breeding to solve the problems existing in the above-mentioned prior art. The DSR1 mutant protein provided by the present invention positively regulates plant drought tolerance without affecting disease resistance, and an associated molecular marker is developed, revealing that the DSR1 mutant protein and its encoding gene and SNP molecular marker are of great significance for identifying and breeding drought-resistant and disease-resistant rice varieties.

[0004] To achieve the above object, the present invention provides the following solutions:

[0005] The present invention provides a DSR1 mutant protein for improving drought resistance of rice. The DSR1 mutant protein comprises an amino acid sequence as shown in SEQ ID No.2.

[0006] Furthermore, at position 781 of the amino acid sequence shown in SEQ ID No. 2, the amino acid is mutated from Asn to Asp.

[0007] The present invention also provides a gene encoding the above-mentioned DSR1 mutant protein, wherein the gene comprises a nucleotide sequence as shown in SEQ ID No.1.

[0008] The present invention also provides biological materials containing the above gene, wherein the biological materials include expression boxes, recombinant vectors, recombinant bacteria or transgenic cell lines.

[0009] The present invention also provides the use of the DSR1 mutant protein, the gene or the biological material in regulating the drought resistance of rice.

[0010] The present invention also provides the use of the DSR1 mutant protein, the gene or the biological material in improving the drought resistance of rice.

[0011] Furthermore, the drought tolerance of rice is improved by up-regulating the expression level of the DSR1 mutant protein or the gene.

[0012] The present invention also provides the use of the DSR1 mutant protein, the gene or the biological material in creating drought-resistant rice.

[0013] The present invention also provides a SNP molecular marker related to rice drought resistance, the nucleotide sequence of which is shown in SEQ ID No. 1, and there is an A / G base mutation at the 2341st position.

[0014] The present invention also provides a method for identifying drought resistance of rice. The DNA of the rice to be tested is used as a template to perform PCR amplification on the SNP molecular marker. If the amplification result shows that the mutant base is G, the drought resistance of the rice is enhanced.

[0015] The present invention discloses the following technical effects:

[0016] In the early rice mutant screening process, the present invention identified a rice mutant with significantly improved drought tolerance. Through map-based cloning, it was found that it encodes a Myb transcription factor, and the 2341st base A in its coding region is mutated to G (A2341G), resulting in the mutation of the 781 amino acid Asn to Asp (Asn781Asp), which is named DSR1 Asn781Asp (DSR1 mutant protein). The research results of the present invention show that compared with the control DSR1 plants, DSR1 Asn781Asp The drought tolerance of the plants increased, but the disease resistance remained unchanged, indicating that DSR1 Asn781Asp Positive regulation of plant drought tolerance without affecting disease resistance, and the development of associated molecular markers revealed that DSR1 Asn781Asp Proteins, their encoding genes and SNP molecular markers are of great significance for identifying and breeding drought-resistant and disease-resistant rice varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0018] Figure 1Figure 2 is a diagram of the positional cloning and sequencing results of the dsr1 mutant; A is the positional cloning of the dsr1 mutant; B is the sequencing result of the mixed pool of plants with dsr1 phenotype in the F2 population (n=30); C is the sequencing result of the wild-type plant TP309, the control variety Jordan, the mutant dsr1, the mixed pool of plants with dsr1 phenotype in the F2 population, and the mixed pool of wild-type phenotype plants in the F2 population at the mutation site;

[0019] Figure 2 Phenotypes of three-week-old Taipei 309 (TP309, WT) and dsr1 mutant under normal growth conditions and drought growth conditions; scale bar is 10 cm;

[0020] Figure 3 The bar graph shows the survival rates of wild-type rice and dsr1 mutant under drought growth conditions. The asterisk above the bar graph indicates a significant difference (P<0.01).

[0021] Figure 4 Representative lesion images and statistical graphs of lesion length on leaves of wild-type rice and dsr1 mutant plants 5 days after being inoculated with rice blast fungus (physiological subspecies zhong10-8-14) (mean ± SD, n = 20); scale bar is 1 cm, and ns above the bar graph indicates no significant difference (P>0.05). DETAILED DESCRIPTION

[0022] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0023] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0024] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0025] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0026] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0027] In the previous research of the applicant, a rice mutant with significantly improved drought tolerance was identified during the rice mutant screening process. Through map-based cloning, it was found that it encodes a Myb-type transcription factor, and the 2341st base A in its coding region is changed to G (A2341G), resulting in the 781st amino acid Asn being changed to Asp (Asn781Asp). It was named DSR1 Asn781Asp DSR1 plays an important role in plant development. Previous studies on DSR1 have mainly focused on its regulation of plant development. The present invention shows that compared with the control DSR1 plants, DSR1 Asn781Asp The drought tolerance of the plants increased, but the disease resistance remained unchanged, indicating that DSR1 Asn781Asp Positive regulation of plant drought tolerance without affecting disease resistance, DSR1 Asn781Asp The protein and its encoding gene are of great significance for breeding drought-tolerant and disease-resistant rice varieties.

[0028] Rice variety TP309 was provided by Professor Xuewei Chen from the State Key Laboratory of Sichuan Agricultural University. Plant genomic DNA extraction kit: purchased from TIANGEN, China, with the catalog number DP305. Total RNA extraction kit: purchased from TRIzol from Invitrogen, USA, with the catalog number 15596026. Reverse transcription kit: purchased from HiScript III RT SuperMix for qPCR (+gDNAwiper) from Vanzyme, China, with the catalog number R323-01.

[0029] The specific research is as follows:

[0030] Example 1 Rice drought tolerance gene DSR1 Asn781Asp and its clones

[0031] The applicant screened a drought-tolerant mutant dsr1 in rice and located it on the gene LOC_Os07g31450 encoded by rice chromosome 7 through map-based cloning and BSA sequencing. Figure 1Figures 2 and 3 are the positional cloning and sequencing results of the dsr1 mutant, wherein A is the positional cloning of the dsr1 mutant; B is the sequencing result of the mixed pool of plants with dsr1 phenotype in the F2 population (n=30); C is the sequencing result of the wild-type plant TP309, the control variety Jordan, the mutant dsr1, the mixed pool of plants with dsr1 phenotype in the F2 population, and the mixed pool of plants with wild-type phenotype in the F2 population at the mutation site.

[0032] Primers were designed according to the rice Nip genome reference sequence:

[0033] DSR1GF: TGCATCATGGGCACCTCATT;

[0034] DSR1GR: TGCTGAGGCCTTTATTCGCA.

[0035] Using DNA of TP309 and drought-tolerant mutants as templates, a 742 bp fragment was amplified by the above primers. Sequencing confirmed that the 2341st base A in the coding region of the gene LOC_Os07g31450 was changed to G (A2341G), resulting in the change of amino acid Asn at position 781 to Asp (Asn781Asp), and it was named DSR1. Asn781Asp .

[0036] According to the rice Nip genome reference gene sequence, full-length CDS primers were designed:

[0037] DSR1F: ATGAAACATTTGAATGATGTTAGG;

[0038] DSR1R:CTAATGCTCATCTGTGATCATCTC.

[0039] TP309 and the drought-tolerant mutant DSR1 Asn781Asp DNA was used as a template, and a 6.6 Kb DNA band was obtained by amplification with the above primers. After sequencing, it was confirmed to be the Myb transcription factor DSR1. The LOC_Os07g31450 (DSR1) sequence in the rice genome reference sequence and the sequence from TP309 and the mutant DSR1 were Asn781Asp The clone sequences obtained by total cDNA amplification were aligned and showed that the clone sequence obtained in TP309 was identical to that of LOC_Os07g31450 (DSR1). Asn781Asp The cloned sequence obtained from the mutant had a base shift of A to G at position 2341 (A2341G) compared to LOC_Os07g31450 (DSR1). Asn781AspThe nucleotide sequence of the gene DSR1 encoding the DSR1 protein of the mutant is shown in SEQ ID No.1; the amino acid sequence of the DSR1 protein is shown in SEQ ID No.2.

[0040] DSR1 Asn781Asp The CDS sequence of the mutant gene DSR1 (SEQ ID No. 1) is as follows:

[0041]

[0042]

[0043]

[0044]

[0045]

[0046] Note: The shaded base at position 2341 is the mutation site. The wild type base here is A, DSR1 Asn781Asp The base at this position in the mutant is mutated to G.

[0047] DSR1 Asn781Asp The amino acid sequence of the mutant DSR1 protein (SEQ ID No. 2) is as follows:

[0048]

[0049]

[0050] Note: The shaded amino acid at position 781 is the mutation site. The wild-type amino acid here is N (Asn). Asn781Asp The amino acid at this position of the mutant is mutated to D (Asp).

[0051] Example 2DSR1 Asn781Asp Improving rice drought tolerance

[0052] The applicant discovered that DSR1 Asn781Asp Plants turn green under normal growth conditions ( Figure 2 ), therefore, the applicant tested DSR1 Asn781Asp Role in regulating plant drought resistance.

[0053] Drought treatment at the seedling stage: The tested materials were Taipei 309 (TP309), DSR1 with TP309 as the background and genetic stability Asn781AspThe mutant dsr1 was selected. The seeds with full grains were placed in a conical bottle filled with tap water and placed in a dark incubator at 37°C for germination. The water was changed every day. Two days later, the white seeds were selected and placed in a culture medium containing vermiculite and nutrient soil. After 21 days, the water was cut off for 10 days and then rehydrated for 7 days. The survival rate of the rice plants was counted. Statistics showed that compared with TP309, DSR1 in the TP309 background Asn781Asp The survival rate of mutant dsr1 plants was significantly higher than that of wild-type TP309 plants ( Figure 3 ). Description DSR1 Asn781Asp The drought tolerance of rice is enhanced, and its encoding gene DSR1 can be used as a target gene for molecular breeding to improve plant drought tolerance.

[0054] Example 3DSR1 Asn781Asp Does not affect rice's disease resistance

[0055] The applicant discovered that DSR1 Asn781Asp It plays an important role in regulating plant drought resistance. At the same time, the applicant also tested DSR1 Asn781Asp Effects on rice disease resistance.

[0056] Seedling inoculation treatment: The tested materials were Taipei 309 (TP309), DSR1 with TP309 as the background and genetic stability Asn781Asp The mutant dsr1 was selected. The seeds with full grains were placed in a conical bottle filled with tap water and placed in a dark incubator at 37°C for germination. The water was changed every day. Two days later, the white seeds were selected and placed in a 96-well seedling plate. The 96-well seedling plate was placed on a float and grown in Hoagland nutrient solution. After 21 days, the penultimate rice leaf with the same growth and size was selected, and 5 μL of 5×10 5 ml -1 The length of the lesions was observed and counted after 5 days of Zhong10-8-14 rice blast fungus inoculation. Each plant was 20 plants at a time. Statistics showed that after puncture inoculation, DSR1 in the TP309 background was significantly longer than that in TP309. Asn781Asp The lesion length of the mutant dsr1 plants remains unchanged ( Figure 4 ).

[0057] The results showed that DSR1 Asn781Asp It does not affect the disease resistance of plants, and its encoding gene DSR1 can be used as a target gene for molecular breeding to improve plant drought resistance without changing plant disease resistance. In addition, the SNP molecular marker (A2341G) encoding the gene DSR1 is related to the drought resistance of rice plants, and can be used as a candidate gene editing target for rice plant drought-resistant germplasm resources, which is of great significance for the identification and breeding of drought-resistant rice varieties.

[0058] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A DSR1 mutant protein for improving drought tolerance of rice, characterized in that: The amino acid sequence of the DSR1 mutant protein is shown in SEQ ID No.

2.

2. The gene encoding the DSR1 mutant protein according to claim 1, characterized in that: The nucleotide sequence of the gene is shown in SEQ ID No.

1.

3. The biological material containing the gene according to claim 2, characterized in that: The biological material is an expression box, a recombinant vector, a recombinant bacterium or a transgenic cell line.

4. Use of the DSR1 mutant protein according to claim 1, the gene according to claim 2 or the biological material according to claim 3 in improving drought tolerance of rice, characterized in that: The drought resistance of rice is improved by up-regulating the expression amount of the DSR1 mutant protein or the gene.

5. Use of the DSR1 mutant protein according to claim 1, the gene according to claim 2 or the biological material according to claim 3 in creating drought-tolerant rice, characterized in that: Drought-tolerant rice is created by up-regulating the expression level of the DSR1 mutant protein or the gene.

Images