A glycosyltransferase mutant and a method for catalyzing synthesis of sweet tea glycoside derivative rub2g

By performing site-directed mutagenesis on LbUGT glycosyltransferase to improve its thermal stability and catalytic activity, and combining it with the sucrose synthase cascade reaction, the problem of insufficient thermal stability and catalytic activity of LbUGT was solved, realizing the efficient catalytic synthesis of Rub2G and promoting its application in the food and pharmaceutical industries.

CN118126977BActive Publication Date: 2026-03-27NANJING TECH UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202211535605.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-01
Publication Date
2026-03-27
Estimated Expiration
2042-12-01

AI Technical Summary

Technical Problem

In the existing technology, the LbUGT glycosyltransferase derived from wolfberry has poor thermal stability and limited catalytic activity, which limits the efficient catalytic synthesis of the betaine derivative Rub2G and hinders its application in the food and pharmaceutical industries.

Method used

By site-directed mutagenesis of LbUGT glycosyltransferase, especially the design of mutants such as M374L, M374L/I368L and M374L/I368L/V31L, the thermostability and catalytic activity of the enzyme are improved. Combined with the sucrose synthase cascade reaction, the efficient catalytic synthesis of Rub2G is achieved.

Benefits of technology

The mutant enzyme activity was increased by 89%-774%, the Rub2G yield was increased by 5.7%-30.8 g/L, the half-life was extended by 9-19.4 hours, and the catalytic efficiency was significantly improved, achieving efficient synthesis of Rub2G.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure GDA0005624340930000081
    Figure GDA0005624340930000081
  • Figure GDA0005624340930000091
    Figure GDA0005624340930000091
  • Figure GDA0005624340930000101
    Figure GDA0005624340930000101
Patent Text Reader

Abstract

The application discloses a glycosyltransferase mutant and a method for catalyzing synthesis of sweet tea glycoside derivative Rub2G, the mutant is a single mutation or a combined mutation based on an amino acid sequence of original glycosyltransferase being SEQ ID NO:1, and finally a better catalytic effect is screened out Lb UGT mutant strain _ The SuSy system realizes efficient catalytic synthesis of sweet tea glycoside derivative Rub2G. The application improves the enzyme activity of the glycosyltransferase Lb UGT by site-directed mutagenesis, prolongs the half-life, realizes efficient catalytic synthesis of Rub2G by using the mutant, and has the advantages of mild synthesis method condition, simple operation, short time, high catalytic efficiency, high yield and good application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of bioengineering, and particularly relates to a glycosyltransferase mutant and a method for catalytically synthesizing Rub2G, a sweet tea glycoside derivative. BACKGROUND

[0002] Sweet tea is a new variety of Rubus corchorifolius L.f. It was discovered as a medicine in China in the early 1980s. Sweet tea leaves have been used in folk medicine for a long time. They are often used to replace sucrose in food processing and are used as folk medicine for kidney and blood pressure reduction. They are known as God's tea and are as famous as monk fruit. Sweet tea glycoside, which is rich in sweet tea, is a diterpene glycoside with 300 times the sweetness of sucrose and only 1% of the heat value of sucrose. It is a natural sweetener with high sweetness and low heat. Sweet tea glycoside can activate human insulin and lower blood sugar, and has good health care effects on patients with diabetes and kidney disease. The sweet tea glycoside extracted from sweet tea leaves is the best tasting sweetener in sweet plants. It has good economic value in the food, beverage, cold food product, condiment, medicine, and cosmetic industries due to its green, natural, and health care properties.

[0003] However, the strong bitter aftertaste carried by sweet tea glycoside has hindered its application and promotion in the market. Rub2G has an additional glucose group at the C-2' and C-6' positions of the first glucose group connected to the C19 position of sweet tea glycoside (see Figure 1 ). Compared with sweet tea glycoside, the sweetness of Rub2G increases by 31%, and the bitterness is eliminated. Therefore, Rub2G has better sugar properties and a more ideal taste than sweet tea glycoside.

[0004] Currently, Rub2G has a low content (<0.1%) in plants and cannot be obtained by physical extraction, which hinders its commercial application and promotion. LbUGT derived from Lycium barbarum can catalyze the glycosylation reactions of the C-6' and C-2' glucose groups connected to the C19 position of steviol glycosides. Therefore, it is possible to obtain high-value sweetener Rub2G from sweet tea glycoside by LbUGT catalysis.

[0005] LbUGT is a "Leloir" type glycosyltransferase belonging to the GT1 family, which can synthesize glycosides with UDPG as a glycosyl donor, and can be obtained in large quantities by heterologous expression in E. coli or Saccharomyces cerevisiae, etc. and used to catalyze Rub2G. With the continuous improvement of UDPG production methods, it can be synthesized in large quantities by enzymes such as SuSy. On this basis, the SuSy-UGT cascade reaction system is used, and SuSy is used to provide glycosyl donor for LbUGT, realizing the recycling of UDPG and greatly reducing the application cost. In the LbUGT-SuSy cascade system, SuSy provides the glycosylation reaction with the required glycosyl donor, and when the UDPG regeneration speed is not limited (for example, by increasing the sucrose concentration), the key to the synthesis of Rub2G is LbUGT. However, the LbUGT from Lycium barbarum has poor thermal stability and limited catalytic activity, and the enzyme is basically inactivated after 12h of catalysis, which limits the efficient application of glycosyltransferase. SUMMARY

[0006] The purpose of the present application is to provide a glycosyltransferase mutant and a method for catalyzing the synthesis of Rub2G using the glycosyltransferase mutant; to realize the glycosylation modification of Rub2G by using LbUGT mutant, to efficiently catalyze the preparation of Rub2G, and to provide a certain reference for industrial production.

[0007] In order to achieve the above purpose, the technical scheme adopted by the present application is:

[0008] A glycosyltransferase mutant suitable for Rub2G synthesis, the amino acid sequence of the glycosyltransferase mutant comprises a mutation of the amino acid residue of at least one site corresponding to V31L, V36A, A48P, S104A, Q127P, L143F, S152A, N175Y, G195D, G225L, G256D, G256Y, A297L, A297V, F329W, P333A, N337A, G343A, D358S, I368F, I368L, L370F, M374L, M421A of SEQ ID NO: 1. Preferably, V31L, Q127P, G225L, G256D, G343A, I368L, M374L, further preferably V31L, Q127P, G343A, I368L, M374L, and more preferably V31L, I368L, M374L.

[0009] According to embodiments of the application, the amino acid sequence of the mutant comprises mutations of the amino acid residues at any two of the positions V31 L, V36A, A48P, S104A, Q127P, L143F, S152A, N175Y, G195D, G225L, G256D, G256Y, A297L, A297V, F329W, P333A, N337A, G343A, D358S, I368F, I368L, L370F, M374L, M421A, and at least one of the mutation positions is any one of V31 L, Q127P, G225L, G256D, G343A, I368L, M374L; preferably, one of the mutation positions of the amino acid sequence of the mutant is M374L and the other mutation position is any one of V31 L, S104A, G225L, G256D, G343A, I368L, M421A.

[0010] According to embodiments of the application, the amino acid sequence of the mutant comprises mutations of the amino acid residues at any three of the positions V31 L, S104A, G225L, G256D, G343A, I368L, M374L, M421A. Preferably, the mutant is one of the following combinations of mutations: M374L / V31 L / G225L, M374L / V31 L / G256D, M374L / V31 L / G343A, M374L / V31 L / I368L, M374L / S104A / G343A, M374L / G343A / I368L, M374L / G343A / M421A. Further preferably, the mutations are M374L / V31 L / I368L, M374L / I368L / G343A, M374L / V31 L / G256D.

[0011] A glycosyltransferase mutant suitable for Rub2G synthesis, the mutant is a single point mutation of M374L or any one of the following double site mutations of M374L / V31L, M374L / V36A, M374L / A48P, M374L / S104A, M374L / Q127P, M374L / L143F, M374L / S152A, M374L / N175Y, M374L / G195D, M374L / G225L, M374L / G256D, M374L / G256Y, M374L / A297L, M374L / A297V, M374L / F329W, M374L / P333A, M374L / N337A, M374L / G343A, M374L / D358S, M374L / I368F, M374L / I368L, M374L / L370F, M374L / M421A or any one of the following triple site mutations of M374L / V31L / G225L, M374L / V31L / G256D, M374L / V31L / G343A, M374L / V31L / I368L, M374L / S104A / G343A, M374L / G343A / I368L, M374L / G343A / M421A in the glycosyltransferase with the amino acid sequence as shown in SEQ ID NO: 1.

[0012] A glycosyltransferase mutant M374L suitable for Rub2G synthesis, the mutant M374L is a mutation of the 374th amino acid from methionine (M) to leucine (L) in the glycosyltransferase LbUGT sequence with the amino acid sequence as shown in SEQ ID NO: 1. The mutant M374L has an enzyme activity increased by 89% and a Rub2G production increased by 5.7g / L compared with the original strain.

[0013] A glycosyltransferase mutant M374L / I368L suitable for Rub2G synthesis, the mutant M374L / I368L is a mutation of the 374th amino acid from methionine (M) to leucine (L) and the 368th amino acid from isoleucine (I) to leucine (L) in the glycosyltransferase LbUGT sequence with the amino acid sequence as shown in SEQ ID NO: 1. The mutant M374L / I368L has an enzyme activity increased by 487% and a Rub2G production increased by 21.3g / L compared with the original strain.

[0014] A glycosyltransferase mutant M374L / I368L / V31L suitable for Rub2G synthesis, wherein the amino acid at position 374 in the glycosyltransferase LbUGT sequence shown in SEQ ID NO: 1 is mutated from methionine (M) to leucine (L), the amino acid at position 368 is mutated from isoleucine (I) to leucine (L), and the amino acid at position 31 is mutated from valine (V) to leucine (L), the amino acid sequence of which is shown in SEQ ID NO: 5 and the nucleotide sequence of which is shown in SEQ ID NO: 6. The mutant M374L / I368L / V31L has an enzyme activity increased by 774% compared to the original strain, the Rub2G production is increased by 30.8 g / L, and the half-life is extended by 19.4 h.

[0015] According to an embodiment of the present application, the mutant has a homology of more than 70% to the amino acid sequence shown in SEQ ID NO. 1, for example a homology of more than 80%, for example a homology of more than 90%, more than 95%, more than 98%.

[0016] An expression gene encoding any of the above glycosyltransferase mutants.

[0017] A recombinant plasmid linked with the above expression gene and sucrose synthase gene SuSy.

[0018] A recombinant cell containing the above recombinant expression vector or the expression gene of the above glycosyltransferase mutant.

[0019] Use of the above glycosyltransferase mutant in the preparation of Rub2G.

[0020] A method for synthesizing Rub2G using a glycosyltransferase mutant, comprising the following steps:

[0021] 1) Constructing a recombinant strain containing double-enzyme co-expression: the gene of the mutant of glycosyltransferase LbUGT and the sucrose synthase gene are co-constructed into a plasmid to obtain a recombinant plasmid;

[0022] 2) Transforming the recombinant plasmid into a host bacterium to obtain a recombinant strain containing a double-enzyme co-expression system;

[0023] 3) Activating the recombinant strain and transferring it to a TB induction medium, adding an inducer to induce culture, low-temperature centrifugation and collecting the bacterial body, resuspending the bacterial body in an appropriate amount of buffer and breaking it, centrifuging to collect the supernatant as the crude enzyme solution;

[0024] 4) Catalytic synthesis of Rub2G: adding sweet tea glycoside, sucrose and crude enzyme solution to the catalytic reaction system, reacting for 5-100 h, inactivating at high temperature, and centrifuging the supernatant to obtain Rub2G.

[0025] The final concentration of the inducer is 0.02-1 g / L, and the induction time is 4-50 h.

[0026] The concentration of the sweet tea glycoside is 1-500 g / L; the concentration of sucrose is 1-1500 g / L; and the crude enzyme addition amount is 0.1-1000 g / L.

[0027] The host bacteria include, but are not limited to, Escherichia coli, Saccharomyces cerevisiae, Pichia pastoris, or Corynebacterium glutamicum. The method for catalytically synthesizing Rub2G includes the following steps:

[0028] 1) Constructing a recombinant strain containing a double-enzyme co-expression system: co-express the nucleotide sequence of the glycosyltransferase LbUGT, such as SEQ ID NO: 3 or a corresponding mutant nucleotide sequence, and the nucleotide sequence of sucrose synthase, such as SEQ ID NO: 4, to obtain a recombinant plasmid, and transform the recombinant plasmid into competent cells of Escherichia coli BL21 (DE3) to obtain a recombinant strain containing a double-enzyme co-expression system;

[0029] 2) Inducing enzyme production of the recombinant strain: activate the recombinant strain, inoculate 1%-3% into a TB induction medium, incubate at 37°C for about 2 hours, add lactose at an amount of 0.02 g / L, reduce the temperature to 25°C, and continue to induce culture for 20

[0030] h, centrifuge at low temperature and collect the bacterial cells. Resuspend the bacterial cells in an appropriate amount of buffer and break them, centrifuge to collect the supernatant as a crude enzyme solution;

[0031] 3) Catalytically synthesizing Rub2G: add sweet tea glycoside, sucrose, and the crude enzyme solution to a catalytic reaction system, and react for 5-100 h,

[0032] High-temperature inactivation of the enzyme, and centrifugation to obtain the supernatant as Rub2G.

[0033] The concentration of the sweet tea glycoside in the catalytic reaction system in step 3) is 1-500 g / L; the concentration of sucrose is 1-1500 g / L; and the crude enzyme addition amount is 0.1-1000 g / L. Preferably, the concentration of the sweet tea glycoside is 30-80 g / L; the concentration of sucrose is 1-1500 g / L; and the crude enzyme addition amount is 5-20 g / L.

[0034] The amino acid sequence of the glycosyltransferase LbUGT is shown in SEQ ID NO: 1, and the amino acid sequence of the sucrose synthase is shown in SEQ ID NO: 2.

[0035] The thermal stability and catalytic activity residues of the protein can be simulated by protein structure, and predicted by various strategies, and the relevant residues of the protein, such as flexible residues, are hardened by mutation technology, and the thermal stability of the protein is improved. Based on the glycosyltransferase LbUGT, the single point and combination mutations of the predicted active residues and flexible residues thereof are carried out, and the relative activity and half-life of the mutant strain thereof are compared to detect the catalytic level of the glycosyltransferase mutant. The glycosyltransferase mutant and sucrose synthase cascade are used to synthesize Rub2G with the addition of a proper amount of sucrose. The mutant is simple to prepare, realizes high-efficiency catalytic synthesis of Rub2G, and under the same conditions, the activity of the mutant is 108-874% times that of the original enzyme, the half-life is prolonged by 9-19.4h, and the yield of Rub2G is increased by 7.3-30.8g / L. The catalytic effect of the reaction system based on the mutant strain M374L / I368L / V31 L is better than that of the unmutated system, and the concentration of Rub2G is 41.0g / L after 36h of reaction, and the conversion rate is more than 95%.

[0036] The present application improves the thermal stability and catalytic activity of the glycosyltransferase LbUGT by mutation, and further improves the efficiency of catalytic production of Rub2G.

[0037] Advantages:

[0038] The present application improves the enzyme activity of the glycosyltransferase LbUGT by site-directed mutation, prolongs the half-life, realizes high-efficiency catalytic synthesis of Rub2G by using the mutant, and has the advantages of mild synthesis method condition, simple operation, short time, high catalytic efficiency, high yield, and good application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0039] Figure 1 .LbUGT catalyzes the synthesis of Rub2G from rubusoside.

[0040] Figure 2 .LbUGT and UDPG and rubusoside docking complex model. DETAILED DESCRIPTION

[0041] Example 1 Construction of double enzyme expression system

[0042] The dual-gene expression vector pRSFDuet-1 was selected. A nucleotide sequence of the glycosyltransferase LbUGT (nucleotide sequence as shown in SEQ 1D NO.3) or its LbUGT mutant was inserted into the NdeI / XhoI site of the vector. A nucleotide sequence of the Arabidopsis-derived sucrose synthase SuSy (sequence as shown in SEQ 1D NO.4) was inserted into the NcoI / EcoRI site to construct the corresponding recombinant expression plasmid, which was then constructed into the pRSFDuet-1 vector. The recombinant plasmid was introduced into *E. coli* BL21(DE3) to form a recombinant bacterium for dual-enzyme co-expression. A schematic diagram of the pathway of LbUGT catalyzing the production of Rub2G from betaine is shown below. Figure 1 .

[0043] Example 2: Selection of glycosyltransferase mutation sites

[0044] 3D structural simulation of LbUGT glycosyltransferase using alphafold2 was performed, and LbUGT, UDPG, and Rub were docked using rosetta (e.g., Figure 2 As shown), the solvent-accessible surface area of ​​multiple sites was analyzed using multiple structural analysis software (such as Hotspot) and AMBER. Mean B-factor The parameters were scored using thermal stability (Table 1). Mutants with parameters superior to the wild-type strain (Wt) were selected for single-point mutagenesis. Mutants with parameters superior to Wt included V31L, V36A, A48P, S104A, Q127P, L143F, S152A, N175Y, G195D, G225L, G256D, G256Y, A297L, A297V, F329W, P333A, N337A, G343A, D358S, I368F, I368L, L370F, M374L, and M421A.

[0045] PCR amplification of the coding gene of the site-directed mutant: Rapid mutation was performed using PCR amplification technology with DNA from the unmutated strain pRSFDuet-LbUGT-AtSUS1 as a template.

[0046] The primers for site-directed mutagenesis of V31L are:

[0047] Forward primer: 5'-TTTGAACCTGGCCAAGAAGCTGGTCGACCGCG-3'

[0048] Reverse primer: 5'-TCTTGGCCAGGTTCAAAAACGGGCTAATATGACC-3'

[0049] The primers for site-directed mutagenesis of V36A are:

[0050] Forward primer: 5'-AAGAAGCTGGCCGACCGCGGTTTTCTGATCTATC-3'

[0051] Reverse primer: 5'-CGGTCGGCCAGCTTCTTGGCCACGTTCAAAAA-3'

[0052] Primers for site-directed mutagenesis of A48P are:

[0053] Forward primer: 5'-CTCAACCCCGATTAATCTGAAGAGCACCATTAAAAAGA-3' Reverse primer: 5'-GATTAATCGGGGTTGAGCACAGATAGATCAGAAAAC-3'

[0054] Forward primer: 5'-GAAAATGGCCAAGCCGAATTTCAGCAAGATCC-3'

[0055] Reverse primer: 5'-TCGGCTTGGCCATTTTCAGAGCCTTTTGCAGA-3'

[0056] Primers for site-directed mutagenesis of Q127P are:

[0057] Forward primer: 5'-TGATCTGCTGCAGCCGTGGGCAGAAGGTGTCGCTAA-3' Reverse primer: 5'-ACGGCTGCAGCAGATCATAGATGACGAGATCC-3'

[0058] Primers for site-directed mutagenesis of L143F are:

[0059] Forward primer: 5'-TTAAATTCCTAACGAGCGGCGCGGCAGTGCTCT-3'

[0060] Reverse primer: 5'-TCGTTAGGAATTTAACCGCCGGGATGTTTTGTTC-3'

[0061] Primers for site-directed mutagenesis of S152A are:

[0062] Forward primer: 5'-CAGTGCTCGCTTATTTCTTCAATCTGGTTAAAAAACCG-3' Reverse primer: 5'-GAAATAAGCGAGCACTGCCGCGCCGCTCGTTA-3'

[0063] Primers for site-directed mutagenesis of N175Y are:

[0064] Forward primer: 5'-GCGCAAATACGAACTAGAGAAGATGTCTGAGTTGCTG-3' Reverse primer: 5'-CTAGTTCGTATTTGCGCAGGTAAATCGCCGGA-3'

[0065] Primers for G195D site-directed mutagenesis were:

[0066] Forward primer: 5'-ACCAGATGATGTTGACCCGTTCGCCGATGGTA-3'

[0067] Reverse primer: 5'-GGTCAACATCATCTGGTTCTTTGTCTTTTGCAGA-3'

[0068] Primers for G225L site-directed mutagenesis were:

[0069] Forward primer: 5'-CTTCAGCCTTCTGTCTAACTGGAAAGTTGTTCCG-3'

[0070] Reverse primer: 5'-TAGACAGAAGGCTGAAGTAATCAATGTACTTCGCC-3'

[0071] Primers for G256D site-directed mutagenesis were:

[0072] Forward primer: 5'-CTGGTTGGATAAGAAGGACGAGAACAGCACGG-3'

[0073] Reverse primer: 5'-CCTTCTTGACCAACCAGTCGATCAATTCCATCT-3'

[0074] Primers for G256Y site-directed mutagenesis were:

[0075] Forward primer: 5'-GACTGGTTGTATAAGAAGGACGAGAACAGCACGGTT-3' Reverse primer: 5'-GTCCTTCTTATACAACCAGTCGATCAATTCCATCTC-3'

[0076] Forward primer: 5'-TGGGTTCTTCGTTTTCCGAAAGGCGAGGAGCAAAA-3' Reverse primer: 5'-GGAAAACGAAGAACCCAGATGAAATTAACGTTGG-3'

[0077] Forward primer: 5'-ATCTGGGTTGTTCGTTTTCCGAAAGGCGAGGAG-3'

[0078] Reverse primer: 5'-AAAACGAACAACCCAGATGAAATTAACGTT-3'

[0079] Primers for site-directed mutagenesis of F329W are:

[0080] Forward primer: 5'-GATAAATGGGCACCGCAGCCGCGTATCCTG-3'

[0081] Reverse primer: 5'-CTGCGGTGCCCATTTATCCAGAACACGGCC-3'

[0082] Primers for site-directed mutagenesis of P333A are:

[0083] Forward primer: 5'-CAGGCTCGTATCCTGAATCACCCGAGCACGGG-3'

[0084] Reverse primer: 5'-TTCAGGATACGAGCCTGCGGTGCGAATTTATCCA-3'

[0085] Forward primer: 5'-GCGTATCCTGGCTCACCCGAGCACGGGTGGTTT-3'

[0086] Reverse primer: 5'-TGAGCCAGGATACGCGGCTGCGGTGCGAATTTAT-3'

[0087] Forward primer: 5'-CACGGGTGCTTTCATCAGCCATTGTGGTTGGA-3'

[0088] Reverse primer: 5'-TGATGAAAGCACCCGTGCTCGGGTGATTCAGG-3'

[0089] Primers for site-directed mutagenesis of D358S are:

[0090] Forward primer: 5'-AAAGCGTGTCTTTCGGCGTACCGATCATCGCC-3'

[0091] Reverse primer: 5'-GCCGAAAGACACGCTTTCCATCACGCTGTTCC-3'

[0092] Primers for site-directed mutagenesis of I368F are:

[0093] Forward primer: 5'- ATGCCGTTTCACCTGGACCAGCCTATGAACGC -3'

[0094] Reverse primer: 5'- TCCAGGTGAAACGGCATGGCGATGATCGGTAC -3'

[0095] Primers for site-directed mutagenesis of I368L are:

[0096] Forward primer: 5'- GCCATGCCGCTGCACCTGGACCAGCCTATGAAC -3'

[0097] Reverse primer: 5'- GCCATGCCGCTGCACCTGGACCAGCCTATGAAC -3' Primers for site-directed mutagenesis of L370F are:

[0098] Forward primer: 5'- CCGATTCACTTTGACCAGCCTATGAACGCC -3' Reverse primer: 5'- AGGCTGGTCAAAGTGAATCGGCATGGC -3'

[0099] Primers for site-directed mutagenesis of M374L are:

[0100] Forward primer: 5'- GACCAGCCTCTGAACGCCCGTCTGATCGTA -3' Reverse primer: 5'- ACGGGCGTTCAGAGGCTGGTCCAGGTGAAT -3'

[0101]

[0102]

[0103] Primers for site-directed mutagenesis of M421A are:

[0104] Forward primer: 5'- AGCGAAAGCTCGTGATATTTCCAAGAACCTGAAA -3'

[0105] Reverse primer: 5'- TATCACGAGCTTTCGCTTTCAAGTTTTCACCG -3'

[0106] PCR target plasmid amplification reaction system: 10 μΜ forward primer and reverse primer, 2 μΐ, each; dNTP Mix 1 μΐ,; 2 x Max Buffer 25 μΐ,; template plasmid 1 μΐ,; 2 U / 50 μΐ, Super-Fidelity DNA polymerase 1 μΐ, supplemented with sterile water ddH2O to 50 μΐ,.

[0107] PCR target plasmid amplification reaction conditions: 95°C pre-denaturation for 30 s; 30 cycles of 95°C denaturation for 15 s, 65°C annealing for 15 s, 72°C extension for 7 min; 72°C complete extension for 5 min; and final 16°C incubation. The PCR amplification product was detected by agarose gel nucleic acid electrophoresis.

[0108] DpnI 1 μL was added to the determined PCR amplification product that had been mutated, and the reaction system was then incubated at 37°C for 1-2 h, and then transferred into competent cells of E. coli BL21 (DE3), placed on ice for 30 min, heat shocked at 42°C for 45-90 s, placed on ice for 2 min, added with 600 μL of LB medium, and incubated at 37°C on a shaker at 200 rpm for 45 min. The whole bacterial solution was evenly spread on an LB plate containing kanamycin, and incubated at 37°C overnight. Two single colonies on the plate were picked and inoculated into LB liquid medium, and after 9 h, the bacterial solution was stored in a glycerol tube and sequenced. The bacterial solution in the glycerol tube with correct sequencing results was spread on an LB plate containing kanamycin, and the recombinant plasmid was extracted from the shake tube and introduced into E. coli BL21 (DE3).

[0109] Table 1. Parameter analysis of mutation sites

[0110] Example 3 Fermentation induction of mutant enzymes

[0111] The glycosyltransferase LbUGT mutants were respectively spread on LB solid plates (NaCl 10 g / L, yeast powder 5 g / L, peptone 10 g / L, agar 20 g / L) containing 50 μg / L of kanamycin, and incubated in a 37°C incubator overnight. The next day, single colonies were selected from the plates and inoculated into shake tubes containing 5 mL of LB liquid medium (containing 50 μg / L of kanamycin). The shake tubes were incubated at 37°C on a shaker at 200 rpm overnight as seed solution. The seed solution was inoculated into 100 mL of TB medium (containing 50 μg / L of kanamycin and 0.1 μg / L of lactose) at an inoculation amount of 1% (v:v). The shake tubes were placed in a shaker at 37°C and 200 rpm for shaking culture. After 2 h, the temperature was adjusted to 25°C, and the culture was continued for 20-22 h.

[0112] The fermentation solution was collected and centrifuged at 4°C at 7000 rpm for 6 min, and the supernatant was discarded to obtain bacterial slurry, which was washed twice with potassium phosphate buffer. An appropriate amount of potassium phosphate buffer was added, and the bacterial slurry was placed in an ice-water mixture and broken by ultrasonic wave using an ultrasonic wave disruptor at a parameter setting of Ф6, 300 W for 30 min. The bacterial slurry was then centrifuged at 4°C at 8000 rpm for 30 min, and the supernatant was collected as crude enzyme solution and stored in a 4°C refrigerator for use.

[0113] Enzyme activity and yield detection of wild enzyme and single point mutant enzyme

[0114] The enzyme activity and yield of the simulated calculation parameters of the single point mutant of the original strain were detected to evaluate the effect of single point mutation.

[0115] The method for detecting the enzyme activity of glycosyltransferase is as follows: 1 mM substrate rhamnosylrutin, 2 mM UDPG, 0.5 mg crude enzyme, and 100 mM pH 7.2 potassium phosphate buffer are added to a 3 mL enzyme catalytic reaction system. The reaction conditions are 30°C and 200 rpm, and the sampling time is 0 min, 20 min, and 30 min. Sample treatment: 500 μL is taken, inactivated at 95°C for 5 min in a water bath, and then detected by HPLC. The enzyme activity definition (U) is that the amount of enzyme required to convert 1 μmol of product per minute is 1 enzyme activity unit. The relative enzyme activity of other mutant enzymes is obtained based on the wild enzyme activity of 100%.

[0116] The catalytic reaction system (20 mL) is as follows: substrate rhamnosylrutin 40 g / L, sucrose 120 g / L, crude enzyme 10 mg / mL, and 100 mM pH 7.2 potassium phosphate buffer. The catalytic reaction conditions are 37°C and 200 rpm. The sample is inactivated in a water bath at 95°C, diluted to 40 times, and then detected by HPLC for analysis.

[0117] The enzyme activity and yield detection shows that the enzyme activity and yield of the single point mutant are better than those of the original strain, the enzyme activity is increased by 6-89%, and the yield is increased by 0.1-5.7 g / L. The specific data are shown in Table 2.

[0118] Table 2. Relative enzyme activity and Rub2G yield of wild type and single point mutant (reaction for 24 h)

[0119]

[0120] Enzyme activity and yield detection of wild enzyme and double point combination mutant

[0121] The mutant M374L with the best improvement effect is superimposed with other positive single point mutations to evaluate the mutation effect of double point combination mutation.

[0122] The method of double-point combination mutation: the mutant M374L (nucleotide sequence as shown in SEQ ID NO: 7) as template DNA for rapid mutation: the primers for site-directed mutation of M374L / V31L, M374L / V36A, M374L / A48P, M374L / S104A, M374L / Q127P, M374L / L143F, M374L / S152A, M374L / N175Y, M374L / G195D, M374L / G225L, M374L / G256D, M374L / G256Y, M374L / A297L, M374L / A297V, M374L / F329W, M374L / P333A, M374L / N337A, M374L / G343A, M374L / D358S, M374L / I368F, M374L / I368L, M374L / L370F, M374L / M421A are the same as the primers for corresponding single-site site-directed mutation in Example 2.

[0123] The PCR target plasmid amplification reaction system and the PCR target plasmid amplification reaction conditions are the same as in Example 2, and the glycosyltransferase enzyme activity determination method is the same as in Example 4.

[0124] The catalytic reaction system (20 mL) is as follows: substrate 40 g / L, sucrose 120 g / L, crude enzyme 10 mg / mL, and buffer 100 mM pH 7.2 potassium phosphate buffer. The catalytic reaction conditions are 37°C and 200 rpm. Inactivation sampling is performed at 95°C in a water bath, and the sample is diluted 40 times for HPLC detection and analysis.

[0125] The enzyme activity and yield of the double-point combination mutant are better than those of the original strain, with an enzyme activity increase of 218-487% and a yield increase of 7.3-21.3 g / L. See Table 3 for specific data.

[0126] Table 3. Relative enzyme activity and Rub2G yield of wild type and double-point combination mutant (reaction for 24 h)

[0127] Example 7 Enzyme activity, yield, and half-life detection of wild-type enzyme and three-point mutant

[0128] The double-point combination mutants M374L / V31L, M374L / G343A, and M374L / I368L with V31L, S104A, G225L, G256D, G343A, and M421A are subjected to superposition mutation, and the mutation effect of the three-point combination mutation is evaluated.

[0129] The method of three-point combination mutation:

[0130] Rapid mutation was performed using M374L / V31L (nucleotide sequence SEQ ID NO:8) as a template DNA:

[0131] Primers for site-directed mutagenesis of M374L / V31L / G225L:

[0132] Forward primer: 5'-CTTCAGCCTTCTGTCTAACTGGAAAGTTGTTCCG-3'

[0133] Reverse primer: 5'-TAGACAGAAGGCTGAAGTAATCAATGTACTTCGCC-3'

[0134] The primers for the site-directed mutagenesis of M374L / V31L / G256D are:

[0135] Forward primer: 5'-CTGGTTGGATAAGAAGGACGAGAACAGCACGG-3'

[0136] Reverse primer: 5'-CCTTCTTGACCAACCAGTCGATCAATTCCATCT-3'

[0137] The primers for site-directed mutagenesis of M374L / V31L / G343A are:

[0138] Forward primer: 5'-CACGGGTGCTTTCATCAGCCATTGTGGTTGGA-3'

[0139] Reverse primer: 5'-TGATGAAAGCACCCGTGCTCGGGTGATTCAGG-3'

[0140] Rapid mutation was performed using M374L / G343A (nucleotide sequence SEQ ID NO:9) as a template DNA:

[0141] The primers for site-directed mutagenesis of M374L / G343A / S104A are:

[0142] Forward primer: 5'-GAAAATGGCCAAGCCGAATTTCAGCAAGATCC-3'

[0143] Reverse primer: 5'-TCGGCTTGGCCATTTTCAGAGCCTTTTGCAGA-3'

[0144] The primers for site-directed mutagenesis of M374L / G343A / M421A are:

[0145] Forward primer: 5'-AGCGAAAGCTCGTGATATTTCCAAGAACCTGAAA-3'

[0146] Reverse primer: 5'-TATCACGAGCTTTCGCTTTCAAGTTTTCACCG-3'

[0147] The primer for site-directed mutagenesis of M374L / I368L / V31 L is:

[0148] The primer for site-directed mutagenesis of M374L / I368L / V31 L is:

[0149] Forward primer: 5'-TTTGAACCTGGCCAAGAAGCTGGTCGACCGCG-3'

[0150] Reverse primer: 5'-TCTTGGCCAGGTTCAAAAACGGGCTAATATGACC-3'

[0151] The primer for site-directed mutagenesis of M374L / I368L / G343A is:

[0152] Forward primer: 5'-CACGGGTGCTTTCATCAGCCATTGTGGTTGGA-3'

[0153] Reverse primer: 5'-TGATGAAAGCACCCGTGCTCGGGTGATTCAGG-3'

[0154] The PCR target plasmid amplification reaction system is: 10 μM of forward primer and reverse primer, 2 μL each; dNTP Mix 1 μL; 2 x Max Buffer 25 μL; template plasmid 1 μL; 2 U / 50 μL Super-Fidelity DNA polymerase 1 μL, supplemented with sterile water ddH2O to 50 μL.

[0155] The PCR target plasmid amplification reaction conditions are: 95°C pre-denaturation for 30 s; 30 cycles of 95°C denaturation for 15 s; 65°C annealing for 15 s; 72°C extension for 7 min; 72°C thorough extension for 5 min; and finally 16°C incubation. The PCR amplification product is detected by agarose gel nucleic acid electrophoresis.

[0156] DpnI 1 μL was added to the PCR amplification product determined to have been mutated, and the reaction system was then incubated at 37°C for 1-2 h, and then introduced into competent cells of E. coli BL21(DE3), placed on ice for 30 min, heat shocked at 42°C for 45-90 s, placed on ice for 2 min, 600 μL of LB medium was added, and incubated at 37°C with shaking at 200 rpm for 45 min. The whole bacterial solution was evenly spread on an LB plate containing kanamycin, and incubated at 37°C overnight. Two single colonies on the plate were picked and inoculated into LB liquid medium, and after 9 h, the bacterial solution was stored in a glycerol tube and sequenced. The bacterial solution in the glycerol tube with correct sequencing results was spread on an LB plate containing kanamycin, and the plasmid was extracted by shaking tube activation, and the recombinant plasmid was introduced into E. coli BL21(DE3).

[0157] The glycosyltransferase enzyme activity determination method was as follows: 1 mM substrate theaflavin, 2 mM UDPG, 0.5 mg of crude enzyme were added to a 3 mL enzyme catalytic reaction system, and then 100 mM, pH 7.2 potassium phosphate buffer was supplemented. The reaction condition was 30°C, and the sampling time was 0 min, 20 min and 30 min at 200 rpm. Sample treatment: 500 μL was taken, inactivated at 95°C in a water bath for 5 min, and then detected by HPLC. The enzyme activity definition (U): the amount of enzyme required to convert 1 μmol of product per minute was 1 enzyme activity unit.

[0158] The half-life detection method was as follows: the wild-type enzyme and the mutant enzyme were incubated at 37°C in a water bath for different times, and the enzyme activity was determined, the half-life curve was drawn, and the half-life time was obtained. The enzyme activity detection scheme was the same as above.

[0159] The catalytic reaction system (20 mL) was as follows: substrate theaflavin 40 g / L, sucrose 120 g / L, crude enzyme 10 mg / mL, and buffer 100 mM pH 7.2 potassium phosphate buffer. The catalytic reaction condition was 37°C, 200 rpm. The sample was inactivated in a water bath at 95°C, diluted to 40 times, and then detected by HPLC.

[0160] The enzyme activity and yield detection showed that the enzyme activity and yield of the three-point combined mutant were better than those of the original strain, the enzyme activity was increased by 568-774%, and the half-life was prolonged by 9-19.4 h (see Table 4). The Rub2G yield was increased by 22.7-30.8 g / L after 72 h of catalytic reaction, and the specific data are shown in Table 5.

[0161] Table 4. Relative enzyme activity and half-life of wild type and three-point combined mutant

[0162]

[0163]

[0164] Table 5. Yield of wild type and three-point combination mutant Rub2G

[0165]

Claims

1. A glycosyltransferase mutant, characterized in that, The mutant is that the amino acid at position 374 in the amino acid sequence of the glycosyltransferase shown in SEQ ID NO: 1 is mutated from M to L.

2. A glycosyltransferase mutant having the activity of catalyzing the generation of Rub2G from sweet tea glycoside, the amino acid sequence of which is obtained by any one of the following combinations of mutation sites on the basis of SEQ ID NO: 1: M374L / V31L, M374L / V36A, M374L / A48P, M374L / S104A, M374L / Q127P, M374L / L143F, M374L / S152A, M374L / N175Y, M374L / G195D, M374L / G225L, M374L / G256D, M374L / G256Y, M374L / A297L, M374L / A297V, M374L / F329W, M374L / P333A, M374L / N337A, M374L / G343A, M374L / D358S, M374L / I368F, M374L / I368L, M374L / L370F, M374L / M421A.

3. A glycosyltransferase mutant having the activity of catalyzing the generation of Rub2G from sweet tea glycoside, the amino acid sequence of which is obtained by any one of the following combinations of mutation sites on the basis of SEQ ID NO: 1: M374L / V31L / G225L, M374L / V31L / G256D, M374L / V31L / G343A, M374L / V31L / I368L, M374L / S104A / G343A, M374L / G343A / I368L, M374L / G343A / M421A.

4. A nucleic acid encoding the glycosyltransferase mutant of any one of claims 1-3.

5. A recombinant plasmid linked with the nucleic acid of the glycosyltransferase mutant of claim 4.

6. A recombinant cell comprising the recombinant plasmid of claim 5 or the nucleic acid of the glycosyltransferase mutant of claim 4.

7. Use of the glycosyltransferase mutant of any one of claims 1-3 in the catalytic synthesis of Rub2G.

8. Use according to claim 7, characterized in that, Comprising the following steps: 1) Construction of recombinant strain containing double-enzyme co-expression: the gene of mutant of glycosyltransferase Lb UGT and sucrose synthase gene were co-constructed into plasmid to obtain recombinant plasmid; 2) Transform the recombinant plasmid into a host bacterium to obtain a recombinant strain containing a double-enzyme co-expression system; 3) Activate the recombinant strain, transfer it to a TB induction medium, add an inducer to induce culture, centrifuge at low temperature and collect the bacterial cells, resuspend the bacterial cells in an appropriate amount of buffer and break them, centrifuge to collect the supernatant, which is the crude enzyme solution; 4) Catalytic synthesis of Rub2G: add sweet tea glycoside, sucrose and crude enzyme solution to the catalytic reaction system, react for 5-100 h, inactivate at high temperature, and centrifuge to obtain the supernatant, which is Rub2G.

9. Use according to claim 8, characterized in that, The final concentration of the inducer is 0.02-1 g / L, and the induction time is 4-50 h.

10. Use according to claim 8, characterized in that, The concentration of rebaudioside is 1-500 g / L; the concentration of sucrose is 1-1500 g / L; and the amount of crude enzyme added is 0.1-1000 g / L. The concentration of rebaudioside is 1-500 g / L; the concentration of sucrose is 1-1500 g / L; and the amount of crude enzyme added is 0.1-100

Citation Information

Patent Citations

  • High-purity steviol glycosides

    CN105408339A

  • High-purity steviol glycosides

    CN105492453A