SNP markers for soybean flowering phenotype identification and application thereof

By developing an SNP marker and primer combination at locus 12087053 on chromosome 2 of the soybean genome, and utilizing PCR amplification and BciVI digestion, the problem of rapid and efficient identification of soybean flowering time was solved, thus improving the accuracy of breeding material selection.

CN118166143BActive Publication Date: 2026-05-29INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410180533.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-02-18
Publication Date
2026-05-29
Estimated Expiration
2044-02-18

AI Technical Summary

Technical Problem

Existing technologies make it difficult to quickly and efficiently identify the flowering time of soybeans without assessing phenotypic characteristics, which limits the large-scale promotion of superior germplasm.

Method used

A SNP marker located at locus 12087053 on chromosome 2 of the soybean genome and its primer composition were developed. Soybean genomic DNA was detected by PCR amplification and BciVI restriction enzyme digestion to identify early-flowering or late-flowering materials.

Benefits of technology

This method enables accurate identification of soybean flowering time, improves the efficiency of material selection in the breeding process, and has important guiding significance for breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118166143B_ABST
    Figure CN118166143B_ABST
Patent Text Reader

Abstract

The present application relates to the field of crop molecular biology technology, and particularly relates to a SNP marker for soybean flowering period phenotype identification and application thereof. The present application provides a SNP marker for soybean flowering period phenotype identification, which is located at the 12087053th position on the chromosome 2 of soybean, and the deoxynucleotide is T or A. The present application detects the genotypes of the 12087053th position on the chromosome 02 of soybean in dozens of sample materials by using whole genome resequencing method, and the results show that the average flowering time of the material carrying TT genotype is significantly earlier than the flowering time of the material carrying AA genotype.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of crop molecular biology technology, and in particular to an SNP marker for identifying soybean flowering phenotypes and its application. Background Technology

[0002] Soybeans, as a food and oilseed crop, are one of the world's most important sources of oil and protein. However, as a typical short-day crop, soybeans are sensitive to photoperiod, which limits the cultivation areas of most varieties and restricts the large-scale promotion of superior germplasm. Flowering time is one of the specific manifestations of soybean's response to photoperiod. Currently, the main mature loci reported to control the soybean photoperiodic flowering pathway include E1-E11 (Xia Z et al., 2012; Watanabe Set al., 2011; Watanabe S et al., 2009; Liu B et al., 2008; Dissanayaka A et al., 2016; Cober ER et al., 2011; Cober ER et al., 2010; Cober ER et al., 2001; Zhao C et al., 2016; Zhai H et al., 2014; Wang F et al., 2019), as well as the FT gene family. In recent years, PRR3b (Li C et al., 2020), qFT13-3 (Li YF et al., 2023), Tof5 (Dong L et al., 2021), and Tof16 (Dong L et al., 2023) have also been cloned. (al., 2021) et al., further elucidated the soybean flowering regulation mechanism.

[0003] With the development of molecular biology techniques, molecular markers, represented by SNPs, have advantages such as being unaffected by the environment, rapid and efficient, co-dominant, and high-throughput. Furthermore, they can identify target plants by confirming the presence of the target gene without assessing phenotypic characteristics. Cleaved Amplified Polymorphic Sequences (CAPS) markers can use appropriate restriction endonucleases to detect SNP sites, offering advantages such as low cost, ease of operation, and high efficiency (Shavrukov YN et al., 2016). Based on this, developing SNP sites that can be used for soybean flowering time identification is of great significance for the development and utilization of soybean germplasm resources.

[0004] In view of this, the present invention is hereby proposed. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides an SNP marker for soybean flowering phenotypic identification and its application.

[0006] Specifically, the technical solution of the present invention is as follows:

[0007] In a first aspect, the present invention provides an SNP marker for identifying the flowering phenotype of soybean, wherein the SNP marker for identifying the flowering phenotype of soybean is located at position 12087053 on chromosome 2 of soybean genome version Glycine max Wm82.a2.v1, and its deoxynucleotide is T or A.

[0008] This invention utilizes whole-genome resequencing to detect the genotype of the soybean Chr02:12087053 locus in dozens of sample materials. The results show that the average flowering time of materials carrying the TT genotype is significantly earlier than that of materials carrying the AA genotype. Therefore, it can be determined that using the SNP locus provided by this invention to detect the flowering time of soybeans is feasible and accurate.

[0009] Secondly, the present invention provides the application of the primer composition for the identification of soybean flowering phenotypes, specifically for the identification of SNP markers for soybean flowering phenotypes, in the identification of soybean flowering phenotypes.

[0010] Thirdly, the present invention provides a primer composition for identifying the flowering phenotype of soybean, comprising an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO.01 and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.02.

[0011] F:ATTCTGCTGCAAACAAACAC(SEQ ID NO.01)

[0012] R:AATGGACTCGGACATGAGAT(SEQ ID NO.02)

[0013] The primer pairs described above were designed and developed based on the single nucleotide polymorphism sites marked by the aforementioned SNPs. They can be used to identify the flowering phenotype of soybeans by amplifying the genomic DNA of the soybean to be tested, with accurate and reliable results.

[0014] Fourthly, the present invention provides reagents, kits, or chips for identifying soybean flowering phenotypes, wherein the reagents, kits, or chips include the primer compositions described above for identifying soybean flowering phenotypes.

[0015] Fifthly, the present invention provides the application of the primer composition for soybean flowering phenotypic identification or the reagent, kit or chip for soybean flowering phenotypic identification in soybean flowering phenotypic identification.

[0016] Sixthly, based on the primer pairs described above, the present invention further provides a method for identifying the flowering phenotype of soybean, comprising: using the genomic DNA of the soybean sample to be tested as a template, performing PCR amplification using the primer composition for identifying the flowering phenotype of soybean or the reagent, kit or chip for identifying the flowering phenotype of soybean; and determining the flowering phenotype of the soybean sample to be tested based on the amplification results.

[0017] Preferably, the method for determining the type of soybean based on the amplification results includes: digesting the PCR amplification product with BciVI enzyme to obtain the digested product; detecting the digested product; if the digested product does not contain fragments of 403bp and 160bp, the soybean to be tested is an early-flowering soybean; if the digested product contains fragments of 403bp and 160bp, the soybean to be tested is a late-flowering soybean.

[0018] In a seventh aspect, based on the SNP markers described above, the present invention further provides another method for identifying the flowering phenotype of soybeans, which detects the base type of soybean samples at the Chr02:12087053 site and determines the flowering phenotype of soybean samples based on the detection results.

[0019] The determination methods include: if the base type of the soybean sample at Chr02:12087053 is TT, its flowering phenotype is determined to be early flowering; and / or, if the base type of the soybean sample at Chr02:12087053 is AA, its flowering phenotype is determined to be late flowering.

[0020] This invention does not impose any particular limitation on the method for detecting the base type at the Chr02:12087053 site in soybean samples; any conventional method in the art (such as first, second, and third generation sequencing methods) is acceptable.

[0021] Eighthly, the present invention provides the application of the SNP marker, the primer composition, or the reagent, kit, or chip in constructing a soybean variety DNA fingerprint database, analyzing the genetic diversity of soybean germplasm resources, marker-assisted breeding of soybeans, identification of soybean varieties, or preparation of soybean genome chips.

[0022] Beneficial effects:

[0023] This invention provides a SNP marker for identifying the flowering phenotype of soybean. The SNP marker is located at position 12087053 on soybean chromosome 2, and its deoxyribonucleotide is either T or A. This invention utilizes whole-genome resequencing to detect the genotype at the soybean Chr02:12087053 locus in dozens of sample materials. The results show that the average flowering time of materials carrying the TT genotype is significantly earlier than that of materials carrying the AA genotype. Attached Figure Description

[0024] To more clearly illustrate the technical solutions in this invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be described below.

[0025] Figure 1 This is a schematic diagram of agarose gel electrophoresis of the primer pair amplification products of the present invention. Wherein, M: DL2000 DNA Marker; 1-4 refer to the four materials in Table 2 of the examples, whose varieties are Williams 82, Hefeng 55, Shangrao Bayuebai, and Zhonghuang 13, respectively.

[0026] Figure 2 This is a schematic diagram of agarose gel electrophoresis of the enzyme digestion products of the primer pairs amplification products of this invention. In this diagram, M: DL2000 DNA Marker; 1-4 refer to the four materials in Table 2 of the examples, whose varieties are Williams 82, Hefeng 55, Shangrao Bayuebai, and Zhonghuang 13, respectively.

[0027] Figure 3 This is a schematic diagram of agarose gel electrophoresis of the enzyme digestion products of the primer pairs amplification products of the present invention. Wherein, M: DL2000 DNA Marker; 1-48 refer to the 48 materials in Table 3 of the examples. Detailed Implementation

[0028] This invention discovers a SNP site on Glyma.02G121600 that is significantly associated with flowering time, and then provides an SNP marker for identifying the flowering phenotype of soybean and its application. The SNP marker can be used to identify or assist in identifying the flowering phenotype of soybean.

[0029] Based on the SNP markers provided by this invention, this invention also provides a pair of primers for identifying or assisting in the identification of soybean flowering phenotypes, which consist of two single-stranded DNA molecules, with sequences as shown in SEQ ID NO.01 and SEQ ID NO.02.

[0030] The present invention also provides reagents or kits comprising the above-described primer pairs.

[0031] Preferably, in the reagent or kit, the molar ratio of the two single-stranded DNA molecules constituting the primer pair is 1:1, and they are individually packaged.

[0032] More preferably, in the reagent or kit, the final concentration of each primer in the above primer pair in the PCR reagent is 2 μmol / L.

[0033] This invention also provides the application of the above primer pairs, reagents or kits in the identification or auxiliary identification of soybean flowering.

[0034] This invention also provides the application of the above primer pairs, reagents, or kits in the preparation, identification, or auxiliary identification of soybean flowering products.

[0035] For example, by applying the primer pairs described above, an apparatus for identifying the flowering period of soybeans can be obtained, the apparatus comprising:

[0036] The detection module is used to detect the SNP site information;

[0037] The input module is used to obtain the detection results from the detection module;

[0038] The judgment module is used to compare the detection results obtained by the input module with standard data to determine the flowering phenotype of soybeans;

[0039] The output module is used to output the detection or judgment results.

[0040] This invention further provides a method for identifying or assisting in the identification of soybean flowering period, comprising the following steps:

[0041] 1) The soybeans to be tested were subjected to PCR amplification using the primers described above to obtain PCR amplification products;

[0042] 2) Digest the PCR amplification product with BciVI to obtain the digested product;

[0043] 3) Detect the enzyme digestion product. If the enzyme digestion product does not contain fragments of 403bp and 160bp, the soybean to be tested is a candidate early-flowering soybean. If the enzyme digestion product contains fragments of 403bp and 160bp, the soybean to be tested is a candidate late-flowering soybean.

[0044] In the above method, the template for PCR amplification is the genomic DNA of the soybean to be tested.

[0045] The above method, using the primer pairs designed in this invention, can specifically or assist in the identification of soybean flowering time. It has high sensitivity and high accuracy, which can greatly improve the selection efficiency of materials in the breeding process and screen breeding materials.

[0046] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention. Unless otherwise specified, the experimental methods used in the embodiments are all conventional methods; the materials and reagents used are all commercially available.

[0047] Example 1

[0048] This embodiment provides a SNP site and explains primer design. Details are as follows:

[0049] This invention discovered a polymorphic nucleotide in Glyma.02G121600. This SNP site is significantly associated with the flowering period and is located at position 2340 of the Glyma.02G121600 gene nucleotide sequence (SEQ ID NO.3). Basic information is shown in Table 1.

[0050] Table 1. Basic information on single nucleotide polymorphism sites of Chr02:12087053

[0051] SNP chromosome Allele Genotype Gene Location of genes on chromosomes Chr02:12087053 Gm02 TT, AA Glyma.02G121600 12084713-12089043

[0052] This invention downloaded the Glyma.02G121600 gene sequence from Phytozome (https: / / phytozome-next.jgi.doe.gov / ) and designed PCR primer pairs using Primer5 software:

[0053]

[0054]

[0055] The above-mentioned SNP sites can be used as CAPS markers (Chr02_BciVI). Using the above primers to amplify soybean genomic DNA, the PCR product is expected to be 563 bp in length. Theoretically, after digestion with BciVI enzyme (New England Biolabs), two fragments of 403 bp and 160 bp can be obtained.

[0056] Example 2

[0057] Based on Example 1, this invention provides a method for identifying or assisting in the identification of soybean flowering time using the primer pair described in Example 1. The details are as follows:

[0058] (1) Extraction of genomic DNA:

[0059] Four known genotypes were extracted (Williams 82, Hefeng 55, Shangrao Bayuebai, and Zhonghuang 13).

[0060] (2) PCR amplification:

[0061] Using the soybean genomic DNA to be tested as templates, PCR amplification was performed using the primer pairs from Example 1 to obtain PCR amplification products;

[0062] The PCR amplification reaction system was 20 μL (PCR reagent containing primer pairs), including 2 μL of 10 ng / μL genomic DNA, 2 μL of 10× PCR buffer (TransGen Biotech Ltd.), 1.5 μL of 2.5 mmol / L dNTPs, 0.8 μL each of 2 μmol / L primers, 0.2 μL of 1U Taq polymerase, and 12.7 μL of sterile water.

[0063] The reaction procedure was as follows: pre-denaturation at 95℃ for 5 min, denaturation at 94℃ for 30 s, annealing at 56℃ for 40 s, extension at 72℃ for 30 s, 35 cycles, and a final extension at 72℃ for 5 min, and storage at 4℃.

[0064] PCR reactions were performed on an ABI (Applied Biosystems, USA) PCR amplification thermal cycler.

[0065] 4 μL of the PCR amplification product corresponding to the primer pair was added to 6× loading buffer, and the amplification of the target fragment was detected by 2.0% agarose gel electrophoresis. PCR amplification was performed on DNA from four soybean varieties with known genotypes (Williams 82, Hefeng 55, Shangrao Bayuebai, and Zhonghuang 13). All four materials yielded a single PCR product of 563 bp, similar in length to the target fragment. Figure 1 As shown.

[0066] (3) Enzyme digestion:

[0067] The amplified PCR products were digested with BciVI restriction enzyme.

[0068] The enzyme digestion reaction system consists of 10 μl of PCR product, 5 μl of PCR product, 0.2 μl of restriction enzyme, and 1.5 μL of NEB buffer. The volume is then adjusted to 10 μL using ddH2O.

[0069] The enzyme digestion reaction system was placed in a 37°C water bath and digested for 2 hours before being removed to obtain the enzyme digestion product.

[0070] The BciVI digestion products were analyzed by 2% agarose gel electrophoresis. If the digestion products contained fragments of 403 bp and 160 bp (sequencing detection size), the genotype to be tested was AA; if the digestion products did not contain fragments of 403 bp and 160 bp (sequencing detection size), the genotype to be tested was TT. Figure 2 As shown in Table 2, the genotype results from enzyme digestion identification were consistent with the known genotypes.

[0071] Table 2. Genotypes of four soybean varieties with known genotypes at locus Chr02:12087053

[0072] Experiment number Variety Name genotype Enzyme digestion results (bp) 1 Williams 82 TT 563 2 Hefeng 55 TT 563 3 Shangrao August White AA 403 and 160 4 Zhonghuang 13 AA 403 and 160

[0073] (4) Correlation analysis between Chr02:12087053 locus genotype and flowering:

[0074] ① Identification of flowering time in soybean varieties: To verify the reliability of the markers, the flowering time of 48 soybean varieties was investigated. Field trials were conducted in 2017 at the Gongzhuling Base of the Jilin Academy of Agricultural Sciences. Row length was 2 meters, plant spacing was 0.1 meters, and row spacing was 0.55 meters. Local standard management practices were followed to ensure normal growth and maturity of the experimental materials. Field phenotypic identification was based on the "Soybean Germplasm Resource Description Specifications and Data Standards" (Qiu et al., 2006), which investigated emergence and flowering periods. Field surveys were conducted row by row. Emergence period was defined as the date when more than 50% of the seedlings emerged from the cotyledons; flowering period was defined as the date when 50% of the plants began to flower. Flowering time (days) = flowering period - emergence period.

[0075] ② The Chr02:12087053 genotype was detected using the primers provided in Examples 1 and 2, and the results are shown in Table 3.

[0076] Table 3. Genotypes and flowering times at the Chr02:12087053 locus in 48 soybean accessions.

[0077]

[0078]

[0079]

[0080] The genotype of the Chr02:12087053 locus in 48 soybean materials was detected using whole-genome resequencing, with 23 materials showing the TT genotype and 25 showing the AA genotype. Under the conditions in Gongzhuling, the average flowering time of materials carrying the TT genotype was (42.72±8.73) days; the average flowering time of materials with the AA genotype was (74.98±9.40) days. A t-test showed that the flowering time of the TT genotype materials (P<0.0001) was significantly earlier than that of the materials carrying the AA genotype. Therefore, it can be determined that using the SNP locus provided in this invention to detect the flowering time of soybeans is feasible and accurate.

[0081] (5) The flowering time of the soybean to be tested was detected using the SNP sites provided by the present invention. The specific method is as follows:

[0082] The whole-genome resequencing method provided in Example 1 was used to identify the genomic DNA of the soybean to be tested, and the sample genotype was obtained: if the obtained genotype is TT, then the soybean to be tested is a candidate material with an early flowering phenotype; if the obtained genotype is AA, then the soybean to be tested is a candidate material with a late flowering phenotype.

[0083] The genotype at the Chr02:12087053 locus in soybean can serve as a new genetic resource for marker-assisted selection in the breeding of widely adaptable and high-quality soybeans, and has very important guiding significance.

[0084] The embodiments described above are merely illustrative of several implementations of the present invention, designed to facilitate a detailed understanding of the technical solutions of the present invention. However, they should not be construed as limiting the scope of patent protection. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. The application of the primer composition for identifying the SNP markers used for soybean flowering phenotypic identification, or specific detection thereof, in the identification of soybean flowering phenotypic characteristics; wherein the SNP markers used for soybean flowering phenotypic identification are located in the soybean genome version. Glycine max The deoxyribonucleotide at position 12087053 on chromosome 2 of Wm82.a2.v1 is either T or A.

2. The application of a primer composition or reagent or kit for identifying soybean flowering phenotypes in soybean flowering phenotype identification; wherein the primer composition comprises an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO. 01, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO. 02; the reagent or kit contains the primer composition; the primer composition is used to detect the SNP marker described in claim 1.

3. The application of a chip for identifying soybean flowering phenotypes in soybean flowering phenotype identification; the chip contains a primer composition; the primer composition includes an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO. 01, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO. 02; the primer composition is used to detect the SNP marker described in claim 1.

4. A method for identifying the phenotypic characteristics of soybean flowering period, characterized in that, include: Using genomic DNA from the soybean sample as a template, PCR amplification is performed using a primer composition for soybean flowering phenotypic identification or a reagent or kit for soybean flowering phenotypic identification; the primer composition includes an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO. 01, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO. 02; the reagent or kit contains the primer composition; the primer composition is used to detect the SNP marker described in claim 1; The flowering phenotype of the soybean sample to be tested was determined based on the amplification results; The method for determining the flowering phenotype of the soybean sample to be tested based on the amplification results includes: using... BciVI The PCR amplification product was digested with enzymes to obtain the digested product; The enzyme digestion product is tested. If the enzyme digestion product does not contain fragments of 403 bp and 160 bp, the soybean to be tested is an early-flowering soybean; if the enzyme digestion product contains fragments of 403 bp and 160 bp, the soybean to be tested is a late-flowering soybean.

5. A method for identifying the phenotypic characteristics of soybean flowering period, characterized in that, The base type at the Chr02:12087053 locus in soybean samples was detected, and the flowering phenotype of the soybean samples was determined based on the detection results: if the base type at the Chr02:12087053 locus in the soybean sample was TT, its flowering phenotype was determined to be early flowering; the Chr02:12087053 locus is located in the soybean genome version Glycine max Wm82.a2.v1 is located at position 12087053 on chromosome 2.

6. A method for identifying the phenotypic characteristics of soybean flowering period, characterized in that, The base type at the Chr02:12087053 locus in soybean samples was detected, and the flowering phenotype of the soybean samples was determined based on the detection results: if the base type at the Chr02:12087053 locus in the soybean sample was AA, its flowering phenotype was determined to be late flowering; the Chr02:12087053 locus is located in the soybean genome version Glycine max Wm82.a2.v1 is located at position 12087053 on chromosome 2.

7. The application of SNP markers or primer compositions, or the reagents or kits described herein, in constructing a soybean variety DNA fingerprint database, analyzing the genetic diversity of soybean germplasm resources, marker-assisted breeding of soybean flowering phenotypes, or identifying soybean varieties; wherein the SNP marker is located in the soybean genome version Glycine max The SNP marker Wm82.a2.v1 is located at position 12087053 on chromosome 2, and its deoxynucleotide is T or A; the primer composition includes an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.01, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.02; the reagent or kit contains the primer composition; the primer composition is used to detect the SNP marker described in claim 1.

8. The application of a chip for identifying soybean flowering phenotypes in constructing a soybean variety DNA fingerprint database, analyzing the genetic diversity of soybean germplasm resources, molecular marker-assisted breeding of soybean flowering phenotypes, or identifying soybean varieties; the chip contains a primer composition; the primer composition includes an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO. 01, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO. 02; the primer composition is used to detect the SNP marker described in claim 1.

Citation Information

Patent Citations

  • SNP marker related to soybean flowering period and soybean mature period and detecting primer and method and application thereof

    CN108456743A

  • SNP (Single Nucleotide Polymorphism) molecular marker associated with soybean canopy coverage and flowering period and application

    CN115141895A