A gene ta cdpk21-7a for regulating seed dormancy and resistance of ear sprouting of plants, an in del marker and application thereof

By cloning the TaCDPK21-7A gene and developing the InDel marker, the problem of slow progress in breeding wheat pre-budding resistance was solved, enabling efficient identification and improvement of dormancy and pre-budding resistance in wheat seeds, and providing significant genetic resources and molecular tools.

CN118325949BActive Publication Date: 2026-06-05ANHUI AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410547400.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-06
Publication Date
2026-06-05
Estimated Expiration
2044-05-06

AI Technical Summary

Technical Problem

Current technologies for breeding wheat seed resistance to germination during the ear are progressing slowly and are insufficient to cope with ear germination disasters caused by high temperatures and heavy rainfall. There is a lack of effective genetic resources and molecular markers.

Method used

The TaCDPK21-7A gene was cloned, and the InDel marker was developed. The dormancy and germination resistance of wheat seeds were identified by detecting the insertion or deletion of 276 bp bases in the promoter region. Genotyping was performed using qRT-PCR and electrophoresis.

Benefits of technology

It provides new genetic resources and molecular markers, improves the efficiency of genetic improvement of wheat pre-budding resistance, is simple and highly targeted, and can significantly distinguish between varieties with different dormancy levels and pre-budding resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118325949B_ABST
    Figure CN118325949B_ABST
Patent Text Reader

Abstract

The application discloses a plant seed dormancy and ear germination resistance gene TaCDPK21-7A, an InDel marker thereof and application, and the InDel marker is an insertion or deletion of 276 base pairs at the 31th position of the promoter region of the TaCDPK21-7A gene. The application verifies that the InDel marker is extremely significantly related to a seed germination index GI by using Jimei 22 and Qitoubai parents and a natural population of a family line thereof, wherein the seed germination index GI of the family line carrying the Qitoubai genotype is significantly smaller than the GI of the family line carrying the Jimei 22 genotype, and it is indicated that the InDel marker developed in the application can effectively distinguish the dormancy level and ear germination resistance of the wheat varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the technical field, specifically to a gene TaCDPK21-7A that regulates seed dormancy and ear budding resistance in plants, its InDel marker, and its application. Background Technology

[0002] Wheat is highly susceptible to pre-harvest sprouting (PHS) when exposed to high temperatures and heavy rainfall before harvest, resulting in a significant decline in yield, quality, and seed viability, which seriously affects food security. PHS has become an important factor restricting the sustainable development of wheat production.

[0003] Seed dormancy is closely related to germination resistance. Wheat varieties with strong seed dormancy also have strong germination resistance. With global warming and frequent hot and rainy weather during the harvest season, large harvesters are unable to work in the fields after rain. Production demands increasingly higher germination resistance in wheat varieties. Therefore, it is particularly urgent to explore key genes for wheat seed dormancy and develop molecular markers to breed wheat varieties with outstanding germination resistance through gene aggregation breeding.

[0004] Wheat seed dormancy is controlled by multiple genes with major and minor effects. Currently, cloned dormant genes include TaVp-1, TaMFT, TaSdr, TaMKK3, TaQsd1, Myb10-D, TaGATA1, and Tapi4K-2A. The cloning of these dormant genes has provided important gene resources for molecular aggregation breeding of wheat resistance to pre-sprouting. However, the progress of wheat breeding for resistance to pre-sprouting is still relatively slow, and there are few wheat varieties that can reach the resistance level, making it difficult to cope with the frequent high temperature and rainy weather during the harvest period. Therefore, cloning new seed dormant genes and developing molecular markers can provide new gene resources and molecular tools for molecular aggregation breeding of wheat resistance to pre-sprouting, accelerate the genetic improvement of pre-sprouting resistance in wheat varieties, and mitigate pre-sprouting disasters. Summary of the Invention

[0005] To overcome the shortcomings of the prior art, the purpose of this invention is to provide a gene TaCDPK21-7A for regulating plant seed dormancy and ear budding resistance, its InDel marker, and its application.

[0006] The present invention achieves the above objectives through the following technical solutions:

[0007] This invention provides an application of the TaCDPK21-7A gene in regulating seed dormancy and bud break resistance in plants. The nucleotide sequence of the TaCDPK21-7A gene is shown in SEQ ID NO.1. Overexpression of the TaCDPK21-7A gene can reduce the level of seed dormancy and bud break resistance in plants, while loss of function of the TaCDPK21-7A gene can increase the level of seed dormancy and bud break resistance in plants.

[0008] As a further optimization of the present invention, the plant is wheat or Arabidopsis thaliana.

[0009] An InDel marker for identifying dormancy and germination resistance in wheat seeds, wherein the InDel marker is an insertion or deletion of 276 bp at position -31 of the promoter region of the TaCDPK21-7A gene, and the sequences of the primers for verifying the molecular marker are shown in SEQ ID NO.4-5.

[0010] SEQ ID NO.4: CDPK-InDel-F:5'TGTTGCCAAGGACAAAGGAAA 3';

[0011] SEQ ID NO.5: CDPK-InDel-R:5'AGTGGGGAGGAACTTAGGAG 3';

[0012] An application of an InDel marker in identifying dormancy and bud break resistance in wheat seeds: when the InDel marker site has an insertion of 276 bp, it is an insertion type, and the dormancy level and bud break resistance of the tested wheat variety are weak; when the InDel marker site is a deletion type, the dormancy level and bud break resistance of the tested wheat variety are strong.

[0013] As a further optimization of the present invention, the promoter sequence of the TaCDPK21-7A gene containing the InDel marker is shown in SEQ ID NO.2 or SEQ ID NO.3. The dormancy level and pre-harvest sprouting resistance of the wheat variety with the promoter sequence shown in SEQ ID NO.2 are stronger than those of the wheat variety with the promoter sequence shown in SEQ ID NO.3.

[0014] A method for identifying wheat seed dormancy and spikelet germination resistance using InDel markers includes the following steps:

[0015] S1. Extract total RNA from wheat seeds and reverse transcribe it into cDNA;

[0016] S2. Using the sequence containing the InDel marker site and its upstream and downstream bases as an amplification template, design InDel primers and perform PCR amplification to obtain an amplification product containing the InDel marker site.

[0017] S3. Genotyping the amplification products to obtain the InDel marker type of the wheat variety to be tested;

[0018] If the InDel marker type of the wheat variety being tested is inserted, then the dormancy level and pre-harvest resistance of the wheat variety are weak.

[0019] If the InDel marker type of the wheat variety being tested is missing, then the dormancy level and pre-harvest sprouting resistance of the wheat variety are strong.

[0020] The present invention has the following beneficial effects:

[0021] 1) This invention identified a gene, TaCDPK21-7A, that negatively regulates wheat seed dormancy level and bud break resistance through transcriptome results of infiltration treatment of WTB (Waitubai, a wheat variety with strong dormancy level and bud break resistance in this application) and JM22 (a wheat variety with weak dormancy level and bud break resistance in this application). Based on the gene sequence differences of different resistant varieties, a gene functional marker (InDel marker) that is easy to detect on a large scale was developed. The InDel marker bands are clearly distinguishable after electrophoresis. The band pattern differences between wheat varieties with different dormancy levels and strong / weak bud break resistance are obvious. The detection method is simple and helps to improve the targeting and specificity of molecular marker selection, thereby improving the efficiency of genetic improvement of wheat bud break resistance.

[0022] 2) This invention uses 331 natural populations of Jimai 22 and Waitoubai parents and their families to verify that the InDel marker is highly significantly correlated with the seed germination index (GI). Among them, the seed germination index (GI) of the families carrying the Waitoubai genotype is significantly lower than that of the families carrying the Jimai 22 genotype, providing a new basis for judging the dormancy level and the germination resistance of wheat varieties. Attached Figure Description

[0023] Figure 1 The relative expression levels of the TaCDPK21-7A gene in the wheat varieties Waitoubai (WTB, which is a wheat variety with strong dormancy level and high resistance to bud break in this application) and Jimai 22 (JM22, which is a wheat variety with weak dormancy level and low resistance to bud break in this application) at different post-flowering stages (25 days, 30 days, and 35 days after flowering), different seed after-ripening stages (0 weeks, 2 weeks, and 4 weeks after ripening), and different seed soaking times (4 hours, 6 hours, and 10 hours) are statistically analyzed.

[0024] Figure 2 Here is the full-length sequence structure diagram of the TaCDPK21-7A gene;

[0025] Figure 3 This is a chromatogram of agarose gel electrophoresis results.

[0026] Figure 4 Figure 4A shows the mutation sites of the wheat EMS mutant cdpk21; Figure 4B shows the relative expression levels of the TaCDPK21-7A gene in wheat seeds of JM22 and the mutant cdpk21; and the germination rate of wheat ears of JM22 and the mutant cdpk21. Figure 4 C) and germination morphology diagram (4D); germination rate of wheat seeds of JM22 and mutant cdpk21 ( Figure 4 E) and the budding hairstyle illustration (4F);

[0027] Figure 5 The graph shows the relative expression levels of the TaCDPK21-7A gene in wild-type Arabidopsis thaliana (Col-0) and its TaCDPK21-7A homologous mutant lines (atcdpk24-3, atcdpk24-6) (5A); the graph also shows the relative expression levels of the TaCDPK21-7A gene in wild-type Arabidopsis thaliana (Col-0) and its complemented Arabidopsis thaliana TaCDPK21-7A homologous mutant lines (35S: TaCDPK21 / atcdpk24-#3, 35S: TaCDPK21 / The relative expression levels of atcdpk24-#6 and TaCDPK21-7A gene overexpressing Arabidopsis thaliana lines (35S: TaCDPK21-#2, 35S: TaCDPK21-#12) are shown in Figure 5B; the germination rate of Colombian wild-type Arabidopsis thaliana and its TaCDPK21-7A homologous mutant Arabidopsis thaliana lines, the TaCDPK21-7A gene homologous mutant Arabidopsis thaliana lines with replacement, and the TaCDPK21-7A gene overexpressing Arabidopsis thaliana lines are shown in Figure 5C and phenotypic figure 5D. Detailed Implementation

[0028] The present application will now be described in further detail with reference to the accompanying drawings. It should be noted that the following specific embodiments are only used to further illustrate the present application and should not be construed as limiting the scope of protection of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.

[0029] 1. Materials

[0030] Unless otherwise specified, the methods used in this embodiment are conventional methods known to those skilled in the art, and the reagents and materials used are commercially available products.

[0031] 2. Method

[0032] 2.1 Identification and analysis of wheat gene TaCDPK21-7A

[0033] 2.1.1 Transcriptome Identification and Analysis

[0034] High-temperature treatment was applied to the mid-to-late developmental stage of the wheat variety Waitoubai, and seed samples were collected. Transcriptome sequencing (https: / / www.ncbi.nlm.nih.gov / bioproject / PRJNA895954) was used to analyze the transcriptome data of Waitoubai under high-temperature treatment during the mid-to-late developmental stage, identifying a Ca2+ gene associated with seed dormancy. 2+ The signal receptor gene TaCDPK21-7A (TraesCS7A02G267000, named TaCDPK21-7A) was investigated, and its expression pattern at different growth stages and seed soaking periods was studied in two wheat varieties, Waitoubai and Jimai 22 (Jimai 22 has weaker pre-budding resistance than Waitoubai; therefore, in this application, Waitoubai is considered a wheat variety with strong dormancy level and pre-budding resistance, while Jimai 22 is considered a wheat variety with weak dormancy level and pre-budding resistance). Referring to the wheat genome sequence, the nucleotide sequence of the TaCDPK21-7A gene is shown in SEQ ID NO.1.

[0035] 2.1.2 qRT-PCR Identification Analysis

[0036] Quantitative real-time PCR (qRT-PCR) is a method that uses fluorescent chemicals to measure the total amount of product after each polymerase chain reaction (PCR) cycle in a DNA amplification reaction. The basic principle is to add a fluorescent group to the PCR reaction system, monitor the entire PCR process in real time by accumulating fluorescence signals, and finally quantify unknown templates using a standard curve. The fluorescent substances used in qRT-PCR include fluorescent probes and fluorescent dyes. This experiment uses SYBR fluorescent dye. The principle is that a certain amount of SYBR fluorescent dye is added to the PCR reaction system. SYBR dye specifically incorporates into the DNA double strand and emits a fluorescent signal, while SYBR dye molecules not incorporated into the strand do not emit any fluorescent signal, thus ensuring that the increase in fluorescence signal is completely synchronized with the increase in PCR product. SYBR only binds to double-stranded DNA; therefore, the specificity of the PCR reaction can be determined by using a melting curve.

[0037] Wheat seeds from different soaking stages were collected in step 2.1.1. Wheat seed RNA was extracted and reverse transcribed into cDNA. Reverse transcription was performed using the Prime Script RT reagent kit (Takara Biotechnology, Dalian, China). Quantitative real-time PCR was then performed according to the instructions of the SYBR Premix Ex Taq GC kit (Takara Biotechnology, Dalian, China). The PCR primer sequences, PCR reaction system, and PCR reaction procedure are as follows:

[0038] PCR amplification primer sequences:

[0039] SEQ ID NO.6:ACAAGGACAAGAACGGCAAC;

[0040] SEQ ID NO. 7: CAGCATCCTGATCTCCGACT.

[0041] PCR reaction system: The total qPCR reaction system was 20 μL, including 10 μL of SYBR Advantage Premix (2×), 2.0 μL of reverse transcribed cDNA, and 7.2 μL of ddH2O. 0.4 μL each of 10 μM upstream and downstream primers for mRNA quantification were added.

[0042] PCR reaction procedure: For quantification, the mRNA quantification program was 95℃ for 2 min, 95℃ for 10 s, and 60℃ for 30 s, with 40 cycles. The real-time PCR process was run on a 7500 Real-Time PCR System (Bio-Rad Laboratories, Shanghai, China). Actin was selected as the internal control gene for mRNA, with four replicates per sample. The Ct values ​​for each group of samples were calculated using 2... -△△Ct The algorithm calculates the change in relative expression levels.

[0043] The expression of TaCDPK21-7A in the seeds of wheat varieties Waitoubai and Jimai 22 was analyzed using qRT-PCR. The results are as follows: Figure 1 As shown, Figure 1 A represents the relative expression levels of the TaCDPK21-7A gene in two wheat varieties (Waitoubai and Jimai 22) at 25 days (25 DPA), 30 days (30 DPA), and 35 days (35 DPA) after flowering. This was achieved through... Figure 1 As shown in A, at 25, 30 and 35 days after wheat flowering, the relative expression level of TaCDPK21-7A gene in Jimai 22 was significantly higher than that in Waitoubai.

[0044] Figure 1 B represents the relative expression levels of the TaCDPK21-7A gene in two wheat varieties (Waitoubai and Jimai 22) at 0 weeks (0W), 2 weeks (2W), and 4 weeks (4W) of seed after-ripening. Figure 1 B indicates that at 0, 2 and 4 weeks of wheat seed after-ripening, the relative expression level of the TaCDPK21-7A gene in Jimai 22 was significantly higher than that in Waitoubai.

[0045] Figure 1 C represents the relative expression level of the TaCDPK21-7A gene in seeds of two wheat varieties (Waitoubai and Jimai 22) at 4h, 6h, and 10h of soaking. Figure 1 As shown in C, when wheat seeds were soaked for 4h, 6h, and 10h, the relative expression level of the TaCDPK21-7A gene in Jimai 22 was significantly higher than that in Waitoubai. Based on the above, it is speculated that the TaCDPK21-7A gene may be involved in regulating seed dormancy and germination, and negatively regulate wheat seed dormancy and ear sprouting resistance.

[0046] 2.2 Development of InDel markers for the TaCDPK21-7A gene

[0047] InDel refers to the insertion or deletion of nucleotide fragments of different sizes at the same locus in the genome of closely related species or different individuals of the same species. It is a phenomenon that produces gaps during homologous sequence alignment. InDel is widely distributed, dense, and numerous in the genome. InDel polymorphic molecular markers are markers that are designed with specific primers based on the sequences flanking the insertion / deletion site for PCR amplification. In essence, it is still a length polymorphism marker and can be genotyped using a convenient electrophoresis platform.

[0048] 2.2.1 Cloning of candidate genes

[0049] Based on the wheat genome sequence, obtain the full-length sequence of the TaCDPK21-7A gene, including the TaCDPK21-7A gene and its promoter region (2000 bp). Figure 2 As shown, using the full-length TaCDPK21-7A gene sequence as a template, specific primers were designed using PrimerPremier 5.0 (https: / / www.PremierBiosoft.com) software to amplify the fragment. The full-length gene was cloned in Jimai 22 (JM22) and Waitoubai (WTB) according to the following operations.

[0050] Because the TaCDPK21-7A gene and its promoter sequence are too long, three pairs of specific primers were used for amplification. The specific primer sequences are as follows:

[0051] SEQ ID NO.8: TaCDPF21-7A-F1:5'AAATCATCTTCATTGATCAAATCATAACTG 3';

[0052] SEQ ID NO.9: TaCDPF21-7A-R1:5'CGTTCATTTACTCCCTCCGATCTG 3';

[0053] SEQ ID NO.10: TaCDPF21-7A-F2:5'TCCGCTGTGCGTACTTGTCTCTC 3';

[0054] SEQ ID NO. 11: TaCDPF21-7A-R2:5'ACTTAGTTCGTCGCCTTCGTTG 3'.

[0055] SEQ ID NO.12: TaCDPF21-7A-F3:5'CGATCAACGTTCTTGCGCAC 3';

[0056] SEQ ID NO. 13: TaCDPF21-7A-R3:5'CACATGAAATCTAATCGACGGCGAT 3'.

[0057] PCR amplification was performed using the high-fidelity enzyme Fastpfu, which has high amplification efficiency and speed, according to the following reaction system: 10 μL 5×PCR Buffer (15 mM MgCl2), 5 μL dNTPmix (2.5 mM), 2 μL upstream primer (10 μM), 2 μL downstream primer (10 μM), 4 μL template DNA (50-100 ng / μL), 1 μL Fast pfu (2.5 U / μL), and distilled water to a final volume of 50 μL.

[0058] Reaction procedure: 95℃ pre-denaturation for 2 min, 95℃ denaturation for 20 s, annealing at the required annealing temperature for each primer pair for 20 s, extension at 72℃ (extension time can be calculated based on fragment length and Fastpfu amplification efficiency of 2-4 kb / min), repeat the denaturation-annealing-extension three-step cycle 35 times, supplementary extension at 72℃ for 5 min, and store the product at 4℃.

[0059] Add 2 μL of 6×DNA loading buffer to the PCR product and perform electrophoresis on a 1.5% agarose gel. After electrophoresis, cut off the gel block containing the target fragment and use the agarose gel DNA recovery kit purchased from Kangwei Century Biotechnology Co., Ltd. to recover and purify the target fragment according to the instructions (https: / / www.cwbiotech.com / uploads / websitepdf / 216c4037-3eae-4ac2-b86a-762277a7adc1.pdf).

[0060] Add 1 μL of plasmid (Blunt-zero, purchased from TransGen Biotech, http: / / www.transgen.com.cn / ) and 4 μL of PCR purification product to a sample tube, ligate at 25°C for 20 min, and cool at 12°C. Remove the ligated sample and add 50 μL of competent cells (Trans-T, stored at -80°C before use) to a UV-sterilized workbench. Mix gently and incubate on ice for 20 min. After completion, transfer the sample to a water bath and heat shock at 42°C for 45 s, then immediately place it on ice for 2 min. On a sterile workbench, add 950 μL of SOC medium (formula per 100 mL: 2 g tryptone, 0.5 g yeast extract, 0.06 g NaCl, 0.02 g KCl, 0.2033 g MgCl2·6H2O, 0.2465 g MgSO4·7H2O, 0.36 g glucose, 100 mL ultrapure water) to the sample and incubate at 37°C for 1-1.5 h. Next, in a sterile workbench, spread 100-200 μL of the bacterial culture evenly onto LB solid medium containing kanamycin (formula per 100 mL: 1 g tryptone, 0.5 g yeast extract, 0.5 g NaCl, 1.5 g agar powder, 100 μL kanamycin solution, 100 mL ultrapure water) and incubate at 37°C for 15-16 h. Once the bacterial colonies have grown to a suitable size, add 6 μL of sterile water to each PCR sample well. Use a pipette with a maximum volume of 10 μL to transfer the bacteria into the well. Gently mix by aspiration, then transfer 4 μL to a centrifuge tube containing 1000 μL of LB liquid medium (per 100 mL: 1 g tryptone, 0.5 g yeast extract, 0.5 g NaCl, 100 μL kanamycin solution, 100 mL ultrapure water). Incubate the centrifuge tube at 37°C for 4-6 hours. Simultaneously, perform PCR detection using M13 as a primer and the remaining 2 μL of bacterial culture in the sample well as a template. If the PCR reaction result is positive and contains the target fragment, the sample can be sent for sequencing.

[0061] The M13 primer sequence is:

[0062] SEQ ID NO.14: M13-F:5'CAGGAAACAGCTATGACCATGAT 3';

[0063] SEQ ID NO. 15: M13-R:5'GTAAAACGACGGCCAGTGC 3'.

[0064] 2.2.2 Sequence analysis of candidate genes

[0065] The alignment and structural analysis of the candidate gene sequencing results were performed using DNAMAN software (https: / / www.lynnon.com / dn aman.html). The comparison revealed a 276bp insertion / deletion variant in the promoter region of the TaCDPK21-7A gene. Specifically, the promoter sequence of the TaCDPK21-7A gene in WTB (anti-PHS) is shown in SEQ NO.2 (a 276bp deletion), while the promoter sequence in JM22 (PHS-sensitive) is shown in SEQ NO.3 (with a 276bp insertion, located at positions -31 to -306 of the SEQ NO.3 sequence). Specific primers (as shown in SEQ ID NO.4-5) were designed using PrimerPremier5.0 software (http: / / www.premierbiosoft.com) to target this mutation, resulting in an InDel marker (i.e., CDPK21-InDel).

[0066] The nucleotide sequences of the specific primers are as follows:

[0067] SEQ ID NO.4: CDPK-InDel-F:5'TGTTGCCAAGGACAAAGGAAA 3';

[0068] SEQ ID NO. 5: CDPK-InDel-R:5'AGTGGGGAGGAACTTAGGAG 3'.

[0069] 2.2.3 InDel labeling amplification, restriction enzyme digestion, and electrophoretic typing

[0070] PCR amplification system: 1 μL 2.5 mM dNTP, 0.25 μL 10 μM primer, 1 μL 10×EasyTaq Buffer, 0.5 U EasyTaq, 100 ng DNA template, and bring the volume up to 10 μL with double-distilled water.

[0071] PCR amplification program: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s; annealing for 30 s at 62℃ starting with a 0.3℃ decrease per cycle; 72℃ extension for 30 s, 40 cycles; 72℃ extension for 8 min.

[0072] Electrophoresis: Add 3 μL of 6×DNA Loading Buffer to the sample, and take 5 μL of PCR product for electrophoresis typing on a 2.5% agarose gel.

[0073] like Figure 3 As shown, consistent with the prediction results, the band of Jimai 22 (CDPK-ins allelic variant) is high, while the band of Waitoubai (CD PK-del allelic variant) is low, with a loss of 276bp compared to Jimai 22.

[0074] 2.2.4 Validation of InDel markers in natural populations

[0075] Seed germination index (GI) determination

[0076] Fifty whole seeds of 331 wheat varieties, including Jimai 22 and Waitoubai parents and their families, were collected at different times (5 days after harvest) in 2021-2022. Two replicates were used, and the seeds were evenly placed ventrally downwards in 90mm diameter Petri dishes. 10mL of sterile water was added, and the dishes were incubated for 3 days at 20℃ under 14h (daytime) / 10h (nighttime) conditions. The number of germinated seeds (n1) on day 1, n2 on day 2, n3 on day 3, and the number of ungerminated seeds (n0) after 3 days were recorded. The germination index (GI) was calculated using the following formula:

[0077] GI=(3*n1+2*n2+n3) / 3*(n1+n2+n3+n0).

[0078] The phenotypic data was prepared using Excel software, and the correlation analysis between the phenotypic data and the labels was performed using SPSS software.

[0079] The Manny-Whitney test (U-test) analysis between two allelic variations (CDPK-ins and CDPK-del) and seed dormancy traits in 331 wheat varieties from the Waitoubai / Jimai 22 parent and its families was performed using IBM SPSS Statistics 20 (www.spss.com). The results are shown in Table 1.

[0080] Table 1

[0081]

[0082] Note: 21GI5-HB, 22GI5-SZ, 22GI5-HY, and 22GI5-HF represent the seed germination index (GI) of 331 wheat varieties of the Waitoubai / Jimai 22 family, measured 5 days after harvest in Huaibei (HB), Suzhou (SZ), Huaiyuan (HY), and Hefei (HF) in 2021 and 2022, respectively; 21GI-HF, 21GI-HB, 22GI-HF, and 22GI-HB represent the seed germination index (GI) of the Waitoubai / Jimai 22 parents, measured in Hefei (HF) and Huaibei (HB) in 2021 and 2022, respectively.

[0083] **This indicates that the two different allelic banding patterns of the marker are highly significantly correlated with the trait at the 0.01 level.

[0084] As shown in Table 1 above, the differences in seed dormancy phenotypic values ​​(GI) between wheat varieties carrying the two allelic variations of CDPK-ins and CDPK-del were extremely significant (P < 0.01).

[0085] 2.3 Determination of seed germination rate in plants with TaCDPK21-7A gene overexpression and gene function loss

[0086] In seed germination experiments, germination rate is represented by the number of germinated seeds divided by the total number of viable seeds.

[0087] 2.3.1 Determination of wheat seed germination rate

[0088] The role of the TaCDPK21-7A gene in wheat seed dormancy and germination resistance was verified using an EMS-induced mutant (cdpk21, jm_chr7A_270043204) based on the wheat variety Jimai 22 (JM22, which is used in this application as a wheat variety with weak dormancy level and low germination resistance). The material used for seed germination phenotype identification was M5 generation EMS mutant plants grown in a greenhouse at 23±1℃ (16h light / 8h dark). The EMS mutant was provided by Yantai Jien Biotechnology Co., Ltd.

[0089] In the wheat seed germination experiment, intact and healthy wheat seeds were divided into three replicates, placed in petri dishes with a diameter of 90 mm, moistened with 9 mL of distilled water, and cultured at 20 °C under a photoperiod of 14 h day / 10 h night. Germination was considered to occur when the embryo of the wheat seed ruptured.

[0090] like Figure 4 As shown, Figure 4 A is a schematic diagram of the mutation sites in the wheat EMS mutant cdpk21; Figure 4 B represents the relative expression level of the TaCD PK21-7A gene in JM22 and the mutant cdpk21 seeds; Figure 4 C and 4D are the whole spike germination rate and germination morphology of JM22 and mutant cdpk21 plants; Figure 4 E and 4F are seed germination rates and germination phenotypes of JM22 and the mutant cdpk21, respectively. Figure 4 D. Whole ear and Figure 4 The F seeds were photographed 7 days and 5 days after germination, respectively;

[0091] Therefore, it can be concluded that the expression of the TaCDPK21-7A gene can release wheat seed dormancy and promote wheat seed germination, that is, it can reduce the dormancy level of plant seeds and the resistance to germination in the ear. The loss of function of the TaCDPK21-7A gene can increase the dormancy level of plant seeds and the resistance to germination in the ear.

[0092] 2.3.2 Determination of Arabidopsis thaliana seed germination rate

[0093] All Arabidopsis plant materials used in this application (including transgenic lines and wild-type (WT) plants) are of the Columbia ecotype (Col-0). The homolog of the TaCDPK21-7A gene in Arabidopsis is Atcdpk24. In this embodiment, the AtCDPK24 mutant (SALK_015986C, a gene loss mutant) was ordered from the Arabidopsis Information Resource Database (TAIR, https: / / www.Arabidopsis.org / ). The CDS sequence encoding TaCDPK21-7A was then inserted into the EcoRI and BamHI multiple cloning sites of the pCAMBIA1305 vector and expressed using the CaMV35S promoter (the 35S promoter of cauliflower mosaic virus). Subsequently, plasmids were obtained through Agrobacterium-mediated transformation. The obtained plasmids were introduced into Columbia wild-type Arabidopsis and the Arabidopsis homolog AtCDPK24 mutant, and homozygous Arabidopsis transgenic lines (T2 generation) were selected for subsequent experimental verification.

[0094] The Colombian wild-type Arabidopsis thaliana (Col-0) and its AtCDPK21-7A Arabidopsis thaliana homolog AtCDPK24 mutant (SALK_015986C, a gene loss mutant) lines (atcdpk24-3, atcdpk24-6), and the Arabidopsis thaliana TaCDPK21-7A gene homolog mutant line (35S:TaCDPK21 / atcdpk24-#3) were compared. Arabidopsis thaliana lines overexpressing the 35S:TaCDPK21 / atcdpk24-#6 and TaCDPK21-7A genes (35S:TaCDPK21-#2, 35S:TaCDPK21-#12) were vernalized at 4℃ for 3 days, then moved to a greenhouse at 24±1℃ (16 hours light / 8 hours darkness) for 7 days, and then moved to square planting pots containing a mixture of vermiculite and black soil (3:1, v / v).

[0095] In the germination experiment of Arabidopsis thaliana seeds, the seeds were placed on two layers of filter paper, which were moistened with deionized water, and grown in a growth chamber (23°C during the day, 21°C at night, 16h light / 8h darkness). The germination rate of Arabidopsis thaliana seeds was counted on the 7th day, and the appearance of a protruding radicle was considered germination.

[0096] like Figure 5 As shown, Figure 5 A represents the relative expression level of the TaCDPK21-7A gene in Colombian wild-type Arabidopsis thaliana (Col-0) and its TaCDPK21-7A homologous mutant Arabidopsis thaliana lines (atcdpk24-3, atcdpk24-6); Figure 5 B represents the relative expression level of the TaCDPK21-7A gene in wild-type Arabidopsis thaliana (Col-0) and its complemented Arabidopsis thaliana TaCDPK21-7A gene homolog mutant lines (35S:TaCDPK21 / atcdpk24-#3, 35S:TaCDPK21 / atcdpk24-#6), and TaCDPK21-7A gene overexpressing Arabidopsis thaliana lines (35S:TaCDPK21-#2, 35S:TaCDPK21-#12); Figure 5 C and 5D are germination rate statistics and phenotypic diagrams of Colombian wild-type Arabidopsis thaliana (Col-0) and its TaCDPK21-7A homologous gene mutant lines (atcdpk24-3, atcdpk24-6), the supplemented Arabidopsis thaliana TaCDPK21-7A gene homologous gene mutant lines (35S:TaCDPK21 / atcdpk24-#3, 35S:TaCDPK21 / atcdpk24-#6), and the TaCDPK21-7A gene overexpressing Arabidopsis thaliana lines (35S:TaCDPK21-#2, 35S:TaCDPK21-#12).

[0097] This demonstrates that the TaCDPK21-7A gene has the function of negatively regulating the seed dormancy level of Arabidopsis thaliana. That is, knocking out the TaCDPK21-7A gene will increase the seed dormancy level of the plant, while overexpression of the TaCDPK21-7A gene will decrease the seed dormancy level of the plant.

[0098] 3. Conclusion

[0099] This application investigated the expression changes of the TaCDPK21-7A gene at different stages of seed development (25d, 30d, and 35d after flowering, during the period of gradual dormancy formation), different stages of after-ripening (0W, 2W, and 4W, during the period of gradual dormancy release), and different stages of soaking (4h, 6h, and 10h, during the period of gradual dormancy release) in Waitoubai and Jimai 22. The results showed that the expression level of the TaCDPK21-7A gene decreased during seed dormancy formation and increased during seed dormancy release. Furthermore, the expression level of TaCDPK21-7A in Jimai 22 was consistently higher than that in Waitoubai, indicating that the TaCDPK21-7A gene may be involved in regulating seed dormancy and germination, as well as ear sprouting resistance. High-level expression of the TaCDPK21-7A gene was negatively correlated with seed dormancy level and ear sprouting resistance.

[0100] Subsequently, transcriptome sequencing identified one Ca gene in the wheat variety WTB. 2+ The signal receptor gene TaCDPK21-7A (encoding serine / threonine kinase) was compared with that of Waitoubai and Jimai 22. An insertion / deletion variant of 276 bp was found in the promoter region of the TaCDPK21-7A gene in both Waitoubai and Jimai 22. Based on this insertion / deletion variant, an InDel marker (named CDPK21-InDel) was developed. The CDPK21-InDel marker was used to detect the seed dormancy / ear germination resistance levels of 331 wheat varieties with different levels of seed dormancy / ear germination resistance in Jimai 22 and Waitoubai parents and their families. Combined with the seed dormancy phenotype measured under multiple environments, it was found that this insertion / deletion variant was significantly correlated with the seed germination index (GI) (P < 0.01).

[0101] Further investigation using the wheat EMS mutant (cdpk21), Arabidopsis homologous gene mutants and their replacement lines, and heterologously overexpressed Arabidopsis materials confirmed that the TaCDPK21-7A gene has the function of negatively regulating seed dormancy levels and pre-harvest sprouting resistance. These findings provide important gene resources and molecular markers for efficiently enhancing pre-harvest sprouting resistance in modern wheat varieties.

[0102] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. A method based on TaCDPK21-7A The application of the InDel marker of the gene in identifying wheat seed dormancy and spikelet germination resistance is characterized by, The TaCDPK21-7A The nucleotide sequence of the gene is shown in SEQ ID NO.1; The InDel marker is located at TaCDPK21-7A The insertion or deletion of 276 bp nucleotides at position -31 of the promoter region of the gene was verified by the sequence of the primer with the InDel tag as shown in SEQ ID NO.4-5. When the InDel marker site contains an insertion of 276 bp nucleotides, it is considered an insertion type, and the tested wheat variety exhibits weak dormancy level and sprouting resistance. When the InDel marker site is a deletion type, the tested wheat variety exhibits strong dormancy level and sprouting resistance.

2. The application according to claim 1, characterized in that, The InDel mark is located TaCDPK21-7A The gene promoter sequences are shown in SEQ ID NO.2 or SEQ ID NO.

3. The wheat variety with the promoter sequence shown in SEQ ID NO.2 has a higher dormancy level and stronger pre-budding resistance than the wheat variety with the promoter sequence shown in SEQ ID NO.

3.

3. A method utilizing based on TaCDPK21-7A A method for identifying wheat seed dormancy and spikelet germination resistance using InDel markers of genes, characterized by: Includes the following steps: S1. Extract total RNA from wheat seeds and reverse transcribe it into cDNA; The TaCDPK21-7A The nucleotide sequence of the gene is shown in SEQ ID NO.1; The InDel marker is located at TaCDPK21-7A The insertion or deletion of 276 bp nucleotides at position -31 of the promoter region of the gene was verified by the sequence of the primer with the InDel tag as shown in SEQ ID NO.4-5. S2. Using the sequence containing the InDel marker site and its upstream and downstream nucleotides as an amplification template, design InDel primers and perform PCR amplification to obtain an amplification product containing the InDel marker site. S3. Perform typing detection on the amplification products to obtain the InDel marker type of the wheat variety to be tested; If the InDel marker type of the wheat variety to be tested is inserted, the dormancy level and pre-harvest sprouting resistance of the wheat variety are weak; If the InDel marker type of the wheat variety being tested is missing, then the dormancy level and pre-harvest sprouting resistance of the wheat variety are strong.