Construction of attenuated african swine fever virus strains with deletion of twenty-four genes and their use as vaccines
By constructing an attenuated ASFV-Δ24 virus strain by deleting multiple MGF genes, the problems of insufficient safety and protection rate of existing vaccines were solved, achieving stable virulence reduction and efficient immune protection, which is suitable for African swine fever vaccines.
Patent Information
- Application Number
- CN202410578697.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-05-11
- Publication Date
- 2026-05-08
- Estimated Expiration
- 2044-05-11
AI Technical Summary
Existing African swine fever vaccines have shortcomings in terms of safety and protection rate. In particular, live attenuated vaccines are prone to reversion to virulence, and the preparation process of genetically engineered vaccines is complex and no effective commercial vaccines have been developed.
By combining and deleting multiple MGF genes, including MGF-360-1La, MGF-360-1Lb, MGF-360-2L, KP177R, L83L, L60L, and MGF-360-3L, an attenuated ASFV-Δ24 virus strain was constructed. Homologous recombination technology was used for gene editing to ensure the loss of function of the encoded protein.
The constructed attenuated ASFV-Δ24 virus strain is virulent and does not cause disease after high-dose immunization, providing 100% immune protection. It is suitable as a candidate strain for African swine fever vaccine and has good safety and protective efficacy.
Smart Images

Figure CN118421572B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bioengineering technology, specifically relating to the construction of an attenuated African swine fever virus strain ASFV-Δ24 lacking 24 genes and its application as a vaccine. Background Technology
[0002] African swine fever (ASF) is a highly contagious disease caused by the African swine fever virus (ASFV). Both wild boars and domestic pigs are susceptible, and virulent strains can cause a 100% mortality rate in domestic pigs. ASFV is the only member of the genus *Asfarviridae* and the only DNA virus (arbovirus) that can be transmitted through arthropods. ASFV is a multi-layered, double-stranded DNA virus, approximately 200 nm in diameter. The innermost viral nucleic acid is enclosed by a coreshell, which is further enclosed by an inner membrane (also known as an inner lipid membrane). Outside the inner membrane is an icosahedral protein capsid, and the outermost layer of the virus is a plasma membrane. p72 is a major capsid protein (encoded by the B646L gene, derived from pp220 and pp62), accounting for approximately 33% of the total capsid protein. The p72 gene sequence is the basis for ASFV genotyping, and p72 is also the main antigen for ASFV diagnosis. Many detection reagents are developed based on p72 protein information, and studies have found that its monoclonal antibodies have the ability to neutralize ASFV.
[0003] African swine fever (ASF) has caused incalculable economic losses, and vaccination is the most effective means of eradicating it. Currently, domestic and international research on ASF vaccines categorizes them into four main types: 1. Inactivated vaccines: These are the safest vaccines for controlling ASF outbreaks, posing no risk of virus transmission, but their protection rate is extremely low, making them insufficient to meet the needs of prevention and control in production. 2. Live attenuated vaccines: These vaccines offer extremely high protection against the parent strain and have a simple preparation process, but they are highly susceptible to viral reversion, exacerbating the impact of the epidemic. 3. Subunit vaccines: These vaccines remove the viral genome structure, ensuring vaccine safety while retaining important viral proteins, allowing them to be stably expressed in pigs and resist ASF invasion. However, their preparation process is complex and the production cycle is long. 4. Genetically engineered vaccines: These can be divided into DNA vaccines, RNA vaccines, and gene knockout vaccines. These vaccines combine emerging genetic engineering technologies to modify ASFV at the genomic level, reducing its virulence by deleting certain genes while simultaneously triggering antiviral immunity to protect the host. All of the above vaccines are still under further research, and no effective commercial vaccines have yet been developed.
[0004] This study aims to use genetic engineering techniques to create an attenuated strain of ASFV by knocking out virulence genes or genes involved in interfering with host immunity. This attenuated strain will have more stable virulence, a lower likelihood of virulence reversion, and higher safety. Several articles have already reported on this type of vaccine.
[0005] Studies have shown that Vivian O'Donnell et al. knocked out the B119L and DP96R genes in the Georgian ASFV (ASFV-G) genome in 2007, constructing the ASFV-G-Δ9GL / ΔUK strain. This strain provided 100% protection to pigs 14 days after immunization, but viremia was observed. The study also confirmed that the protective effect was related to the presence of ASFV antibodies in the serum, but not to cells secreting specific IFN-γ. The I267L gene plays an important role in ASFV replication, promoting viral replication by inhibiting the RNA Pol-III-RIG-I-mediated innate antiviral immune response. Ran Yong et al. constructed the ASFV-ΔI267L gene-deleted virus (deleting the I267L gene), and animal experiments showed that this deleted virus provided 80% protection against the parent virus. Manuel V. Borca et al. discovered that the EP402R gene encodes a transmembrane protein of ASFV, thereby participating in the host's immune regulation. Experiments also demonstrated that the deletion of the EP402R gene does not provide any protection against the virus.
[0006] In the genome of African swine fever (ASF), there exists a special type of gene—the multi-gene family (MGF). It is known that different ASFV genotypes contain five MGF families: MGF100 (1R / 2L / 3L), MGF110 (1L / 2L / 3L / 4L / 5L / 6L / 7L / 8L / 9L / 10L / 11L / 12L / 13L / 14L), and MGF110 (1L / 2L / 3L / 4L / 5L / 6L / 7L / 8L / 9L / 10L / 11L / 12L / 13L / 14L). MGF300 (1L / 2R / 3L / 4L), MGF360 (1L / 2L / 3L / 4L / 5L / 6L / 7L / 8L / 9L / 10L / 11L / 12L / 13L / 14L / 15R / 16R / 17R / 18R / 19R / 20R / 21R / 22R), and MGF505 (1R / 2R / 3R / 4R / 5R / 6R / 7R / 8R / 9R / 10R / 11L) have been reported to play important roles in viral virulence, regulation of interferon responses, and inflammatory responses. Therefore, research on constructing MGF gene-deleted viruses is quite extensive.
[0007] The recombinant virus, with simultaneous deletions of MGF360-9L, MGF360-10L, MGF360-11L, MGF360-12L, MGF360-13L, MGF360-14L, MGF505-1R, MGF505-2R, MGF505-3R, and MGF505-4R, exhibits a replication rate at the cellular level similar to its parental viruses, Benin97 / 1 and OURT88 / 3. Immunization with this virus induces the production of large amounts of IFN-β, providing 100% protection against both homologous and heterologous strains after challenge. Another study confirmed that the deletion virus constructed by simultaneously deleting MGF360-9L and MGF505-7R achieved an 80% protection rate after immunization. However, not all deletion viruses provide good protection. Studies have found that the replication rate and clinical symptoms of the virus after deleting MGF110-1L are similar to those of the parental virus, demonstrating that this gene is not related to viral virulence. A recombinant virus (ASFV-G-Δ9GL / ΔMGF) lacking MGF360, MGF505, and CD2V can be used as a candidate vaccine for African swine fever. After immunization with this deleted strain, the survival rate of pigs is 100%, and no viremia or ASFV-specific antibodies are detected after immunization. However, this strain does not provide protection. After simultaneous deletion of MGF110-5L and MGF110-6L in ASFV-G, viral replication is unchanged, and homologous protection is not provided after immunization. The naturally recombinant virus discovered by Tomoya Kitamura et al. had 11 genes deleted (MGF300-4L, MGF360-8L, MGF360-9L, MGF360-10L, MGF360-11L, MGF505-1R, MGF360-12L, MGF360-13L, MGF360-14L, MGF505-2R, and MGF505-3R), which provides 100% protection against parental strains.
[0008] To address the above, this invention combines the deletion of the following genes: MGF-360-1La, MGF-360-1Lb, MGF-360-2L, KP177R, L83L, L60L, MGF-360-3L, MGF-110-1L, ASFV-G-ACD-00090, MGF-110-2L, MGF-110-3L, ASFV-G-ACD-00120, MGF-110-4L, and MGF-11. By incorporating the 0-5L-6L, MGF-110-7L, 285L, ASFV-G-ACD-00160, MGF-110-8L, MGF-100-1R, MGF-300-1L, MGF-300-2R, MGF-300-4L, MGF-100-2L, and MGF-100-3L genes, a relatively safe attenuated African swine fever virus strain was obtained. High doses of the attenuated African swine fever virus strain were administered intramuscularly (10 doses per pig). 6 HAD 50 The fact that the pigs did not develop the disease indicates that intramuscular injection of this strain could not cause disease and death in pigs; the challenge experiment showed that the attenuated African swine fever virus strain could provide 100% immune protection against challenge with the virulent strain isolated from ASFV CN / GS / 2018. Summary of the Invention
[0009] To address the aforementioned technical problems, this invention provides a strategy for constructing an attenuated African swine fever virus strain. The strategy involves combining the deletion of the following genes from the parental strain: MGF-360-1La, MGF-360-1Lb, MGF-360-2L, KP177R, L83L, L60L, MGF-360-3L, MGF-110-1L, ASFV-G-ACD-00090, MGF-110-2L, MGF-110-3L, ASFV-G-ACD-00120, MGF-110-4L, MGF-110-5L-6L, MGF-110-7L, 285L, and AS... The genes involved are FV-G-ACD-00160, MGF-110-8L, MGF-100-1R, MGF-300-1L, MGF-300-2R, MGF-300-4L, MGF-100-2L, and MGF-100-3L. Since MGF-300-1L, MGF-300-2R, and MGF-300-4L are three adjacent genes, a homologous recombination targeting vector can be used to replace the p72-GFP element in these three genes, thus preventing the normal expression of the proteins encoded by these three genes and resulting in loss of protein function. Similarly, since MGF-100-2L and MGF100-3L are two adjacent genes, a homologous recombination targeting vector can be used to replace the p72-mCherry element in these two genes, also preventing the normal expression of the proteins encoded by these two genes and resulting in loss of protein function.
[0010] Based on common knowledge in the art, in addition to the gene editing methods described above, other gene editing methods can be used to modify the MGF-360-1La, MGF-360-1Lb, MGF-360-2L, KP177R, L83L, L60L, MGF-360-3L, MGF-110-1L, ASFV-G-ACD-00090, MGF-110-2L, MGF-110-3L, ASFV-G-ACD-00120, and MGF-110 genes. The proteins encoded by the MGF-110-5L-6L, MGF-110-7L, 285L, ASFV-G-ACD-00160, MGF-110-8L, MGF-100-1R, MGF-300-1L, MGF-300-2R, MGF-300-4L, MGF-100-2L, and MGF-100-3L genes simultaneously lose their function, and attenuated African swine fever virus strains are constructed through methods such as frameshift mutations, point mutations, deletions, or insertions of nucleotide sequences.
[0011] The specific technical solutions include:
[0012] In a first aspect, the present invention provides an application for preparing an attenuated African swine fever virus strain by combining a deleted gene fragment with the type II African swine fever virus strain ASFV CN / GS2018, wherein the gene fragment includes the complete / partial nucleotide sequence of the MGF-360-1La gene, the complete / partial nucleotide sequence of the MGF-360-1Lb gene, the complete / partial nucleotide sequence of the MGF-360-2L gene, the complete / partial nucleotide sequence of the KP177R gene, the complete / partial nucleotide sequence of the L83L gene, the complete / partial nucleotide sequence of the L60L gene, the complete / partial nucleotide sequence of the MGF-360-3L gene, the complete / partial nucleotide sequence of the MGF-110-1L gene, the complete / partial nucleotide sequence of the ASFV-G-ACD-00090 gene, the complete / partial nucleotide sequence of the MGF-110-2L gene, the complete / partial nucleotide sequence of the MGF-110-3L gene, and the ASFV-G-AC gene. The complete / partial nucleotide sequences of the D-00120 gene, MGF-110-4L gene, MGF-110-5L-6L gene, MGF-110-7L gene, 285L gene, AS FV-G-ACD-00160 gene, MGF-110-8L gene, MGF-100-1R gene, MGF-300-1L gene, MGF-300-2R gene, MGF-300-4L gene, MGF-100-2L gene, and MGF-100-3L gene are described. The type II African swine fever virus strain ASFV CN / GS2018 is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC. NO: V202096.The missing MGF-360-1La, MGF-360-1Lb, MGF-360-2L, KP177R, L83L, L60L, MGF-360-3L, MGF-110-1L, ASFV-G-ACD-00090, MGF-110-2L, MGF-110-3L, ASFV-G-ACD-00120, MGF-110-4L, MGF-110-5L-6L, MGF-1 The loss of function of the encoded proteins can be caused by the deletion of the complete nucleotide sequence of the genes 10-7L, 285L, ASFV-G-ACD-00160, MGF-110-8L, MGF-100-1R, MGF-300-1L, MGF-300-2R, MGF-300-4L, MGF-100-2L, and MGF-100-3L. Alternatively, the loss of function can be achieved by simply deleting the MGF-100-1R, MGF-300-1L, or MGF-300-2L genes. The complete nucleotide sequences of the R, MGF-300-4L, MGF-100-2L, and MGF-100-3L genes enable the production of MGF-360-1La, MGF-360-1Lb, MGF-360-2L, KP177R, L83L, L60L, MGF-360-3L, MGF-110-1L, ASFV-G-ACD-00090, MGF-110-2L, MGF-110-3L, and ASFV-G-A genes. The proteins encoded by the genes CD-00120, MGF-110-4L, MGF-110-5L-6L, MGF-110-7L, 285L, ASFV-G-ACD-00160, MGF-110-8L, MGF-100-1R, MGF-300-1L, MGF-300-2R, MGF-300-4L, MGF-100-2L, and MGF-100-3L cannot be expressed, resulting in the loss of function of the encoded proteins.Based on common knowledge in the art, in addition to the gene editing methods described above, other gene editing methods can also be used to modify MGF-360-1La, MGF-360-1Lb, MGF-360-2L, KP177R, L83L, L60L, MGF-360-3L, MGF-110-1L, ASFV-G-ACD-00090, MGF-110-2L, MGF-110-3L, and ASF. The proteins encoded by the genes VG-ACD-00120, MGF-110-4L, MGF-110-5L-6L, MGF-110-7L, 285L, ASFV-G-ACD-00160, MGF-110-8L, MGF-100-1R, MGF-300-1L, MGF-300-2R, MGF-300-4L, MGF-100-2L, and MGF-100-3L may simultaneously lose their function, for example, through frameshift mutations, point mutations, frameshift deletions, or insertion of nucleotide sequences.
[0013] Preferably, the deleted gene fragment is positions 852-1403, 1613-1933, 2018-3106, 3247-3780, 3917-4162, 4263-4421, 4580-5650, 6096-6686, 6685-6798, 6866-7180, 7277-7651, 7797-7954, and 796 of the full-length sequence of African swine fever virus strain CN / GS2018. Positions 5-8339, 8528-9145, 9352-9765, 10080-10364, 10106-10234, 10493-10876, 11094-11468, 19732-20538, 21365-21847, 21937-22929, 179519-179944, and 180309-180617.
[0014] Secondly, the present invention provides an application for preparing an African swine fever vaccine by combining a deleted gene fragment in the type II African swine fever virus strain ASFV CN / GS2018, wherein the gene fragment includes the complete / partial nucleotide sequence of the MGF-360-1La gene, the complete / partial nucleotide sequence of the MGF-360-1Lb gene, the complete / partial nucleotide sequence of the MGF-360-2L gene, the complete / partial nucleotide sequence of the KP177R gene, the complete / partial nucleotide sequence of the L83L gene, the complete / partial nucleotide sequence of the L60L gene, the complete / partial nucleotide sequence of the MGF-360-3L gene, the complete / partial nucleotide sequence of the MGF-110-1L gene, the complete / partial nucleotide sequence of the ASFV-G-ACD-00090 gene, the complete / partial nucleotide sequence of the MGF-110-2L gene, the complete / partial nucleotide sequence of the MGF-110-3L gene, and the complete / partial nucleotide sequence of the ASFV-G-ACD-00120 gene. The following nucleotide sequences are included: partial nucleotide sequences of the MGF-110-4L gene, complete / partial nucleotide sequences of the MGF-110-5L-6L gene, complete / partial nucleotide sequences of the MGF-110-7L gene, complete / partial nucleotide sequences of the 285L gene, complete / partial nucleotide sequences of the ASFV-G-ACD-00160 gene, complete / partial nucleotide sequences of the MGF-110-8L gene, complete / partial nucleotide sequences of the MGF-100-1R gene, complete / partial nucleotide sequences of the MGF-300-1L gene, complete / partial nucleotide sequences of the MGF-300-2R gene, complete / partial nucleotide sequences of the MGF-300-4L gene, complete / partial nucleotide sequences of the MGF-100-2L gene, and complete / partial nucleotide sequences of the MGF-100-3L gene; the type II African swine fever virus strain ASFV. CN / GS2018 is deposited at the China Center for Type Culture Collection, with accession number CCTCCNO: V202096.The missing MGF-360-1La, MGF-360-1Lb, MGF-360-2L, KP177R, L83L, L60L, MGF-360-3L, MGF-110-1L, ASFV-G-ACD-00090, MGF-110-2L, MGF-110-3L, ASFV-G-ACD-00120, MGF-110-4L, MGF-110-5L-6L, MGF-1 The loss of function of the encoded proteins can be caused by the deletion of the complete nucleotide sequence of the genes 10-7L, 285L, ASFV-G-ACD-00160, MGF-110-8L, MGF-100-1R, MGF-300-1L, MGF-300-2R, MGF-300-4L, MGF-100-2L, and MGF-100-3L. Alternatively, the loss of function can be achieved by simply deleting the MGF-100-1R, MGF-300-1L, or MGF-300-2L genes. The complete nucleotide sequences of the R, MGF-300-4L, MGF-100-2L, and MGF-100-3L genes enable the production of MGF-360-1La, MGF-360-1Lb, MGF-360-2L, KP177R, L83L, L60L, MGF-360-3L, MGF-110-1L, ASFV-G-ACD-00090, MGF-110-2L, MGF-110-3L, and ASFV-G-A genes. The proteins encoded by the genes CD-00120, MGF-110-4L, MGF-110-5L-6L, MGF-110-7L, 285L, ASFV-G-ACD-00160, MGF-110-8L, MGF-100-1R, MGF-300-1L, MGF-300-2R, MGF-300-4L, MGF-100-2L, and MGF-100-3L cannot be expressed, resulting in the loss of function of the encoded proteins.Based on common knowledge in the art, in addition to the gene editing methods described above, other gene editing methods can also be used to modify MGF-360-1La, MGF-360-1Lb, MGF-360-2L, KP177R, L83L, L60L, MGF-360-3L, MGF-110-1L, ASFV-G-ACD-00090, MGF-110-2L, MGF-110-3L, ASFV-G-ACD-00120, and MG. The proteins encoded by the genes F-110-4L, MGF-110-5L-6L, MGF-110-7L, 285L, ASFV-G-ACD-00160, MGF-110-8L, MGF-100-1R, MGF-300-1L, MGF-300-2R, MGF-300-4L, MGF-100-2L, and MGF-100-3L may simultaneously lose their function, for example, through frameshift mutations, point mutations, frameshift deletions, or insertion of nucleotide sequences.
[0015] Preferably, the deleted gene fragment is positions 852-1403, 1613-1933, 2018-3106, 3247-3780, 3917-4162, 4263-4421, 4580-5650, 6096-6686, 6685-6798, 6866-7180, 7277-7651, 7797-7954, and 796 of the full-length sequence of African swine fever virus strain CN / GS2018. Positions 5-8339, 8528-9145, 9352-9765, 10080-10364, 10106-10234, 10493-10876, 11094-11468, 19732-20538, 21365-21847, 21937-22929, 179519-179944, and 180309-180617.
[0016] Thirdly, the present invention provides a gene-deleted attenuated African swine fever virus strain, wherein the gene-deleted attenuated African swine fever virus strain is a type II African swine fever virus strain ASFV CN / GS2018 with a gene fragment deletion; the gene fragment includes all / partial nucleotide sequences of the MGF-360-1La gene, all / partial nucleotide sequences of the MGF-360-1Lb gene, all / partial nucleotide sequences of the MGF-360-2L gene, all / partial nucleotide sequences of the KP177R gene, all / partial nucleotide sequences of the L83L gene, all / partial nucleotide sequences of the L60L gene, all / partial nucleotide sequences of the MGF-360-3L gene, all / partial nucleotide sequences of the MGF-110-1L gene, all / partial nucleotide sequences of the ASFV-G-ACD-00090 gene, all / partial nucleotide sequences of the MGF-110-2L gene, all / partial nucleotide sequences of the MGF-110-3L gene, and all / partial nucleotide sequences of the ASFV-G-ACD-00120 gene, M... The complete / partial nucleotide sequences of the following genes were obtained: GF-110-4L, MGF-110-5L-6L, MGF-110-7L, 285L, ASFV-G-ACD-00160, MGF-110-8L, MGF-100-1R, MGF-300-1L, MGF-300-2R, MGF-300-4L, MGF-100-2L, and MGF-100-3L. The type II African swine fever virus strain ASFV CN / GS2018 is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: V202096.This can be achieved by addressing the absence of MGF-360-1La, MGF-360-1Lb, MGF-360-2L, KP177R, L83L, L60L, MGF-360-3L, MGF-110-1L, and ASFV-G-AC. The loss of function of the encoded proteins can be caused by deleting the complete nucleotide sequences of the genes D-00090, MGF-110-2L, MGF-110-3L, ASFV-G-ACD-00120, MGF-110-4L, MGF-110-5L-6L, MGF-110-7L, 285L, ASFV-G-ACD-00160, MGF-110-8L, MGF-100-1R, MGF-300-1L, MGF-300-2R, MGF-300-4L, MGF-100-2L, and MGF-100-3L. Alternatively, the loss of function can be achieved by simply deleting the complete nucleotide sequences of the genes MGF-100-1R, MGF-300-1L, MGF-300-2R, MGF-300-4L, MGF-100-2L, and MGF-100-3L. MGF-360-1La, MGF-360-1Lb, MGF-360-2L, KP177R, L83L, L60L, MGF-360-3L, MGF-110-1 L. ASFV-G-ACD-00090, MGF-110-2L, MGF-110-3L, ASFV-G-ACD-00120, MGF-110-4L, MGF The proteins encoded by the genes -110-5L-6L, MGF-110-7L, 285L, ASFV-G-ACD-00160, MGF-110-8L, MGF-100-1R, MGF-300-1L, MGF-300-2R, MGF-300-4L, MGF-100-2L, and MGF-100-3L cannot be expressed, resulting in the loss of function of the encoded proteins.Based on common knowledge in the art, in addition to the gene editing methods described above, other gene editing methods can also be used to modify MGF-360-1La, MGF-360-1Lb, MGF-360-2L, KP177R, L83L, L60L, MGF-360-3L, MGF-110-1L, ASFV-G-ACD-00090, MG F-110-2L, MGF-110-3L, ASFV-G-ACD-00120, MGF-110-4L, MGF-110-5L-6L, MGF-110-7L, 285L, and AS. The proteins encoded by the FV-G-ACD-00160, MGF-110-8L, MGF-100-1R, MGF-300-1L, MGF-300-2R, MGF-300-4L, MGF-100-2L, and MGF-100-3L genes simultaneously lose their function, for example, through frameshift mutations, point mutations, frameshift deletions, or insertion of nucleotide sequences.
[0017] Preferably, the deleted gene fragment is positions 852-1403, 1613-1933, 2018-3106, 3247-3780, 3917-4162, 4263-4421, 4580-5650, 6096-6686, 6685-6798, 6866-7180, 7277-7651, 7797-7954, and 796 of the full-length sequence of African swine fever virus strain CN / GS2018. Positions 5-8339, 8528-9145, 9352-9765, 10080-10364, 10106-10234, 10493-10876, 11094-11468, 19732-20538, 21365-21847, 21937-22929, 179519-179944, and 180309-180617.
[0018] Fourthly, the present invention provides an African swine fever vaccine, wherein the African swine fever vaccine comprises the gene-deleted attenuated African swine fever virus strain described in the third aspect above.
[0019] Fifthly, the present invention provides a method for preparing the gene-deleted attenuated African swine fever virus strain described in the third aspect above. The method involves using genetic engineering techniques to extract all / partial nucleotide sequences of the following genes from the original type II African swine fever virus strain ASFV CN / GS2018: MGF-360-1La, MGF-360-1Lb, MGF-360-2L, KP177R, L83L, L60L, MGF-360-3L, MGF-110-1L, ASFV-G-ACD-00090, MGF-110-2L, MGF-110-3L, and ASFV-G-ACD-00120. Sequences of MGF-110-4L, MGF-110-5L-6L, MGF-110-7L, 285L, ASFV-G-ACD-00160, MGF-110-8L, MGF-100-1R, MGF-300-1L, MGF-300-2R, MGF-300-4L, MGF-100-2L, and MGF-100-3L genes.
[0020] Preferably, the method is homologous recombination technology.
[0021] Preferably, the method includes the following steps:
[0022] (1) Design 1.0 kb upstream and downstream sequences of the MGF-100-1R gene as left and right homologous recombination arms. Simultaneously clone the left and right homologous recombination arms and the p72-BFP gene fragment of the BFP gene selection expression cassette into the pUC57 vector to obtain the recombinant plasmid A00-A-BFP; (Check for errors)
[0023] (2) Design 1.0kb each of the upstream sequence of MGF-100-2L gene and the downstream sequence of MGF-100-3L gene as left and right homologous recombination arms. The left and right homologous recombination arm genes and the mCherry gene selection expression cassette gene fragment p72-mCherrry were simultaneously cloned into the pUC57 vector to obtain the recombinant plasmid A00-BC-RFP.
[0024] (3) Design 1.0kb each of the upstream sequence of MGF-300-1L gene and the downstream sequence of MGF-300-4L gene as left and right homologous recombination arms. Simultaneously clone the left and right homologous recombination arm genes and the eGFP gene selection expression cassette gene fragment p72-eGFP into the pUC57 vector to obtain the recombinant plasmid C00-GFP.
[0025] (4) Recombinant plasmids C00-GFP, A00-BC-RFP, and A00-A-BFP were sequentially transfected into BMDM cells infected with the original ASFV strain. After continuous passage, the following genes were constructed: MGF-360-1La, MGF-360-1Lb, MGF-360-2L, KP177R, L83L, L60L, MGF-360-3L, MGF-110-1L, ASFV-G-ACD-00090, MGF-110-2L, and MGF-110-3L. A live attenuated African swine fever virus (ASFV-Δ24) with the following genes jointly deleted: ASFV-G-ACD-00120, MGF-110-4L, MGF-110-5L-6L, MGF-110-7L, 285L, ASFV-G-ACD-00160, MGF-110-8L, MGF-100-1R, MGF-300-1L, MGF-300-2R, MGF-300-4L, MGF-100-2L, and MGF-100-3L.
[0026] The beneficial effects of this invention are: This invention, through the combined loss of the MGF-360-1La gene, MGF-360-1Lb gene, MGF-360-2L gene, KP177R gene, L83L gene, L60L gene, MGF-360-3L gene, MGF-110-1L gene, ASFV-G-ACD-00090 gene, MGF-110-2L gene, MGF-110-3L gene, ASFV-G-ACD-00120 gene, MGF-110-4L gene, MGF-110-5L-6L gene, and MGF... By analyzing the functions of the proteins encoded by the MGF-110-7L, MGF-285L, ASFV-G-ACD-00160, MGF-110-8L, MGF-100-1R, MGF-300-1L, MGF-300-2R, MGF-300-4L, MGF-100-2L, and MGF-100-3L genes, an attenuated African swine fever virus strain was obtained. This attenuated African swine fever virus strain exhibits significantly weakened virulence, and high doses do not induce morbidity or mortality. Immunization with this attenuated African swine fever virus strain provides 100% protection against the parent strain ASFV CN / GS / 2018 isolate, demonstrating good safety profile and suitability as a candidate vaccine strain for the prevention of African swine fever. Attached Figure Description
[0027] Figure 1 Schematic diagram of the MGF-100-1R gene deletion strategy;
[0028] Figure 2 Schematic diagram of MGF-100-2L and MGF100-3L gene deletion strategies;
[0029] Figure 3 Schematic diagram of MGF-300-1L, MGF-300-2R and MGF-300-4L gene deletion strategies;
[0030] Figure 4 Image showing the purity test results of attenuated African swine fever virus strain Δ24;
[0031] Figure 5 A graph showing the change in body temperature of animals after immunization with attenuated African swine fever virus strain Δ24. Each curve represents an animal, with the horizontal axis representing the number of days after immunization and the vertical axis representing body temperature.
[0032] Figure 6 Survival rate of experimental pigs after immunization with attenuated African swine fever virus strain Δ24, where each curve represents one animal, the horizontal axis is the number of days after immunization, and the vertical axis is the survival rate;
[0033] Figure 7The graph shows the changes in p30 specific antibody levels in experimental pigs after immunization with attenuated African swine fever virus strain Δ24. Each curve represents one animal, the horizontal axis is the number of days after immunization, and the vertical axis is the p30 specific antibody blocking rate.
[0034] Figure 8 The graph shows the results of blood virus carriage in animals immunized with attenuated African swine fever virus strain Δ24. Each curve represents one animal, the horizontal axis represents the number of days after immunization, and the vertical axis represents the number of virus copies.
[0035] Figure 9 A graph showing the change in body temperature of animals after immunization with attenuated African swine fever virus strain Δ24. Each curve represents an animal, with the horizontal axis representing the number of days after challenge and the vertical axis representing body temperature.
[0036] Figure 10 Survival rate of experimental pigs after immunization with attenuated African swine fever virus strain Δ24. Each curve represents one animal, with the horizontal axis representing the number of days after challenge and the vertical axis representing the survival rate.
[0037] Figure 11 The graph shows the changes in p30 specific antibody levels in experimental pigs after immunization with attenuated African swine fever virus strain Δ24. Each curve represents one animal, the horizontal axis is the number of days after challenge, and the vertical axis is the p30 specific antibody blocking rate.
[0038] Figure 12 The graph shows the results of virus content detection in the blood of animals after immunization with attenuated African swine fever virus strain Δ24. Each curve represents an animal, the horizontal axis is the number of days after challenge, and the vertical axis is the number of virus copies. Detailed Implementation
[0039] To make the technical means, creative features, objectives, and effects of this invention easier to understand, the invention is further described below in conjunction with specific embodiments. However, the scope of protection of this invention is not limited to the embodiments described below.
[0040] The experiments described in the following examples obtained biosafety clearance and African swine fever laboratory activity clearance:
[0041] Based on the requirements for a Biosafety Level 3 (BSL-3) laboratory and related biosafety for African swine fever, the Lanzhou Veterinary Research Institute of the Chinese Academy of Agricultural Sciences, through a hierarchical reporting process involving the Institute's Biosafety Committee, Laboratory Animal Ethics Committee, the Chinese Academy of Agricultural Sciences' Biosafety Committee, the Lanzhou Veterinary Research Institute's Laboratory Animal Ethics Committee, and the Lanzhou Veterinary Research Institute's Biosafety Committee, has obtained permission to conduct research on highly pathogenic ASFV pathogens and related animals. This permission has been registered with the Ministry of Agriculture and Rural Affairs and meets the national biosafety level requirements.
[0042] The experimental cells, viruses, and plasmids described in the following examples were obtained from: Primary bone marrow macrophages (BMDM) were obtained from healthy pigs aged 2-4 months. After aseptic collection, red blood cells were removed using erythrocyte lysis buffer (purchased from Biosharp). After low-speed centrifugation, the supernatant was discarded, and the cell pellet was resuspended in RPMI 1640 complete medium (purchased from Gibco) containing 10% FBS (purchased from Gibco) and cultured in a 37°C, 5% CO2 incubator. For BMDM cell culture, an additional 10 ng / mL final concentration of recombinant porcine GM-CSF (purchased from R&D Systems) was added to the RPMI 1640 complete medium. The cells were induced in a 37°C, 5% CO2 incubator, and washed every 2-3 days. Non-adherent cells were centrifuged and re-added to new cell culture dishes, the medium was changed, and induction continued. After 3-7 days, the cells were frozen or used. ASFV was amplified using BMDM cells, and the viral load was titrated. BMDM cells were used for plasmid transfection and viral recombination experiments.
[0043] The African swine fever virus strain CN / GS2018, type II, originated from the National African Swine Fever Regional Laboratory (Lanzhou). It belongs to genotype II and has a viral titer of 1×10⁻⁶. 5 HAD 50 / mL, which is the fourth generation seed virus after PAM cell propagation, was deposited at the China Center for Type Culture Collection on December 21, 2020, with accession number CCTCC NO: V202096; deposit address: Wuhan University, Wuhan, China.
[0044] The plasmids were synthesized by Genscript Biotech Inc.; the endotoxin-free plasmid extraction kit was purchased from MN (Macherey-Nagel).
[0045] Unless otherwise specified, all procedures performed in the experiment are known in the field.
[0046] definition
[0047] The term "loss of protein function" refers to the loss of function of a protein encoded by knocking out, mutating, or inserting a portion of the gene into a protein-encoding gene segment, resulting in a frameshift mutation.
[0048] The term "gene deletion" refers to the loss of a segment of a chromosome along with its associated gene, resulting in a mutation.
[0049] The term "gene mutation" refers to a change in the composition or sequence of base pairs in the structure of a gene. In other words, a new gene suddenly appears at a certain site, replacing the original gene. This gene is called a mutated gene. Gene mutations lead to the sudden appearance of new traits in offspring that have never been seen before.
[0050] Gene deletion methods generally refer to gene knockout, which is a foreign DNA introduction technology that involves homologous recombination between a DNA fragment containing a known sequence and a gene with the same or similar sequence in the recipient cell's genome. This allows the DNA to integrate into the recipient cell's genome and be expressed. Gene knockout methods generally include: homologous recombination, random insertion mutation, and RNA interference. Homologous recombination, also known as gene targeting, refers to the recombination between foreign DNA and homologous sequences on the recipient cell's chromosomal DNA, integrating into a predetermined location to alter certain genetic characteristics. The purpose of recombination is to knock out a specific gene. Random insertion mutation involves using viruses, bacteria, or other gene vectors capable of randomly inserting gene sequences to create a cell library of randomly inserted mutations in the target cell's genome. These cells are then screened using appropriate markers to obtain gene knockout cells.
[0051] The purpose of this invention is to investigate the MGF-360-1La, MGF-360-1Lb, MGF-360-2L, KP177R, L83L, L60L, MGF-360-3L, MGF-110-1L, ASFV-G-ACD-00090, MGF-110-2L, MGF-110-3L, ASFV-G-ACD-00120, MGF-110-4L, MGF-110-5L-6L, MGF-110-7L, 285L, ASFV-G-ACD-00160, MGF-110-8L, and MGF-100-1R genes in African swine fever virus. Knockout of some or all nucleotide sequences of the MGF-300-1L, MGF-300-2R, MGF-300-4L, MGF-100-2L, and MGF-100-3L genes, resulting in the knockout of the MGF-360-1La, MGF-360-1Lb, MGF-360-2L, KP177R, L83L, L60L, MGF-360-3L, MGF-110-1L, ASFV-G-ACD-00090, MGF-110-2L, MGF-110-3L, ASFV-G-ACD-00120, MGF-110-4L, MGF-110-5L-6L, and MG genes. The proteins encoded by the F-110-7L, 285L, ASFV-G-ACD-00160, MGF-110-8L, MGF-100-1R, MGF-300-1L, MGF-300-2R, MGF-300-4L, MGF-100-2L, and MGF-100-3L genes have lost their function.Furthermore, the following genes were constructed: MGF-360-1La, MGF-360-1Lb, MGF-360-2L, KP177R, L83L, L60L, MGF-360-3L, MGF-110-1L, ASFV-G-ACD-00090, MGF-110-2L, MGF-110-3L, ASFV-G-ACD-00120, MGF-110-4L, and MG. The F-110-5L-6L, MGF-110-7L, 285L, ASFV-G-ACD-00160, MGF-110-8L, MGF-100-1R, MGF-300-1L, MGF-300-2R, MGF-300-4L, MGF-100-2L, and MGF-100-3L genes encode attenuated African swine fever virus with loss of protein function, which are used in the production of African swine fever vaccines.
[0052] Since MGF-300-1L, MGF-300-2R, and MGF-300-4L are three adjacent genes, a homologous recombination targeting vector can be used to replace the p72-GFP element in these three genes, thereby preventing the normal expression of the proteins encoded by these three genes and resulting in loss of protein function. Furthermore, since MGF-100-2L and MGF100-3L are two adjacent genes, a homologous recombination targeting vector can be used to replace the p72-mCherry element in these two genes, thereby preventing the normal expression of the proteins encoded by these two genes and resulting in loss of protein function.
[0053] Based on common knowledge in the art, in addition to the aforementioned homologous recombination gene editing techniques, other gene editing methods can also be used, such as gene deletion, gene mutation, missing gene insertion, and RNA interference.
[0054] The MGF-360-1La gene described in this invention is located at positions 852-1403 of the complete genome sequence of the ASFV CN / GS / 2018 isolate (as shown in SEQ ID NO.1); the MGF-360-1Lb gene is located at positions 1613-1933 of the complete genome sequence of the ASFV CN / GS / 2018 isolate (as shown in SEQ ID NO.2); the MGF-360-2L gene is located at positions 2018-3106 of the complete genome sequence of the ASFV CN / GS / 2018 isolate (as shown in SEQ ID NO.3); the KP177R gene is located at positions 3247-3780 of the complete genome sequence of the ASFVCN / GS / 2018 isolate (as shown in SEQ ID NO.4); and the L83L gene is located at positions 3917-4162 of the complete genome sequence of the ASFV CN / GS / 2018 isolate (as shown in SEQ ID NO.1). As shown in NO.5, the L60L gene is located at positions 4263-4421 of the complete genome sequence of the ASFV CN / GS / 2018 isolate (as shown in SEQ ID NO.6), the MGF-360-3L gene is located at positions 4580-5650 of the complete genome sequence of the ASFV CN / GS / 2018 isolate (as shown in SEQ ID NO.7), the MGF-110-1L gene is located at positions 6096-6686 of the complete genome sequence of the ASFV CN / GS / 2018 isolate (as shown in SEQ ID NO.8), the ASFV-G-ACD-00090 gene is located at positions 6685-6798 of the complete genome sequence of the ASFV CN / GS / 2018 isolate (as shown in SEQ ID NO.9), and the MGF-110-2L gene is located at positions 6866-7180 of the complete genome sequence of the ASFV CN / GS / 2018 isolate (as shown in SEQ ID NO.6). As shown in NO. 10, the MGF-110-3L gene is located at positions 7277-7651 of the complete genome sequence of the ASFV CN / GS / 2018 isolate (as shown in SEQ ID NO. 11), the ASFV-G-ACD-00120 gene is located at positions 7797-7954 of the complete genome sequence of the ASFV CN / GS / 2018 isolate (as shown in SEQ ID NO. 12), the MGF-110-4L gene is located at positions 7965-8339 of the complete genome sequence of the ASFV CN / GS / 2018 isolate (as shown in SEQ ID NO. 13), and the MGF-110-5L-6L gene is located at positions 8528-9145 of the complete genome sequence of the ASFV CN / GS / 2018 isolate (as shown in SEQ ID NO. 10).As shown in SEQ ID NO. 14), the MGF-110-7L gene is located at positions 9352-9765 of the complete genome sequence of the ASFV CN / GS / 2018 isolate (as shown in SEQ ID NO. 15), the 285L gene is located at positions 10080-10364 of the complete genome sequence of the ASFV CN / GS / 2018 isolate (as shown in SEQ ID NO. 16), the ASFV-G-ACD-00160 gene is located at positions 10106-10234 of the complete genome sequence of the ASFV CN / GS / 2018 isolate (as shown in SEQ ID NO. 17), the MGF-110-8L gene is located at positions 10493-10876 of the complete genome sequence of the ASFV CN / GS / 2018 isolate (as shown in SEQ ID NO. 18), and the MGF-100-1R gene is located at positions 9352-9765 of the complete genome sequence of the ASFV CN / GS / 2018 isolate (as shown in SEQ ID NO. 18). The MGF-300-1L gene is located at positions 11094-11468 of the complete genome sequence of the CN / GS / 2018 isolate (as shown in SEQ ID NO. 19); the MGF-300-2R gene is located at positions 21365-21847 of the complete genome sequence of the ASFV CN / GS / 2018 isolate (as shown in SEQ ID NO. 21); the MGF-300-4L gene is located at positions 21937-22929 of the complete genome sequence of the ASFV CN / GS / 2018 isolate (as shown in SEQ ID NO. 22); and the MGF-100-2L gene is located at positions 179519-179944 of the complete genome sequence of the ASFV CN / GS / 2018 isolate (as shown in SEQ ID NO. 19). As shown in SEQ ID NO. 23, the MG F-100-3L gene is located at positions 180309-180617 of the full genome sequence of the ASFV CN / GS / 2018 isolate (as shown in SEQ ID NO. 24).
[0055] The MGF-360-1La gene, MGF-360-1Lb gene, MGF-360-2L gene, KP177R gene, L83L gene, L60L gene, MGF-360-3L gene, MGF-110-1L gene, ASFV-G-ACD-00090 gene, MGF-110-2L gene, MGF-110-3L gene, ASFV-G-ACD-00120 gene, MGF-110-4L gene, and MGF-110-5L-6L gene are mentioned. The genes MGF-110-7L, 285L, ASFV-G-ACD-00160, MGF-110-8L, and MGF-100-1R are adjacent genes; the genes MGF-300-1L, MGF-300-2R, and MGF-300-4L are adjacent genes; and the genes MGF-100-2L and MGF-100-3L are adjacent genes, with spacer sequences between them. To simplify the knockout process, this invention uses homologous recombination technology in ASFV... The CN / GS / 2018 isolate simultaneously knocked out the following genes: MGF-360-1La, MGF-360-1Lb, MGF-360-2L, KP177R, L83L, L60L, MGF-360-3L, MGF-110-1L, ASFV-G-ACD-00090, MGF-110-2L, MGF-110-3L, and ASFV-G-ACD-001. 20 gene, MGF-110-4L gene, MGF-110-5L-6L gene, MGF-110-7L gene, 285L gene, ASFV-G-ACD-00160 gene, MGF-110-8L gene, MGF-100-1R gene, MGF-300-1L gene, MGF-300-2R gene, MGF-300-4L gene, MGF-100-2L gene and MGF-100-3L gene (located at positions 852-11468, 19732-22929 and 179519-179944 of the whole genome sequence of the ASFV CN / GS / 2018 isolate, including some spacer sequences);This involves the following genes: MGF-360-1La, MGF-360-1Lb, MGF-360-2L, KP177R, L83L, L60L, MGF-360-3L, MGF-110-1L, ASFV-G-ACD-00090, MGF-110-2L, MGF-110-3L, ASFV-G-ACD-00120, MGF-110-4L, MGF-110-5L-6L, MGF-110-7L, 285L, ASFV-G-ACD-00160, MGF-110-8L, and MGF-100-1R. Because the proteins encoded by the MGF-300-1L, MGF-300-2R, MGF-300-4L, MGF-100-2L, and MGF-100-3L genes cannot be expressed normally, and the MGF-360-1La, MGF-360-1Lb, MGF-360-2L, KP177R, L83L, L60L, MGF-360-3L, MGF-110-1L, ASFV-G-ACD-00090, MGF-110-2L, MGF-110-3L, ASFV-G-ACD-00120, and MGF-110-4L genes are collectively lost... The functions of the proteins encoded by the genes MGF-110-5L-6L, MGF-110-7L, 285L, ASFV-G-ACD-00160, MGF-110-8L, MGF-100-1R, MGF-300-1L, MGF-300-2R, MGF-300-4L, MGF-100-2L, and MGF-100-3L were successfully constructed. The functions of the proteins encoded by the genes MGF-360-1La, MGF-360-1Lb, MGF-360-2L, KP177R, L83L, L60L, MGF-360-3L, and MGF-110-1 were also successfully constructed. Attenuated African swine fever virus strains lacking the L gene, ASFV-G-ACD-00090 gene, MGF-110-2L gene, MGF-110-3L gene, ASFV-G-ACD-00120 gene, MGF-110-4L gene, MGF-110-5L-6L gene, MGF-110-7L gene, 285L gene, ASFV-G-ACD-00160 gene, MGF-110-8L gene, MGF-100-1R gene, MGF-300-1L gene, MGF-300-2R gene, MGF-300-4L gene, MGF-100-2L gene, and MGF-100-3L gene were selected as vaccine candidate strains.
[0056] The term "vaccine" refers to a biological agent that provides a protective response in animals, wherein the vaccine has been delivered and does not cause serious disease.
[0057] The African swine fever vaccine of the present invention optionally further comprises one or more adjuvants, excipients, carriers, and diluents. The adjuvant can be any suitable adjuvant, including chemical adjuvants such as aluminum hydroxide, Freund's adjuvant, mineral oil, Span, etc.; microbial adjuvants such as mycobacteria, lipopolysaccharides, muramyl dipeptides, cytokines, lipid-soluble wax D, and short rod-shaped bacteria; and plant-based adjuvants, mostly polysaccharides extracted from plants or macrofungi, such as Poria cocos polysaccharides, safflower polysaccharides, and traditional Chinese medicines. Biochemical adjuvants include thymosin, transfer factor, and interleukins. Preferred adjuvants may be nano-adjuvants, biological adjuvants, interleukins, etc.
[0058] The African swine fever vaccine disclosed in this invention can also be used to prepare combination vaccines, such as those for pigs, but the focus is on live attenuated vaccines, especially the integration of viral genes, such as bivalent and trivalent vaccines. Combination vaccines can contain multiple attenuated African swine fever viruses of different genotypes, and can induce cross-protective immune responses against multiple African swine fever virus genotypes.
[0059] The African swine fever vaccine of the present invention can be administered via convenient routes, such as intramuscular injection, intranasal administration, oral administration, subcutaneous administration, transdermal administration, and vaginal administration. The attenuated vaccine of the present invention is preferably administered via intramuscular injection. The vaccine can be administered after a primary-boost regimen. For example, after the first vaccination, the subject can receive a second booster dose after a period of time (e.g., approximately 7, 14, 21, or 28 days). Typically, the booster dose is the same as or lower than the primary dose. Furthermore, a third booster immunization can be performed, for example, 2-3 months, 6 months, or one year after immunization. Example 1: Construction, purification, and identification of attenuated African swine fever virus strains.
[0060] 1. Construction of homologous recombination transfer vectors
[0061] Construction of the Enhanced Blue Fluorescent Protein (eGFP) gene selection expression cassette: The pUC57 vector, containing approximately 1.0 kb upstream of the MGF-100-1R gene, the p72 promoter, the BFP gene, and approximately 1.0 kb downstream of the MGF100-1R gene, was synthesized using GeneScript, forming the recombinant plasmid A00-A-BFP. DNA was extracted using an endotoxin-free plasmid extraction kit, and the concentration was determined. The DNA was stored at -20°C for later use. For detailed construction strategies, see [link to specific details]. Figure 1 .
[0062] Construction of the mCherry selection expression cassette for the red fluorescent protein gene: The pUC57 vector was synthesized using GeneScript and contained approximately 1.0 kb of sequence upstream of the MGF-100-2L gene, the p72 promoter, the mCherry gene, and approximately 1.0 kb of sequence downstream of the MGF100-3L gene, forming the recombinant plasmid A00-BC-RFP. DNA was extracted using an endotoxin-free plasmid extraction kit, and the concentration was determined. The DNA was stored at -20°C for later use. For detailed construction strategies, please refer to [link to specific details]. Figure 2 .
[0063] Construction of the Enhanced Green Fluorescent Protein (eGFP) gene selection expression cassette: The pUC57 vector was synthesized using GeneScript and contained approximately 1.0 kb of sequence upstream of the MGF-300-1L gene, the p72 promoter, the eGFP gene, and approximately 1.0 kb of sequence downstream of the MGF-300-4L gene, forming the recombinant plasmid C00-GFP. DNA was extracted using an endotoxin-free plasmid extraction kit, and the concentration was determined. The DNA was stored at -20°C for later use. For detailed construction strategies, see [link to specific details]. Figure 3 .
[0064] 2. Cell transfection and recombinant virus screening
[0065] Homologous recombination transfer vector C00-GFP and Polyplus After thoroughly mixing the -jetPRIME transfection reagent, co-transfect the cells into healthy bone marrow macrophage (BMDM) cells obtained from 2-4 month old healthy SPF pigs in good condition. Six hours later, the cells were directly infected with a 1 MOI ASFV CN / GS / 2018 purified virus strain to obtain ASFV recombinant virus Δ300 with deletions of the MGF-300-1L, MGF-300-2R, and MGF-300-4L genes. Subsequently, using the ASFV recombinant virus Δ300 as the parent strain, A00-BC-RFP was transfected into BMDM cells. Six hours later, the cells were infected with the ASFV recombinant virus Δ300, and the virus strain was purified to obtain the MGF-100-2L and MGF-100-4L genes. An attenuated African swine fever virus strain Δ100-BC / 300, lacking the 0-3L, MGF-300-1L, MGF-300-2R, and MGF-300-4L genes, was obtained. Finally, using the ASFV recombinant virus Δ100-BC / 300 as the parent strain, A00-A-BFP was transfected into BMDM cells. Six hours later, the cells were infected with the ASFV recombinant virus Δ100-BC / 300, and the virus strain was purified. MGF-300-4L genes were obtained through continuous passage. 360-1La gene, MGF-360-1Lb gene, MGF-360-2L gene, KP177R gene, L83L gene, L60L gene, MGF-360-3L gene, MGF-110-1L gene, ASFV-G-ACD-00090 gene, MGF-110-2L gene, MGF-110-3L gene, ASFV-G-ACD-00120 gene, MGF-110-4L gene Attenuated African swine fever virus strain Δ24 with deletions of the following genes: MGF-110-5L-6L, MGF-110-7L, 285L, ASFV-G-ACD-00160, MGF-110-8L, MGF-100-1R, MGF-300-1L, MGF-300-2R, MGF-300-4L, MGF-100-2L, and MGF-100-3L.Furthermore, during continuous passaging, the following genes were observed: MGF-360-1La, MGF-360-1Lb, MGF-360-2L, KP177R, L83L, L60L, MGF-360-3L, MGF-110-1L, ASFV-G-ACD-00090, MGF-110-2L, MGF-110-3L, ASFV-G-ACD-00120, and MG. No replacement was observed in the F-110-4L, MGF-110-5L-6L, MGF-110-7L, 285L, ASFV-G-ACD-00160, MGF-110-8L, MGF-100-1R, MGF-300-1L, MGF-300-2R, MGF-300-4L, MGF-100-2L, and MGF-100-3L genes.
[0066] Purity testing: The following primer pairs were selected to test the purity of each gene:
[0067] MGF-360-1La-F: GGCTCGCTATTTCCATGCTC, MGF-360-1La-R: GGGCTGACATTAATCGGGCA;
[0068] MGF-360-1Lb-F: GTCTGCACCCCATTCGGTAA, MGF-360-1Lb-R: GAGCGTTGTGGTTTGTGGTG;
[0069] MGF-360-2L-F: ATTTCTGCCGGGAGTTAGGC, MGF-360-2L-R: CGAGGTAACCATTGCCCGAT;
[0070] KP177R-F: GGAGAGCATTGTGTTCGTGG, KP177R-R: TTTCACACACCTCTTGGGGG;
[0071] L83L-F: TTTATGGCAACAATCTACCATTGAA, L83L-R: GCTGAGCTGATAAAACAAACGA;
[0072] L60L-F: ACTCTTCCTAAACAGATGACTCCA, L60L-R: TATTGTTGCAATGAGCCTGC;
[0073] MGF-360-3L-F: ATTATCGCGCATACAGGCCA, MGF-360-3L-R: GGCCACGCAACACGTATCTA;
[0074] MGF-110-1L-F:CAAGCTCTCTTTCGGGAGGA,MGF-110-1L-R:ATGGCACGAGGCTGTCATAC;
[0075] ASFV-G-ACD-00090-F:AGTGGCTGCTCGTCAACAAA,ASFV-G-ACD-00090-R:GCTTACCCACA AGCAGCATT;
[0076] MGF-110-2L-F: ATCTGCATTCTGCCTGGAA, MGF-110-2L-R: TTTCGACCGACAATCCCCTG;
[0077] MGF-110-3L-F:GCGGTTGTGAGGTACTGGAT,MGF-110-3L-R:CAGGAGGGCATCTTCGTTCA;
[0078] ASFV-G-ACD-00120-F:GAATGTACATGGTTCCGCACA,ASFV-G-ACD-00120-R:ACCTGGCTTTGT TGCTAGTTGA;
[0079] MGF-110-4L-F:GCGGTTGTGAGGTACTGGAT,MGF-110-4L-R:CAGGAGGGCATCTTCGTTCA;
[0080] MGF-110-5L-6L-F: TGCCAAGACGGCACTTGTAT, MGF-110-5L-6L-R: GGCTTTGGTTCAGAACA GGC;
[0081] MGF-110-7L-F: CCAGGGCTTTGGGTCAGAAC, MGF-110-7L-R: GGGATTTGTACCAGCAGGGT;
[0082] 285L-F:TGCTTCTTGAGGAGGTGATTTTG,285L-R:GGATGGTCATACTCACATCTATG;
[0083] ASFV-G-ACD-00160-F: GGCAGGTTTGATGTGGAGAA, ASFV-G-ACD-00160-R: ACCATCCCCGGT TTGAGAGA;
[0084] MGF-110-8L-F:AGATACCGTGGACGCATTCC,MGF-110-8L-R:TACTGGGGGTGGTTGTCCTT;
[0085] MGF-100-1R-F:ACCACCCTCCAGAAGATTGTTG,MGF-100-1R-R:CCACCGAATCCTTTACGACC;
[0086] MGF-100-2L-F: AGATCCTCCTGGAGCCATTTG, MGF-100-2L-R: ACTGGAGATGTGCTCGGAAG;
[0087] MGF-100-3L-F:TCGTCCGTAAGCAGAAAGGT,MGF-100-3L-R:GGGAACCGCCTTAACGGAAG;
[0088] MGF-100-2L / 3L-F: AGATCCTCCTGGAGCCATTTG, MGF-100-2L / 3L-R: GGGAACCGCCTTAACGG AAG;
[0089] MGF-300-1L-F:CAACGTCCTTGCTACGGCTA,MGF-300-1L-R:GTACTCAATGCAACGGCGTC;
[0090] MGF-300-2R-F:TAAAACACCCCGATAGCCGT,MGF-300-2R-R:ACACAGTCGCATCCCTTGTT;
[0091] MGF-300-4L-F:CAAAGATGCCGTACCTCCGA,MGF-300-4L-R:GCTACGGAATGGAATGGGCT;
[0092] MGF-300-F:CAACGTCCTTGCTACGGCTA,MGF-300-R:GCTACGGAATGGAATGGGCT;
[0093] Meanwhile, p72 in the viral genome was selected as an internal reference gene to ensure the quality of the detected viral genome. The primers for detecting p72 were p72-F: CTTCGGCGAGCGCTTTATCAC and p72-R: GGAAATTCATTCACCAAATCCTT.
[0094] The results are as follows Figure 4 As shown, WT represents the ASFV CN / GS2018 isolate, and NC is the negative control using water as a template. The results indicate that the MGF-360-1La, MGF-360-1Lb, MGF-360-2L, KP177R, L83L, L60L, MGF-360-3L, MGF-110-1L, ASFV-G-ACD-00090, MGF-110-2L, MGF-110-3L, ASFV-G-ACD-00120, MGF-110-4L, and MG genes were all undetectable in the genome of the gene-deleted attenuated African swine fever virus. The F-110-5L-6L gene, MGF-110-7L gene, 285L gene, ASFV-G-ACD-00160 gene, MGF-110-8L gene, MGF-100-1R gene, MGF-300-1L gene, MGF-300-2R gene, MGF-300-4L gene, MGF-100-2L gene, and MGF-100-3L gene combination fragments indicate the MGF-360-1La gene, MGF-360-1Lb gene, MGF-360-2L gene, KP177R gene, L83L gene, L60L gene, MGF-360-3L gene, MGF-110-1L gene, and ASFV-G-ACD-00160 gene. The following genes were successfully knocked out: 0090, MGF-110-2L, MGF-110-3L, ASFV-G-ACD-00120, MGF-110-4L, MGF-110-5L-6L, MGF-110-7L, 285L, ASFV-G-ACD-00160, MGF-110-8L, MGF-100-1R, MGF-300-1L, MGF-300-2R, MGF-300-4L, MGF-100-2L, and MGF-100-3L. These results indicate that the gene-deleted attenuated African swine fever virus strain has been successfully constructed and purified, and named Δ24.
[0095] Example 2: Determination of Viral Titer
[0096] African swine fever virus titers are determined using the half-maximal hemolymph adsorption (HAD) method.50 ) indicates that HAD 50 For detailed experimental procedures, please refer to the literature (Borca MV. Development of a highly effective Africanswine fever virus vaccine by deletion of the I177L gene results in sterileimmunity against the current epidemic Eurasia strain. JVirol. 2020.pii:JVI.02017-19), and make appropriate adjustments accordingly: in a 96-well plate, use approximately 1×10 5 Primary PAM cells were seeded into each well of a 96-well plate. The recombinant viral virus to be tested was serially diluted 10-fold (7 dilutions total), with 8 wells per dilution. 100 μL of the diluted virus was added to each well of the PAM plate, followed by the addition of erythrocytes. This process was repeated three times. Viral infection was determined by the rosette-like pattern of erythrocytes around infected cells. Observations were performed for 6 days, and the number of positive wells was counted. The half-maximal hemocytopenic purpura (HAD) was calculated. 50 If the titer test is qualified, pathogenicity evaluation will be conducted.
[0097] Example 3: Virulence evaluation of gene-deleted attenuated African swine fever virus strain
[0098] To test the virulence of the gene-deleted attenuated African swine fever virus strain, this experiment used 10 6 HAD 50 The toxicity of the drug was evaluated by intramuscular injection into piglets.
[0099] This experiment used seven healthy Landrace piglets that were negative for African swine fever antigen and antibodies. Seven of these piglets were immunized with the gene-deleted attenuated African swine fever virus strain Δ24 (ASFVΔ24). Body temperature changes were measured daily after immunization. Peripheral blood and oral, nasal, and anal swabs were collected. Following the literature (King DP. Development of a TaqMan PCR assay with internal amplification control for the detection of African swine fever virus. J VirolMethods 107:53-61), the ASFV virus content in the blood was determined using quantitative real-time PCR. The assay continued for 22 days. Body temperature changes and mortality rates were statistically analyzed in the immunized animals. The body temperature change results are shown below. Figure 5 As shown, the mortality rate results are as follows: Figure 6As shown, the results indicated that after intramuscular injection, the gene-deleted attenuated African swine fever virus strain Δ24 maintained normal body temperature, without persistent high fever, and no deaths occurred, resulting in a 100% survival rate. Peripheral blood samples were analyzed using a p30 blocking ELISA; antibody levels began to rise on day 6 and remained at a high level from day 12 onwards, as shown in the results. Figure 7 As shown. Furthermore, the viral copy number in peripheral blood began to rise on day 4 and began to decline on day 8, eventually remaining at a low level, as... Figure 8 As shown.
[0100] The above experimental results indicate that the following genes were involved in the parental ASFV CN / GS2018 isolate: MGF-360-1La, MGF-360-1Lb, MGF-360-2L, KP177R, L83L, L60L, MGF-360-3L, MGF-110-1L, ASFV-G-ACD-00090, MGF-110-2L, MGF-110-3L, ASFV-G-ACD-00120, MGF-110-4L, and MGF-110-5L-6. After the L gene, MGF-110-7L gene, 285L gene, ASFV-G-ACD-00160 gene, MGF-110-8L gene, MGF-100-1R gene, MGF-300-1L gene, MGF-300-2R gene, MGF-300-4L gene, MGF-100-2L gene, and MGF-100-3L gene encode proteins, the resulting gene-deleted attenuated African swine fever virus strains exhibit completely attenuated virulence and can generate high levels of protective antibodies within a short period of time, demonstrating good safety.
[0101] Example 4: Evaluation of the immunoprotective effect of gene-deleted attenuated African swine fever virus strain
[0102] To test the immunoprotective effect of gene-deleted attenuated African swine fever virus strains, this experiment used 10 2 HAD 50 A challenge experiment was conducted on 7 pigs in the Δ24 immunized group and 5 pigs in the non-immunized control group using a dose of parental ASFV CN / GS2018 isolate.
[0103] Following viral challenge, body temperature changes were measured daily, and peripheral blood, oral, nasal, and anal swabs were collected for observation until 18 days. The results of body temperature changes are as follows: Figure 9 As shown, the survival rate results after virus challenge are as follows: Figure 10As shown: immunized pigs (ASFVΔ24 immunized) after being challenged with the parental ASFV CN / GS2018 isolate did not exhibit typical symptoms of fever and had a survival rate of 100%; while unimmunized control pigs (not immunized) experienced a sharp rise in body temperature after being challenged with the parental ASFV CN / GS2018 isolate and died on day 7 post-challenge, with all dying by day 9, resulting in a survival rate of 0%.
[0104] After challenge, the p30-specific antibody levels in the experimental animals remained consistently high (no less than 90% blockade rate), such as Figure 11 As shown; while the antibody levels of the unimmunized control group pigs increased after challenge with the parental ASFV CN / GS2018 isolate, but never exceeded 40%, and all of them died in the later stages.
[0105] The status of viral load in the blood of experimental animals after challenge is as follows: Figure 12 As shown, the immunized pigs (ASFVΔ24 immunized) after being challenged with the parental ASFV CN / GS2018 isolate showed high viral loads, but recovered completely in the later stages; while the unimmunized control pigs (unimmunized) showed a continuous increase in viral load after being challenged with the parental ASFV CN / GS2018 isolate, and all of them died in the later stages.
[0106] The above results indicate that after challenge with the parental ASFV CN / GS2018 isolate, the pigs immunized with the gene-deleted attenuated African swine fever virus strain Δ24 had normal body temperature and a survival rate of 100%. That is, the gene-deleted attenuated African swine fever virus strain Δ24 has a complete immune protective effect against the parental ASFV CN / GS2018 isolate.
Claims
1. The application of preparing an attenuated African swine fever virus strain by combining a deleted gene fragment with the type II African swine fever virus strain ASFV CN / GS 2018, characterized in that, The gene fragment in question is from the full-length sequence of African swine fever virus strain ASFV CN / GS 2018, specifically positions 852-1403, 1613-1933, 2018-3106, 3247-3780, 3917-4162, 4263-4421, 4580-5650, 6096-6686, 6685-6798, 6866-7180, 7277-7651, 7797-7954, 7965-8339, and 85... Positions 28-9145, 9352-9765, 10080-10364, 10106-10234, 10493-10876, 11094-11468, 19732-20538, 21365-21847, 21937-22929, 179519-179944, and 180309-180617; the type II African swine fever virus strain ASFV CN / GS 2018 is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: V202096.
2. The application of an African swine fever vaccine prepared by combining a deleted gene fragment with the type II African swine fever virus strain ASFV CN / GS 2018, characterized in that, The missing gene segments are positions 852-1403, 1613-1933, 2018-3106, 3247-3780, 3917-4162, 4263-4421, 4580-5650, 6096-6686, 6685-6798, 6866-7180, 7277-7651, 7797-7954, 7965-8339, and 85... of the full-length sequence of African swine fever virus strain ASFV CN / GS 2018. Positions 28-9145, 9352-9765, 10080-10364, 10106-10234, 10493-10876, 11094-11468, 19732-20538, 21365-21847, 21937-22929, 179519-179944, and 180309-180617; the type II African swine fever virus strain ASFV CN / GS 2018 is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: V202096.
3. A gene-deleted attenuated African swine fever virus strain, characterized in that, The gene-deleted attenuated African swine fever virus strain is the type II African swine fever virus strain ASFV CN / GS 2018 with a gene segment deletion; the gene segment is positions 852-1403, 1613-1933, 2018-3106, 3247-3780, 3917-4162, 4263-4421, 4580-5650, 6096-6686, 6685-6798, 6866-7180, 7277-7651, 7797-7954, and 7965-8... 339th, 8528-9145th, 9352-9765th, 10080-10364th, 10106-10234th, 10493-10876th, 11094-11468th, 19732-20538th, 21365-21847th, 21937-22929th, 179519-179944th, and 180309-180617th.
4. An African swine fever vaccine, characterized in that, The African swine fever vaccine comprises the gene-deleted attenuated African swine fever virus strain described in claim 3.
5. A method for preparing the gene-deleted attenuated African swine fever virus strain according to claim 3, characterized in that, The method described involves using genetic engineering techniques to modify positions 852-1403, 1613-1933, 2018-3106, 3247-3780, 3917-4162, 4263-4421, 4580-5650, 6096-6686, 6685-6798, 6866-7180, 7277-7651, 7797-7954, and 7965-83 of the original African swine fever virus type II strain ASFV CN / GS 2018. The following positions are missing: 39th, 8528-9145th, 9352-9765th, 10080-10364th, 10106-10234th, 10493-10876th, 11094-11468th, 19732-20538th, 21365-21847th, 21937-22929th, 179519-179944th, and 180309-180617th.
6. The method as described in claim 5, characterized in that, The method is homologous recombination technology.
7. A method for preparing the gene-deleted attenuated African swine fever virus strain according to claim 3, characterized in that, The method includes the following steps: (1) Design 1.0kb upstream and downstream sequences of the MGF-100-1R gene as left and right homologous recombination arms. Simultaneously clone the left and right homologous recombination arms and the BFP gene selection expression cassette gene fragment p72-BFP into the pUC57 vector to obtain the recombinant plasmid A00-A-BFP. (2) Design 1.0kb each of the upstream sequence of MGF-100-2L gene and the downstream sequence of MGF-100-3L gene as left and right homologous recombination arms. Simultaneously clone the left and right homologous recombination arm genes and the mCherry gene selection expression cassette gene fragment p72-mCherrry into the pUC57 vector to obtain the recombinant plasmid A00-BC-RFP. (3) Design 1.0kb each of the upstream sequence of MGF-300-1L gene and the downstream sequence of MGF-300-4L gene as left and right homologous recombination arms. Simultaneously clone the left and right homologous recombination arm genes and the eGFP gene selection expression cassette gene fragment p72-eGFP into the pUC57 vector to obtain the recombinant plasmid C00-GFP. (4) Recombinant plasmids C00-GFP, A00-BC-RFP, and A00-A-BFP were sequentially transfected into BMDM cells infected with the original ASFV strain. After continuous passage, the following genes were constructed: MGF-360-1La, MGF-360-1Lb, MGF-360-2L, KP177R, L83L, L60L, MGF-360-3L, MGF-110-1L, ASFV-G-ACD-00090, MGF-110-2L, and MGF-110-3L. A live attenuated African swine fever virus (ASFV-Δ24) with the following genes jointly deleted: ASFV-G-ACD-00120, MGF-110-4L, MGF-110-5L-6L, MGF-110-7L, 285L, ASFV-G-ACD-00160, MGF-110-8L, MGF-100-1R, MGF-300-1L, MGF-300-2R, MGF-300-4L, MGF-100-2L, and MGF-100-3L.
Citation Information
Patent Citations
Construction of attenuated African swine fever virus strain without ten genes and application of attenuated African swine fever virus strain as vaccine
CN114015660A
Construction of attenuated African swine fever virus strain without twelve genes and application of attenuated African swine fever virus strain as vaccine
CN114107228A