Application of lncRNA MAGE-A10 coding short peptide in regulating lymphatic metastasis of bladder cancer and targeted therapy for patients

By screening and validating the short peptide encoded by the highly expressed lncRNA MAGE-A10 as a molecular marker and therapeutic target for lymph node metastasis in bladder cancer, new diagnostic and therapeutic methods are provided, which solves the problem of limited efficacy of existing treatments for lymph node metastasis in bladder cancer and improves the prognosis of patients.

CN118421797BActive Publication Date: 2026-05-01SUN YAT SEN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410603369.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-15
Publication Date
2026-05-01
Estimated Expiration
2044-05-15

AI Technical Summary

Technical Problem

Current treatments have limited effectiveness against lymph node metastasis in bladder cancer, lacking effective drug targets and predictive biomarkers, which limits the improvement of prognosis in bladder cancer lymph node metastasis.

Method used

By screening for highly expressed lncRNA MAGE-A10-encoded short peptides, and using them as molecular markers for diagnosis and treatment, new diagnostic and therapeutic targets are provided, including microarrays, kits, or reagents. The expression level of the short peptides is used for assessment, and inhibitors of lncRNA MAGE-A10 translation are used to prepare drugs for the treatment of bladder cancer.

Benefits of technology

This study revealed the biological role of the MAGE-A10-44aa short peptide in lymph node metastasis of bladder cancer, providing a theoretical basis for early diagnosis and treatment, improving the prognosis of bladder cancer patients, and showing broad clinical application prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118421797B_ABST
    Figure CN118421797B_ABST
Patent Text Reader

Abstract

This invention discloses the application of lncRNA MAGE-A10-encoded short peptide in regulating lymph node metastasis and targeted therapy in bladder cancer, belonging to the field of biomedical technology. This invention focuses on the coding ability of long non-coding RNAs, using high-throughput sequencing and bioinformatics algorithms to screen for lncRNA MAGE-A10, which is highly expressed in lymph node metastasis-positive bladder cancer tissues. The coding ability was verified by predicting open reading frames, constructing expression vectors, and synthesizing specific antibodies. The encoded short peptide MAGE-A10-44aa was positively correlated with lymph node metastasis in bladder cancer and poor patient prognosis, and also promoted lymphangiogenesis and lymph node metastasis in bladder cancer. This confirms the biological role of the MAGE-A10-44aa short peptide in bladder cancer lymph node metastasis, providing a potential target for bladder cancer treatment.
Need to check novelty before this filing date? Find Prior Art

Description

lncRNA MAGE-A10 encodes a short peptide that regulates lymph node metastasis in bladder cancer and its application in targeted therapy for patients. Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to the application of lncRNA MAGE-A10-encoded short peptides in regulating lymph node metastasis in bladder cancer and in targeted therapy for patients. Background Technology

[0002] Currently, bladder cancer (BCa) is one of the most common malignant tumors of the urinary system worldwide, ranking 9th in incidence among malignant tumors and 7th among male malignant tumors. Its incidence is showing an increasing trend year by year, imposing a huge economic burden on the population. Studies have shown that lymphatic metastasis is the most common and primary mode of metastasis for bladder cancer. Once lymphatic metastasis occurs in bladder cancer patients, existing treatments, including surgical resection, radiotherapy, chemotherapy, and immunotherapy, have limited effectiveness in improving patient prognosis, with the five-year survival rate decreasing from 77.6% to 18.6%. While recent research has deepened our understanding of the molecular mechanisms of lymphatic metastasis in bladder cancer, its effectiveness in improving the prognosis of patients with lymphatic metastasis remains limited, mainly due to the lack of effective drug targets and predictive biomarkers. Therefore, exploring effective biomarkers and novel drug targets for bladder cancer lymphatic metastasis is a pressing challenge in current clinical and basic research on bladder cancer.

[0003] Long non-coding RNAs (lncRNAs) are a group of heterogeneous RNAs with transcripts longer than 200 nucleotides (nt). Initially considered transcriptional redundancy or byproducts, lncRNAs have been proven through ongoing research to play important roles in promoting or inhibiting tumor growth in human cancers. lncRNAs can regulate protein activity at epigenetic, transcriptional, and post-transcriptional levels and are associated with multiple processes such as cell cycle, differentiation, and metabolism, thereby influencing tumor progression. For example, lncRNA LNMAT2 promotes lymph node metastasis (LN) in bladder cancer by recruiting hnRNPA2B1 and regulating PROX1 expression; lncRNA-BCYRN1 promotes lymph node metastasis in bladder cancer by promoting WNT5A expression and activating the Wnt / β-catenin signaling pathway. To date, more than 100 lncRNAs have been identified as involved in the development and progression of bladder cancer, including MALAT1, UCA1, H19, NORAD, and TUG1. lncRNAs are promising targets for the prediction and treatment of bladder cancer. However, some tumor treatment strategies targeting lncRNA effector proteins still have significant limitations in effectiveness, suggesting that lncRNAs may have other additional regulatory mechanisms to regulate lymphatic metastasis besides their intrinsic functions. Recent studies have shown that non-coding RNAs also have the ability to encode short peptides, and these short peptides play important roles in promoting or inhibiting tumor growth in many tumors. Functional peptides encoded by lncRNAs are a relatively new area of ​​experimental and research research. Currently, the role of lncRNA-encoded short peptides in bladder cancer remains unclear, limiting the application of lncRNAs. Summary of the Invention

[0004] To address the shortcomings of existing technologies, this invention provides a lncRNA-encoded short peptide and elucidates its molecular mechanism mediating lymph node metastasis in bladder cancer, thus offering a more effective new diagnostic and therapeutic target for lymph node metastasis in bladder cancer.

[0005] lncRNA MAGE-A10 encodes a short peptide that regulates lymph node metastasis in bladder cancer and its application in targeted therapy for patients.

[0006] To achieve the above objectives, the present invention provides the following technical solution to address the technical problem:

[0007] On the one hand, this invention provides the application of lncRNA MAGE-A10 encoded short peptides as molecular markers in screening or preparing products for diagnosing bladder cancer, predicting the risk of lymph node metastasis in bladder cancer, and assessing the survival prognosis of bladder cancer.

[0008] Preferably, the product includes a chip, a reagent kit, or a reagent.

[0009] Preferably, the product is determined by the expression level of short peptides.

[0010] Preferably, the short peptide is MAGE-A10-44aa, and its amino acid sequence is shown in SEQ ID NO.1.

[0011] Preferably, patients with high expression of the MAGE-A10-44aa short peptide have a poorer prognosis, while patients with low expression of the MAGE-A10-44aa short peptide have a better prognosis; patients with high expression of the MAGE-A10-44aa short peptide have a shorter overall survival than patients with low expression of the MAGE-A10-44aa short peptide.

[0012] The present invention also provides a reagent for detecting the expression level of lncRNA MAGE-A10, which is used to predict the prognosis of bladder cancer lymph node metastasis or to diagnose bladder cancer.

[0013] Preferably, the reagent includes an upstream primer as shown in SEQ ID NO.2 and a downstream primer as shown in SEQ ID NO.3.

[0014] This invention also provides the application of an inhibitor of lncRNA MAGE-A10 translation in the preparation of drugs for treating bladder cancer.

[0015] The present invention also provides a kit for diagnosing or predicting the prognosis of bladder cancer lymph node metastasis, the kit comprising an upstream primer as shown in SEQ ID NO.2 and a downstream primer as shown in SEQ ID NO.3.

[0016] This invention also provides the application of lncRNA MAGE-A10 in the preparation of drugs for the diagnosis or treatment of bladder cancer.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] This invention focuses on the coding ability of long non-coding RNAs. Through high-throughput sequencing and bioinformatics algorithm analysis, the lncRNA MAGE-A10, highly expressed in lymph node metastasis-positive bladder cancer tissues, was identified. Its coding ability was validated by predicting open reading frames, constructing expression vectors, and synthesizing specific antibodies. The encoded short peptide MAGE-A10-44aa was positively correlated with lymph node metastasis in bladder cancer and poor patient prognosis. Further in vivo and in vitro experiments confirmed the promoting effect of MAGE-A10-44aa on lymphangiogenesis and lymph node metastasis in bladder cancer, revealing its biological role in bladder cancer lymph node metastasis. This provides a theoretical basis and scientific evidence for using MAGE-A10-44aa as an early diagnostic marker and novel therapeutic target for bladder cancer lymph node metastasis, showing broad clinical application prospects and offering new insights for improving the prognosis of bladder cancer patients. Attached Figure Description

[0019] To more clearly illustrate the technical solution of the present invention, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0020] Figure 1 is a schematic diagram of lncRNAs with high expression and translational potential in lymph node metastasis-positive bladder cancer tissues screened by the present invention. In the figure: A is a schematic diagram of lncRNAs with translational potential screened by high-throughput sequencing and bioinformatics prediction; B is a diagram of the expression of lncRNAs in bladder cancer tissue (BCa) and adjacent normal tissue (NAT) detected by qRT-PCR after expanding clinical samples; C is a diagram of the expression of lncRNAs in lymph node metastasis (LN) positive and negative cancer tissues detected by qRT-PCR after expanding clinical samples.

[0021] Figure 2 shows the expression of the ORF-GFP fusion protein detected by the Western blot experiment of this invention.

[0022] Figure 3 shows the activity of the start codon and the endogenous expression of the MAGE-A10-44aa short peptide. In the figure: A1 is a Western blot experiment; Figure A2 is a bar chart of expression level analysis.

[0023] Figure 4 shows the activity of the start codon and the endogenous expression of short peptides detected by immunofluorescence. In the figure: B represents the activity of the start codon and the endogenous expression of short peptides detected by immunofluorescence; C represents the endogenous expression of short peptides detected by immunofluorescence using specific antibodies.

[0024] Figure 5 shows the expression of the MAGE-A10-44aa short peptide. In the figure, A is the expression of the MAGE-A10-44aa short peptide detected by Western blot experiment; B is the statistical graph of MAGE-A10-44aa protein expression analysis. The statistical method is the nonparametric Mann–Whitney U test, in which two... The p-value for statistical analysis comparing representative groups was less than 0.01.

[0025] Figure 6 shows the expression of MAGE-A10-44aa short peptide in lymphoma-positive and negative lymphomas. In the figure: A on the left is a representative image taken under a microscope, and A on the right is a bar chart of statistical analysis; B on the left is a representative image taken under a microscope, and B on the right is a bar chart of statistical analysis.

[0026] Figure 7 shows the results of the tube formation and transwell experiments. In the figure: A is a representative image of lymphatic endothelial cell tube formation and transwell formation taken under a microscope; B is a statistical analysis of the differences in the width of lymphatic endothelial cell tubes in different groups, with three dots representing three replicates, and the statistical method being the two-tailed Student's t-test; C is a statistical analysis of the differences in the number of cells that transwelled in different groups, with three dots representing three replicates, and the statistical method being the two-tailed Student's t-test. The p-value for statistical analysis comparing representative groups was less than 0.01.

[0027] Figure 8 shows the results of the in vivo experiment. In the figure: A is a graph showing the metastasis of the popliteal lymph nodes of nude mice in different groups detected by in vivo imaging, and B is a graph showing the metastasis of tumors in the popliteal lymph nodes of nude mice detected by immunofluorescence.

[0028] Figure 9 is a statistical table showing the occurrence of popliteal lymph node metastasis in nude mice among different groups in the in vivo experiment. Detailed Implementation

[0029] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to specific examples. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0030] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; the materials and reagents used are commercially available unless otherwise specified.

[0031] The cancerous tissue and paired adjacent normal tissue involved in this invention were both obtained from Sun Yat-sen Memorial Hospital of Sun Yat-sen University.

[0032] Example 1: Screening of lncRNAs using MAGE-A10

[0033] I. Five pairs of bladder cancer tissues and their paired adjacent normal tissues, as well as five pairs of bladder cancer lymph node metastasis-positive and lymph node metastasis-negative tissues were collected from Sun Yat-sen Memorial Hospital. BGI Genomics Co., Ltd. then used high-throughput sequencing technology to construct libraries and perform sequencing, detecting lncRNAs with differential expression levels.

[0034] II. Expanding the clinical sample: Cancer tissue and paired adjacent normal tissue specimens were collected from 30 bladder cancer patients. The expression levels of lncRNAs in these specimens were detected by qRT-PCR. The specific steps included:

[0035] 1. Total RNA extraction:

[0036] (1) Tissue RNA lysis: Frozen fresh bladder cancer tissue was ground into small particles in liquid nitrogen, and then 1 mL of Trizol lysis buffer was added. The mixture was gently blown to mix and allow the cells to fully lyse. The lysis buffer was transferred to a 1.5 mL EP tube and allowed to stand at room temperature for 5 min.

[0037] (2) Cellular RNA lysis: Aspirate the culture medium, wash twice with PBS, each time 10 6 Add 1 mL of Trizol lysis buffer to each cell, gently pipette to mix and ensure complete cell lysis. Transfer the lysis buffer to a 1.5 mL EP tube and incubate at room temperature for 5 min. Then add 1 / 5 volume of chloroform, vortex vigorously to mix, and incubate at room temperature until layers appear. Centrifuge at 12000 rpm and 4°C for 15 min. At this point, the solution in the EP tube will separate into three layers. Carefully transfer the uppermost supernatant (approximately 400–500 μL) to a new RNase-free EP tube, being careful not to touch the intermediate phase or precipitate.

[0038] (3) RNA precipitation: Add an equal volume of isopropanol (about 400-500 μL) to the supernatant, mix thoroughly, let stand at room temperature for 10 min, then centrifuge at 12000 rpm at 4°C for 10 min and discard the supernatant to obtain RNA precipitate; add 1 mL of 75% ethanol to wash once, centrifuge at 7500 rpm at 4°C for 5 min, discard the ethanol thoroughly, and air dry until the RNA becomes completely transparent; add an appropriate amount of DEPC-treated water according to the size of the precipitate, shake thoroughly to mix, and obtain total RNA.

[0039] 2. Reverse transcription: LncRNA expression was detected using Novozymes' HiScript III RT SuperMix for qPCR. The amplification system and program are shown in Tables 1 and 2 below.

[0040] Table 1 qRT-PCR amplification system

[0041]

[0042] Table 2 Amplification Procedure

[0043]

[0044] The qRT-PCR primer sequences (designed and synthesized by Shanghai Sangon Biotech Co., Ltd.) are shown below:

[0045] Upstream primer F1: 5'-CCTGCTACCCTGATCAGAGTC-3' (SEQ ID NO.2);

[0046] Downstream primer R1: 5'-TCTTTAGTTTCCTGTGCTTGCT-3' (SEQ ID NO.3).

[0047] As shown in Figures 1B and 1C, by expanding the clinical sample and detecting the expression level of lncRNAs in it by qRT-PCR, it was found that lncRNA MAGE-A10 was expressed significantly higher in bladder cancer tissue than in adjacent normal tissue, and was expressed higher in lymph node metastasis-positive cancer tissue than in lymph node metastasis-negative cancer tissue.

[0048] 3. Using ORF Finder and GWIPS-viz database ribosome analysis data to identify lncRNAs with translational potential, three lncRNAs with high expression and translational potential in lymph node metastasis-positive bladder cancer tissues were screened out (as shown in Figure 1A). ORF Finder was used to predict all ORFs with start codon AUG in a meaningful (+) direction.

[0049] Plasmids with GFP tags added to the C-terminus of all ORFs were constructed and transfected into the UM-UC-3 bladder cancer cell line, and further Western blot experiments were performed.

[0050] As shown in Figure 2, by detecting the expression of each ORF-GFP fusion protein, it was confirmed that only the ORF1 of lncRNA MAGE-A10 (sequence shown as SEQ ID NO.4) has translational potential, and only the ORF1 of lncRNA MAGE-A10 can translate into a polypeptide.

[0051] ATGCCTCGAGCTCCAAAGCGTCAGCGCTGCATGCCTGAAGAAGATCTTCAATCCCAAACATCATGCACTATCCTGTTGGGAGCATCCTCACCTCCAAGACACTGTTTGGGCCTGAGGAGAAGGAGTCTGCAGTGA (SEQ ID NO. 4).

[0052] Example 2: Verification that MAGE-A10 has the function of encoding short peptides

[0053] 1. Plasmid construction: Using plasmid construction technology from Guangzhou Aiji Biotechnology Co., Ltd., a fusion expression plasmid with a FLAG tag inserted at the C-terminus of the ORF1 fragment of lncRNA MAGE-A10 was successfully constructed. The start codon ATGGTG was further mutated to ATTGTT to construct the FLAGmut ORF fusion expression plasmid.

[0054] 2. The constructed plasmid was transfected into the UM-UC-3 bladder cancer cell line using Lipo 3000 and p3000 reagents. 48 h after transfection, half of the cells were used for immunofluorescence experiments. The antibody used was the FLAG antibody from Abcam. The transfected UM-UC-3 cells were fixed in confocal dishes with 4% paraformaldehyde, treated with 0.5% Triton's reagent, and then blocked with 1% BSA solution at 37°C for 1 hour. Subsequently, they were incubated overnight with anti-FLAG antibody. Finally, after DAPI staining, the confocal dishes were photographed under a laser confocal microscope (Zeiss LAM 710 focal Microscope). The other half of the cells were used to extract proteins and then Western blot experiments were performed to verify the expression of the FLAG fusion protein.

[0055] As shown in Figures 3 and 4, the ORF1 of lncRNA MAGE-A10 is capable of translation, translating into a short peptide with an amino acid sequence length of 44aa (sequence shown in SEQ ID NO.1), named MAGE-A10-44aa. Furthermore, Western blot experiments and immunofluorescence assays did not detect the expression of the FLAGmut ORF fusion protein in the AUG codon mutant group, confirming that the initiation AUG codon of the MAGE-A10-44aa short peptide is functionally active.

[0056] MPRAPKRQRCMPEEDLQSQTSCTILLGASSPPRHCLGLRRRSLQ (SEQ ID NO. 1).

[0057] Example 3: Analysis of the relationship between MAGE-A10-44aa short peptide and lymph node metastasis and poor prognosis in bladder cancer patients

[0058] 1. We collected tumor tissue, paired adjacent normal tissue, and corresponding paraffin sections from 30 bladder cancer patients at Sun Yat-sen Memorial Hospital.

[0059] First, the collected bladder cancer tissue and paired adjacent normal tissue were flash-frozen in liquid nitrogen, then ground and the total cellular protein was extracted. The processed cells were then subjected to routine digestion and centrifugation to obtain a cell pellet. The pellet was washed with PBS, and the PBS solution was discarded. Next, an appropriate amount of cell lysis buffer was added according to the cell number: 1 μL of 100X phosphatase inhibitor (Comvita, China) and 100X protease inhibitor (Comvita, China) were added to every 98 μL of RIPA lysis buffer (Comvita, China). After thorough shaking, the cells were placed on ice for lysis and centrifuged at 4°C, 12000 g, for 30 min. The supernatant was transferred to a new EP tube, and the total protein concentration was determined using the Pierce BCA protein quantification kit (Comvita, China). The required BCA mixture was prepared by mixing solution A and solution B from the kit at a ratio of 50:1. Subsequently, 180 μL of BCA mixture + 18 μL of pure water + 2 μL of total protein solution was added to each well of a 96-well plate and vortexed to mix. The 96-well plate was then incubated at 37°C for 30 min. Next, the absorbance at 562 nm in different well solutions was measured using a microplate reader, and the total protein concentration in different samples was calculated based on the kit's standard curve. Based on the measured concentration, a final concentration of 1 μg / μL was prepared using 5X protein loading buffer (final concentration 1×) (Solepro, China) and RIPA solution. The prepared total protein samples were boiled at 98°C for 10 min to denature the protein and then stored at -30°C for later use.

[0060] The protein was then used in a Western blot experiment to detect its expression level. The specific steps are as follows:

[0061] (1) Gel preparation: Install the cleaned and dried gel preparation glass plate on the gel preparation rack. Then prepare 10% SDS-PAGE gel according to the instructions of the SDS-PAGE gel preparation kit (Yamei, China).

[0062] (2) Glue pouring: Slowly pour the prepared separating glue into the installed glass plate tank, and then continue to slowly add the concentrated glue, being careful to be gentle and avoid generating air bubbles. Next, insert the comb teeth into the concentrated glue, let it stand, and wait for the gelatin to solidify;

[0063] (3) Prepare electrophoresis buffer: Prepare electrophoresis buffer according to the proportions shown in Table 3, and pour the prepared electrophoresis buffer into the electrophoresis tank;

[0064] Table 3 Electrophoresis Buffer Formulation Table

[0065]

[0066] (4) Sample loading and electrophoresis: Remove the comb teeth from the gelatin, add 20 μL of protein solution to the sample well, and add 2 μL of protein marker to both ends of the lane. Turn on the power and start electrophoresis at a constant voltage of 75 V. When the protein sample reaches the separating gel, increase the voltage to 120 V and continue electrophoresis. Stop electrophoresis when the protein sample is about to be electrophoresed out of the gelatin.

[0067] (5) Electroporation: Prepare the electroporation buffer according to the proportions shown in Table 4 and pre-cool it on ice. Take out the gelatin and cut off the top layer of gelatin. Place the gelatin into the electroporation clamp containing the sponge pad and cover it with the PVDF membrane (Merck, Germany) that has been activated with methanol in advance. Then, insert the electroporation clamp into the electroporation tank in the correct electroporation direction and add an appropriate amount of electroporation buffer. Electroporate for 120 min at a constant current of 300 mA.

[0068] Table 4 Western blot electroporation solution formulation table

[0069]

[0070] (6) Blocking: Take out the PVDF membrane after electroporation and block it on a shaker for 10 min with protein rapid blocking solution;

[0071] (7) Primary antibody incubation: Prepare the primary antibody solution according to the antibody instructions, and incubate the cut protein band in the corresponding primary antibody solution at 4°C with slow shaking overnight;

[0072] (8) Secondary antibody incubation: After the primary antibody incubation is completed, the bands are washed with TBST solution on a shaker for 10 min, and repeated 3 times. Then, according to the different species of primary antibody and the corresponding secondary antibody solution, continue incubation at room temperature for 60 min;

[0073] (9) Chemiluminescence: After the secondary antibody incubation, the strips were washed with TBST solution on a shaker for 10 min, and repeated 3 times. Then, the chemiluminescence solution was prepared using the ECL chemiluminescence solution kit (Millipore, USA), and an appropriate amount of chemiluminescence solution was added to the strips in a darkroom for development. X-ray film (Foxconn, Japan) was pressed onto the strips, and the exposed X-ray film was placed in a film processor for development. The film was scanned using a scanner, and statistical analysis was performed using Image J (NIH, Bethesda, USA) software.

[0074] As shown in Figure 5, peptide expression was found in both bladder cancer cell lines and normal bladder epithelial cell lines. Compared with adjacent normal tissues, the expression level of MAGE-A10-44aa short peptide was significantly increased in bladder cancer tissues, confirming the endogenous expression of MAGE-A10-44aa short peptide.

[0075] 2. Use a multi-target immunofluorescence staining kit (Beijing Bainuo Panoramic Biotechnology Co., Ltd.) to stain the paraffin sections. The antibodies used are specific anti-MAGE-A10-44aa short peptide antibody and LYVE-1 antibody (Abcam). Follow the instructions in the kit's manual for specific procedures.

[0076] 3. The stained slides were scanned using the Pannoramic Confocal (3DHISTECH, Hungary) side scanner, and the slides were identified and statistically analyzed using Imaris 9.0 software. The results were then compared with the clinical information of patients corresponding to bladder cancer slides. The chi-square test was used, and the statistical scoring method was H-score = ∑(P × I), where P is the number of positively stained cells, I is the staining depth, and 0 points represent no staining, 1 point represents weak staining, 2 points represent moderate staining, and 3 points represent strong staining.

[0077] As shown in Figure 6, the expression level of MAGE-A10-44aa short peptide in bladder cancer tissues with positive lymph node metastasis was significantly higher than that in bladder cancer tissues without lymph node metastasis. At the same time, the lymphatic vessel density was significantly increased in bladder cancer tissues with high expression of MAGE-A10-encoded short peptide. The lymphatic vessels were detected by immunofluorescence assay using LYVE-1 antibody labeling. Combined with the analysis of LYVE-1 labeled lymphatic vessel staining results, it was found that the density of newly formed lymphatic vessels labeled by LYVE-1 in bladder cancer tissues with high expression of MAGE-A10-44aa short peptide was significantly higher than that in bladder cancer tissues with low expression of MAGE-A10-44aa short peptide.

[0078] Example 4: In vitro experiment

[0079] MAGE-A10-44aa short peptide can promote the migration and tube-forming ability of lymphatic endothelial cells.

[0080] I. Construction of a bladder cancer cell line with high expression of MAGE-A10-44aa short peptide: The FLAG tag plasmid constructed by Guangzhou Aiji Biotechnology Co., Ltd. was transfected into the UM-UC-3 bladder cancer cell line to overexpress the MAGE-A10-44aa short peptide in the bladder cancer cell line. The cells were further lysed to extract proteins, and the extracted proteins were measured by Western blot to verify the transfection efficiency.

[0081] 2. Seed lymphatic endothelial cells into a six-well plate, 10 cells per well. 4 10 cells per well; then the transfected tumor cells were divided into 10 cells per well. 5 Two groups of cells, Vector and ORF-FLAG, were induced by adding a certain number of cells to the upper chamber. After culturing the cells in an incubator for 48 hours, the six-well plates were removed, the cells were digested with trypsin, centrifuged, and the culture medium was discarded.

[0082] III. Tube Formation Experiment:

[0083] One day in advance, prepare the matrix gel in 24-well plates. The experimental procedure is as follows: Prepare and mix the matrix gel with serum-free medium at a ratio of 1:2. Then, add 700 μL of the diluted matrix gel to each well of the 24-well plate, shake to level, and place the plate in an incubator until the matrix gel solidifies. Afterward, resuspend the cells in normal complete medium containing 5% serum and count them. Take 2 × 10⁶ cells... 4Cells per well were gently added to a 24-well plate pre-coated with matrix gel, gently shaken to spread the cells evenly. The plates were then incubated in a cell culture incubator, and cell tube formation was observed every 2 hours. After cell tube formation, images were taken under an inverted microscope, and the tube length was measured using ImageJ software. Statistical analysis was performed to compare the differences in tube formation among different induction groups. The results are shown in Figure 7. It was found that, compared with the control group, overexpression of the MAGE-A10-44aa short peptide significantly enhanced the ability of bladder cancer cells to induce lymphangiogenic cell tube formation.

[0084] IV. Transwell Experiment:

[0085] After induction and digestion, the centrifuged cells were resuspended in fresh serum-free culture medium and counted. 5 × 10⁶ cells were collected. 4 Cells were diluted with serum-free medium to a total volume of 300 μL, and the cell suspension was added to the upper chamber of a Transwell chamber. 700 μL of medium containing 5% serum was added to the lower chamber. The entire system was incubated for 8 hours. After incubation, the chambers were removed, and cells were fixed with 4% paraformaldehyde for 15 min. Cells were then gently washed three times with PBS and stained with crystal violet for 15 min. Excess crystal violet stain was washed away with PBS. Cells were gently wiped from the inside of the chambers with cotton swabs, and observed and photographed under a microscope. Random fields of view were counted using ImageJ. Statistical analysis was performed to identify differences in cell migration ability among different bladder cancer cell induction groups. The results are shown in Figure 7. Compared with the control group, overexpression of the MAGE-A10-44aa short peptide significantly enhanced the migration ability of lymphangiocytes induced by bladder cancer cells.

[0086] V. In vivo experiments

[0087] A UM-UC-3 bladder cancer cell line labeled with GFP was constructed, including a portion of the UM-UC-3 bladder cancer cell line stably overexpressing the C-terminus FLAG-labeled MAGE-A10-44aa peptide. Twenty-four healthy female nude mice aged 4-5 weeks were purchased, and 5 × 10⁸ of normal UM-UC-3 cells labeled with GFP and UM-UC-3 cells overexpressing the MAGE-A10-44aa peptide were injected into the right paw pad. 5 Each mouse was used to construct a footpad tumor model. In vivo imaging was then performed weekly to observe metastasis of the popliteal lymph nodes in the footpads of nude mice until the footpad tumor volume exceeded 200 mm². 3 Or the nude mice died. The popliteal lymph nodes of the nude mice were isolated, their volume was measured, and the metastasis of tumors was analyzed by immunofluorescence. The differences in the metastasis rate of the popliteal lymph nodes among different bladder cancer cell induction groups were recorded and analyzed. Significance analysis was performed using the chi-square test, where two... The p-value for statistical analysis comparing representative groups was less than 0.01.

[0088] The results, as shown in Figures 8 and 9, revealed that bladder cancer cells overexpressing the MAGE-A10-44aa peptide significantly promoted lymphatic metastasis of bladder cancer.

[0089] This invention focuses on the coding ability of long non-coding RNAs. Through high-throughput sequencing and bioinformatics algorithm analysis, the lncRNA MAGE-A10, highly expressed in lymph node metastasis-positive bladder cancer tissues, was identified. Its coding ability was validated by predicting open reading frames, constructing expression vectors, and synthesizing specific antibodies. The invention also confirmed a positive correlation between the MAGE-A10-44aa short peptide and lymph node metastasis in bladder cancer and poor patient prognosis. Furthermore, in vitro and in vivo experiments demonstrated the promoting effect of the MAGE-A10-44aa short peptide on lymphangiogenesis and lymph node metastasis in bladder cancer, revealing its biological role in bladder cancer lymph node metastasis. This provides a theoretical basis and scientific evidence for using the MAGE-A10-44aa short peptide as an early diagnostic marker and novel therapeutic target for bladder cancer lymph node metastasis.

[0090] Furthermore, it should be understood that although this specification describes embodiments, not every embodiment contains only one independent technical solution. This narrative style is merely for clarity. Those skilled in the art should consider the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. The application of lncRNA MAGE-A10 encoding a short peptide as a molecular marker in the preparation of products for diagnosing bladder cancer, predicting the risk of lymph node metastasis in bladder cancer, or assessing the survival prognosis of bladder cancer; the short peptide is MAGE-A10-44aa, and its amino acid sequence is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The products include chips, reagent kits, or reagents.

3. The application according to claim 1, characterized in that, The product is determined by the expression level of short peptides.

4. The application according to claim 1, characterized in that, Patients with high expression of the MAGE-A10-44aa short peptide have a poorer prognosis, while patients with low expression of the MAGE-A10-44aa short peptide have a better prognosis; patients with high expression of the MAGE-A10-44aa short peptide have a shorter overall survival than patients with low expression of the MAGE-A10-44aa short peptide.