Use of an akt1 inhibitor in the manufacture of a medicament for treating pigmented villonodular synovitis
By preparing AKT1 inhibitors as drugs, silencing the AKT1 protein, and inhibiting the migration and invasion activities of PVNS-FLSs, the problem of the lack of effective therapeutic drugs in the prior art is solved, and a new method for treating pigmented villonodular synovitis is provided.
Patent Information
- Application Number
- CN202410564074.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-05-08
- Publication Date
- 2026-03-24
- Estimated Expiration
- 2044-05-08
AI Technical Summary
The lack of effective AKT1 inhibitors in the current technology for the treatment of pigmented villonodular synovitis results in limited treatment options.
Develop AKT1 inhibitors as active ingredients and formulate them into pharmaceutically acceptable dosage forms for the treatment of pigmented villonodular synovitis by silencing AKT1 to inhibit the migration and invasive activity of PVNS-FLSs.
Effectively inhibiting the migration and invasion activity of PVNS-FLSs provides a new drug option for the treatment of PVNS.
Smart Images

Figure CN118453870B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the field of biological medicine, and particularly relates to application of an AKT1 inhibitor in preparation of a drug for treating pigmented villonodular synovitis. BACKGROUND
[0002] Pigmented villonodular synovitis (PVNS), also known as intracapsular synovial giant cell tumor (TGCT), is a benign lesion characterized by villonodular synovial hyperplasia and hemosiderin deposition, and its malignant transformation and distant metastasis are rare. PVNS is more common in young adults aged 20-40 years, and recent epidemiological survey results show that its incidence is greater than 1.8 / 100,000. In 2013, the World Health Organization classified the disease into localized PVNS (LPVNS) and diffuse PVNS (DPVNS). The incidence of LPVNS is higher than that of DPVNS, and both types are more common in women. PVNS usually involves a single joint, of which 80% is the knee joint, but there are also cases of multiple joint involvement.
[0003] The early X-ray findings of PVNS are normal, and the late X-ray findings are bone erosion and subchondral bone cyst. Bone erosion is related to increased joint cavity pressure and direct involvement of bone, and is more common in joints with smaller joint cavity capacity. CT examination is commonly used for advanced cases, which can not only find slight bone erosion, but also accurately analyze subchondral bone cysts, and is helpful for the differential diagnosis of PVNS and other malignant tumors. The results of ultrasonic examination can show non-specific joint effusion, synovial hypoecho thickening and high vascularization, which can not only guide biopsy, but also evaluate disease progression and treatment effect.
[0004] The preferred treatment for LPVNS is arthroscopic surgery, and the surgical method for DPVNS should be comprehensively considered in combination with the location, severity of the lesion and the experience of the operator; the long-term efficacy of joint replacement needs to be observed; although radiotherapy can reduce the recurrence rate, its safety is still controversial; targeted drugs for the CSF-1 / CSF-1R axis can provide a new treatment option.
[0005] AKT is a key factor for PI3K-dependent inhibition of apoptosis, and AKT1 is one of the important subtypes of AKT.
[0006] Overall, the choice of PVNS treatment drugs is still very small, and more effective PVNS treatment drugs need to be developed. There is no report on AKT1 inhibitors for treating PVNS. SUMMARY
[0007] The purpose of the present application is to overcome the shortcomings of the prior art, and to provide the application of AKT1 inhibitor in the preparation of a drug for treating pigmented villonodular synovitis.
[0008] The above-mentioned purpose of the present application is realized by the following technical solutions:
[0009] Use of AKT1 inhibitor in the preparation of a medicament for treating pigmented villonodular synovitis.
[0010] Preferably, the medicament contains AKT1 inhibitor as an active ingredient, and further contains a pharmaceutically acceptable carrier or excipient, and is prepared into a pharmaceutically acceptable dosage form.
[0011] Preferably, the carrier or excipient is solid, liquid or semi-solid.
[0012] Beneficial effects:
[0013] It is known to those skilled in the art that the high migration activity and high invasion activity of PVNS-FLSs are important reasons for the development of the disease. The experimental results of the present application show that the migration and invasion activity of PVNS-FLSs can be effectively inhibited by silencing AKT1. Therefore, AKT1 inhibitor has the prospect of developing into a medicament for treating pigmented villonodular synovitis. BRIEF DESCRIPTION OF DRAWINGS
[0014] Figure 1 For Western blot detection of AKT1 silencing efficiency.
[0015] Figure 2 For the effect of AKT1 silencing on the migration activity of PVNS-FLSs.
[0016] Figure 3 For the effect of AKT1 silencing on the invasion activity of PVNS-FLSs.
[0017] Figure 4 For the flow chart of animal experiments.
[0018] Figure 5 For the size of xenograft volume. DETAILED DESCRIPTION
[0019] The essential content of the present application will be specifically described below in combination with examples, but the protection scope of the present application is not limited by this.
[0020] Example 1: Cell experiment
[0021] I. Experimental materials
[0022] 1. Animals
[0023] Female BALB / c-athymic mice (5-6 weeks old) were purchased from Charles River (Beijing, China).
[0024] 2. Reagents
[0025]
[0026] II. Experimental Methods
[0027] 1. Primary culture of PVNS synovial fibroblasts (FLS, PVNS-FLSs)
[0028] Synovial specimens were obtained from PVNS patients under sterile operating room conditions. Fat and connective tissue were carefully removed in a laminar flow hood to obtain synovial tissue. The tissue was washed three times with PBS containing 5% penicillin-dextrose antibody and then cut into 1mm×1mm×1mm pieces.
[0029] 1) Transfer the shredded synovial tissue into 4 ml of RPMI-1640 medium containing 0.5 mg / ml type IV collagenase and digest it on a shaker at 37°C for 2 h.
[0030] 2) Centrifuge at 1500 rpm for 5 min and discard the supernatant. Then add 4 ml of 1640 culture medium and resuspend the precipitate by pipetting.
[0031] 3) Centrifuge at 1500 rpm for 5 min and discard the supernatant. Then add 2 ml of complete high-glucose DMEM medium, transfer to a 6-well plate, and incubate at 37°C in a 5% CO2 incubator.
[0032] 4) On the third day, perform a half-volume medium change, and on the fifth day, perform a full-volume medium change. Thereafter, change the medium every 2-3 days to a complete high-glucose DMEM medium (containing 10% fetal bovine serum and penicillin-streptomycin antibiotics).
[0033] 2. PVNS-FLSs passaging
[0034] When the cells in the cell culture dish cover approximately 80%–90% of the bottom, passage PVNS-FLSs. After discarding the culture medium, add approximately 3 ml of trypsin solution to the bottom of a 10 cm dish. Spread the solution evenly on the bottom of the dish. Place the culture dish in a 37°C CO2 incubator for 2–3 minutes to digest the cells, then gently pipette the bottom of the dish to detach the adherent cells. Once all cells have detached from the culture dish and are in suspension, immediately add DMEM complete culture medium to terminate the reaction. Transfer the cells at a 1:3 ratio to the required containers, such as 10 cm culture dishes, 6-well plates, and 12-well plates, and add an appropriate amount of DMEM complete culture medium. If necessary, add cell smears to the wells for immunofluorescence and other experiments. Incubate at 37°C in a CO2 incubator.
[0035] PVNS-FLSs from generations 4 to 7 were used for subsequent experiments.
[0036] 3. Grouping and processing
[0037] The experiment was divided into a control group (C), an interference group (siRNA), and a negative control group (NC).
[0038] The control group consisted of PVNS-FLSs that did not undergo transfection.
[0039] The interference group consisted of PVNS-FLSs transfected with siRNA that downregulates AKT1 expression (AKT1 siRNA);
[0040] The interference control group consisted of PVNS-FLSs transfected with a scrambled control siRNA.
[0041] The sequence of AKT1 siRNA is as follows:
[0042] Sense:UGCAGCAUCGCUUCUUUGCCGGUAU;
[0043] Antisense:AUACCGGCAAGAAGCGAUGCUGCA.
[0044] The transfection procedure is as follows:
[0045] Under normal conditions, transiently transfect AKT1-targeting siRNA into PVNS-FLSs. Suspend 15 μl of AKT1 siRNA or non-targeted disordered control siRNA in 200 μl of BTX nuclear transfection buffer. Add 5 × 10⁻⁶ ppm of this mixture to PVNS-FLSs. 5 FLSs were then transfected using the BTX electroporation system. Transfected cells were placed in culture dishes and cultured for 2 days under different conditions. Scramble control siRNA was used as a negative control. Western blot was used to detect the silencing efficiency of AKT1.
[0046] AKT1 siRNA or scramble control siRNA was transfected into PVNS-FLSs using a standard transient transfection method. Specifically, 15 μl of AKT1 siRNA or scramble control siRNA was suspended in 200 μl of BTX nuclear transfection buffer, and the mixture was added to 5 × 10⁻⁶ ppm of the buffer. 5 Cells were cultured in PVNS-FLSs and then transfected using the BTX electroporation system. Transfected cells were then incubated in culture dishes for 2 days. AKT1 silencing efficiency was assessed using Western blot.
[0047] 4. Detection of migration and invasion activity
[0048] The migration and invasion abilities of passaged FLSs were assessed on Transwell plates containing polycarbonate filter cartridges (Corning-Costar) with a diameter of 10 mm and a pore size of 8.0 μmm. In the invasion assay, 25 μg of Matrigel (Labselect, dilution: 40:1) was coated onto the filter membrane of each upper compartment of the Transwell plate, and incubated at 37°C to form a recombinant matrix membrane. FLSs were prepared into 500 μl cell suspensions (1 × 10⁶ cells / mL) using DMEM complete medium containing 10% fetal bovine serum. 5 Cells were seeded in the upper chamber of a Transwell plate (100 μl DMEM) and stimulated with IL-1β (10 ng / ml) for 30 min. Additionally, 500 μl of DMEM complete medium containing 10% fetal bovine serum was added to the lower chamber. To assess the effect of AKT signal silencing on PVNS-FLS migration and invasion, siRNA-PVNS-FLSs and disordered control PVNS-FLSs were added to the upper chamber along with the previously mentioned PVNS-FLSs, and stimulated with IL-1β after 30 min. After 18 h of incubation, cells were fixed with 4% paraformaldehyde for 30 min and stained with 0.1% crystal violet for 20 min. Unmigrated cells were carefully removed from the upper surface of the Transwell filter membrane by wiping with a moistened cotton swab. Cells passing through the bottom surface of the filter membrane were counted under a high-power objective (100x), with six fields of view per well.
[0049] 5. Statistical Analysis
[0050] Numerical values are reported as SEM ± mean. All statistical tests were run using GraphPad Prism (v8.4.3). All quantitative data were subjected to the Shapiro-Wilk test for normality and the F-test for homogeneity of variance. We used unpaired two-tailed Student's t-tests to compare data between two groups, and for non-normally distributed data, we used the Mann-Whitney test. A p-value less than 0.05 was considered significant.
[0051] III. Experimental Results
[0052] 1. AKT1 Silence Efficiency
[0053] Western blot results are as follows Figure 1 As shown in the figure, compared with the control group (C), the expression level of AKT1 protein in the interference group (siRNA) PVNS-FLSs was significantly downregulated; the expression level of AKT1 protein in the interference control group (NC) PVNS-FLSs was not significantly downregulated. This result indicates that AKT1 expression was successfully and significantly reduced by siRNA transfection.
[0054] 2. Effect of AKT1 silencing on the migration activity of PVNS-FLSs
[0055] To observe the migration activity of PVNS-FLSs, we stimulated PVNS-FLSs with different treatments using IL-1β. The results are as follows: Figure 2 As shown, the migration activity of PVNS-FLSs in the interference group under IL-1β stimulation was significantly weaker than that in the control group; however, the migration activity of PVNS-FLSs in the interference group under IL-1β stimulation was not significantly weaker than that in the control group. These results indicate that AKT1 silencing significantly inhibits the migration activity of PVNS-FLSs.
[0056] 3. Effect of AKT1 silencing on the invasive activity of PVNS-FLSs
[0057] To observe the invasive activity of PVNS-FLSs, we stimulated PVNS-FLSs with different treatments using IL-1β. The results are as follows: Figure 3 As shown, the invasive activity of PVNS-FLSs in the interference group under IL-1β stimulation was significantly weaker than that in the control group; the invasive activity of PVNS-FLSs in the interference group under IL-1β stimulation was not significantly weaker than that in the control group. These results indicate that AKT1 silencing significantly inhibits the invasive activity of PVNS-FLSs.
[0058] Those skilled in the art know that the high migration and invasive activity of PVNS-FLSs are important factors contributing to disease progression. The above experimental results demonstrate that silencing AKT1 can effectively inhibit the migration and invasive activity of PVNS-FLSs. Therefore, AKT1 inhibitors show promise for development into drugs for the treatment of pigmented villonodular synovitis.
[0059] Example 2: Animal Experiment
[0060] I. Experimental Materials
[0061] 1. Animals
[0062] Female BALB / c-athymic mice (5-6 weeks old) were purchased from Charles River (Beijing, China).
[0063] 2. Reagents
[0064]
[0065] II. Experimental Methods
[0066] 1. Animal husbandry
[0067] Five- to six-week-old female BALB / c-athymium mice were housed in SPF conditions at 23°C to 25°C.
[0068] 2. Grouping, modeling, and drug administration
[0069] Freshly dissected synovial tissue from PVNS patients was collected intraoperatively and placed in normal saline. After removing necrotic tissue, the tumor mass was cut into small pieces (approximately 1 mm in volume). 3 After anesthesia took effect, subcutaneous transplantation was performed on mice, and the wound was then sutured closed. A mouse model of PVNS patient-derived tumor xenograft (PDTX) was established.
[0070] Three days after model establishment, the mice were randomly divided into a control group (CON, n=3) and a treatment group (GSK690693, n=3). The treatment group was given the AKT1 inhibitor GSK690693 (2 mg / kg / day) by gavage, while the control group was given an equal amount of the carrier.
[0071] 3. Sample collection and processing
[0072] Ten days after administration, the mice were sacrificed and the transplanted tumors were harvested surgically to compare the tumor volume between the two groups.
[0073] 4. Statistical Analysis
[0074] Numerical values are reported as SEM ± mean. All statistical tests were run using GraphPad Prism (v8.4.3). All quantitative data were subjected to the Shapiro-Wilk test for normality and the F-test for homogeneity of variance. We used an unpaired two-tailed Student's t-test to compare data between two groups, and for non-normally distributed data, we used the Mann-Whitney test. A p-value less than 0.05 was considered significant.
[0075] III. Experimental Results
[0076] The procedure for animal experiments is as follows Figure 4 As shown in the figure. Compared with the control group, AKT1 inhibitors significantly inhibited the growth of tumor xenografts from PVNS patients, and the tumor volume in the treatment group was significantly smaller than that in the control group, as shown in the figure. Figure 5 As shown.
[0077] The purpose of the above embodiments is to specifically illustrate the substantive content of the present invention, but those skilled in the art should know that the scope of protection of the present invention should not be limited to the specific embodiments.
Claims
1. The use of an AKT1 protein expression level inhibitor in the preparation of a medicament for treating pigmented villonodular synovitis, wherein the AKT1 protein expression level inhibitor is a siRNA with the following sequence: Justice Chain: UGCAGCAUCGCUUCUUUGCCGGUAU; Antonyms: AUACCGGCAAAGAAGCGAUGCUGCA.
2. The application according to claim 1, characterized in that: The drug uses the AKT1 protein expression level inhibitor as its active ingredient and also contains pharmaceutically acceptable excipients, and is formulated into a pharmaceutically acceptable dosage form.
3. The application according to claim 2, characterized in that: The auxiliary material is a solid, liquid, or semi-solid.