A wheat receptor protein kinase TaFER-NW and its applications

Abstract

This invention belongs to the field of bioengineering technology and relates to a wheat receptor protein kinase TaFER-NW and its applications. The amino acid sequence of the wheat receptor protein kinase TaFER-NW provided by this invention is shown in SEQ ID NO:1, and the encoding ORF sequence of the wheat receptor protein kinase TaFER-NW is shown in SEQ ID NO:2. This invention involves gene editing in Fielder wild-type materials to obtain gene-edited mutant plants of TaFER-NW that exhibit resistance to the stripe rust fungus CYR31. This invention provides a new technical approach for breeding stripe rust-resistant varieties, confirming that this gene plays a negative regulatory role in wheat stripe rust resistance, and providing new gene resources for wheat stripe rust resistance breeding.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology and relates to a wheat receptor protein kinase TaFER-NW and its applications. Background Technology

[0002] Wheat, as one of the most widely planted and highest-yielding cereal crops globally, reportedly feeds 30%-45% of the world's population. Wheat stripe rust, caused by the wheat-specific strain of *Puccinia striiformis* f. spritici (Pst), is a fungal disease that occurs in almost every major wheat-growing region worldwide, severely impacting wheat yields. Frequent variations in the virulence of the stripe rust fungus lead to frequent outbreaks of wheat stripe rust and the overcoming of resistance in existing varieties. Therefore, the rational utilization of disease-resistant genes to create resistant materials is the most economical, effective, and sustainable development strategy for controlling wheat stripe rust.

[0003] Receptor-like protein kinases (RLKs) are a large class of transmembrane proteins in plants, playing a crucial role in cell-cell and cell-environment communication. RLKs are single-transmembrane proteins located on the cell membrane, comprising an extracellular receptor domain for sensing external signals, a transmembrane domain, and an intracellular kinase domain. In common RLK signaling pathways, the extracellular receptor domain first senses and recognizes external signals, transmitting the signal to the cytoplasm. The cytoplasmic kinase domain then interacts with downstream proteins, initiating their biochemical reactions (such as phosphorylation). Finally, the signal is transmitted to the nucleus via the nucleus-cytoplasm shuttle messenger, regulating downstream gene expression and enabling adaptation to rapid environmental changes.

[0004] Currently, chemical control is the primary method for controlling wheat stripe rust, and the environmental and food safety hazards posed by chemical pesticides have attracted widespread attention. Disease-resistant breeding is one of the most economical and effective measures for controlling wheat stripe rust. However, the discovery of disease-resistant genes is time-consuming, the cultivation of resistant varieties is difficult, and the stripe rust fungus exhibits rapid virulence variation, making it difficult to achieve sustained control of the disease. Therefore, creating broad-spectrum, long-lasting disease-resistant materials is the fundamental approach and key technology for controlling wheat stripe rust. CRISPR / Cas9, as a highly efficient and precise gene-editing technology, is widely used in the creation of gene-edited plants. This system consists of Cas9 nuclease and guide RNA (sgRNA), with sgRNA guiding the Cas9 protein to target and cut specific DNA sequences. For gene-edited plants constructed using CRISPR / Cas9, the Bar gene is often used as a selection marker gene for identifying positive plants. How to screen for and obtain disease-resistant genes and create stripe rust-resistant wheat varieties using CRISPR / Cas9 technology is of great significance for the control of wheat stripe rust. Summary of the Invention

[0005] The purpose of this invention is to address the challenges of reproductive isolation and incompatibility in distant hybridization in traditional disease-resistant breeding, which makes it difficult to achieve targeted improvement of the target trait within a short breeding cycle. At the same time, the rapid virulence variation of stripe rust fungi makes long-term control of wheat stripe rust still a significant challenge under current technological conditions.

[0006] To address this need in the field, this invention provides a wheat receptor protein kinase TaFER-NW and its applications. The invention aims to further explore the innate immune defense mechanism of wheat, identify disease-resistant genes that play a negative regulatory role in the defense response against wheat stripe rust, and provide a new pathway for creating wheat-resistant materials to control wheat stripe rust through gene function research.

[0007] On one hand, the present invention relates to a wheat receptor protein kinase TaFER-NW, the amino acid sequence of which is shown in SEQ ID NO:1; and the encoding ORF sequence of which is shown in SEQ ID NO:2.

[0008] On the other hand, the present invention relates to the application of wheat receptor protein kinase TaFER-NW in the breeding of wheat varieties resistant to stripe rust.

[0009] Furthermore, in the application provided by the present invention, the ORF sequence encoding the wheat receptor protein kinase TaFER-NW is expressed through Agrobacterium-mediated genetic transformation and has a negative regulatory effect in the interaction between wheat and stripe rust fungus. Overexpression of the ORF sequence encoding the wheat receptor protein kinase TaFER-NW can enhance the resistance of wheat to stripe rust pathogen.

[0010] Compared with the prior art, the beneficial effects or advantages of the present invention are as follows:

[0011] (1) Compared with traditional disease-resistant breeding techniques, plant disease-resistant genetic engineering technology can overcome reproductive isolation and incompatibility between species, achieving targeted improvement of target traits in a shorter time and providing crops with more comprehensive, continuous, and broad-spectrum protection. This invention, through gene function research, discovered that wheat receptor protein kinase TaFER-NW plays a negative regulatory role in the defense response against stripe rust in wheat; that is, overexpression of the ORF sequence encoding wheat receptor protein kinase TaFER-NW can enhance wheat's resistance to stripe rust. When the ORF sequence encoding wheat receptor protein kinase TaFER-NW is overexpressed in plants, it can confer certain disease resistance to the plant.

[0012] (2) This invention provides a method for breeding wheat varieties resistant to stripe rust. This method utilizes genetic engineering technology to overexpress the wheat receptor-like protein kinase TaFER-NW in wheat plants, thereby enhancing wheat's resistance to stripe rust pathogens. Verification has shown that the transgenic wheat obtained using this method exhibits resistance to the main prevalent races of stripe rust. This invention provides a new technical approach for breeding wheat varieties resistant to stripe rust from a molecular biology perspective, effectively solving the technical problems of this invention. Attached Figure Description

[0013] Figure 1 This is a schematic diagram of the expression profile analysis of the wheat receptor protein kinase TaFER-NW gene.

[0014] Figure 2 This is a schematic diagram showing the phenotypic results of wheat receptor protein kinase TaFER-NW gene editing followed by inoculation with CYR31. TaFER-NW-KO represents TaFER-NW gene-edited plants inoculated with stripe rust fungus CYR31. Fielder is a wild-type wheat variety, and CYR31 is a stripe rust fungus line that interacts with Fielder.

[0015] Figure 3 To obtain a diagram of the wheat receptor protein kinase TaFER-NW gene editing vector.

[0016] Figure 4 This is a schematic diagram of the PCR detection results of wheat receptor protein kinase TaFER-NW gene-edited plants.

[0017] Figure 5 This is a schematic diagram of the detection results for the wheat receptor protein kinase TaFER-NW gene editing. Detailed Implementation

[0018] The technical solution of the present invention will be described below with reference to the embodiments. However, the present invention is not limited to the following embodiments.

[0019] To enable those skilled in the art to better understand and implement the technical solutions of the present invention, the present invention will be further described below in conjunction with specific embodiments and accompanying drawings. However, the embodiments described are not intended to limit the present invention.

[0020] Unless otherwise specified, the experimental and detection methods described in the following embodiments are conventional methods; unless otherwise specified, the reagents and materials are commercially available.

[0021] Example

[0022] This invention provides the application of wheat receptor protein kinase TaFER-NW in the improvement of wheat rust-resistant varieties.

[0023] By using plant gene editing technology, the wheat receptor protein kinase TaFER-NW gene was transformed into wheat cells, resulting in a wheat variety with gene-edited TaFER-NW protein kinase.

[0024] The application of wheat receptor protein kinase TaFER-NW provided in this invention for breeding and improving wheat rust-resistant varieties also includes: constructing an editing vector containing the wheat receptor protein kinase TaFER-NW gene; and transforming wheat embryos using Agrobacterium-mediated genetic transformation to obtain wheat with TaFER-NW gene editing.

[0025] like Figure 1 As shown, the verification method for the application of wheat receptor protein kinase TaFER-NW in breeding and improving wheat rust-resistant varieties provided in this embodiment of the invention includes:

[0026] S101, Obtain TaFER-NW gene-edited wheat, and perform molecular detection on the obtained TaFER-NW gene-edited wheat;

[0027] S102, T1 generation gene-edited plants were inoculated with the prevalent stripe rust race CYR31, and the resistance of the gene-edited plants to the prevalent stripe rust race was identified.

[0028] The functional identification method provided in this embodiment of the invention includes:

[0029] Based on qRT-PCR using the elongation factor gene TaEF as an internal control, real-time quantitative PCR was performed using specific primers for the protein kinase gene TaFER-NW to determine the expression level of the TaFER-NW gene at different infection times in wheat infected with stripe rust fungus. qRT-PCR was used to detect the induced expression of the TaFER-NW gene in wild-type wheat Fielder inoculated with stripe rust fungus CYR23 (incompatible) and CYR31 (compatible) at different time points (1 h, 12 h, 24 h, 48 h, 72 h, 96 h, and 120 h after infection). The experimental results are as follows: Figure 1 As shown.

[0030] The TaFER-NW gene was edited using CRISPR / Cas9 gene editing technology. Phenotypic results were observed 14 days after wheat was inoculated with wheat stripe rust fungus CYR23 at the two-leaf stage to identify disease resistance. The experimental results are as follows: Figure 2 As shown.

[0031] The encoding ORF sequence of the wheat receptor protein kinase TaFER-NW of the present invention is SEQ ID NO:2.

[0032] The amino acid sequence of the wheat receptor protein kinase TaFER-NW of the present invention is SEQ ID NO:1.

[0033] The plant species used in this invention are preferably monocotyledonous cereal crops that can be successfully infected by wheat stripe rust fungus, with wheat being a particularly preferred species.

[0034] The application of wheat receptor protein kinase TaFER-NW in the improvement of wheat rust-resistant varieties, as provided in this embodiment of the invention, includes the following steps:

[0035] The TaFER-NW gene-edited plants, when inoculated with the compatible strain CYR31, showed a significant decrease in wheat disease resistance, indicating that TaFER-NW plays a negative regulatory role in the interaction between wheat and stripe rust fungus.

[0036] TaFER-NW gene-edited plants were created using Agrobacterium-mediated genetic transformation. Phenotypic identification of these plants after inoculation with CYR31 revealed enhanced resistance to the stripe rust fungus CYR31. The gene-editing vector map is shown below. Figure 3 As shown. Target1 and Target2 are the two target sgRNAs of the TaFER-NW gene; TaU6 is the promoter that initiates Target1 and Target2; Cas9 is the core element of the gene editing system that encodes the Cas9 protein; ZmUbi is the maize ubiquitin promoter that initiates Cas9 expression.

[0037] TaFER-NW-cDNA-F:ATGGTGCTCCCAACCTTACCG;

[0038] TaFER-NW-cDNA-R:AAATGTATGTCTACCTTTCACTC.

[0039] This invention provides the application of the wheat receptor protein kinase TaFER-NW in the improvement of wheat rust-resistant varieties. Firstly, to clarify the function of TaFER-NW in the interaction between wheat and stripe rust fungus, expression profiling of TaFER-NW was performed at different stages in both affinity and incompatible systems of wheat infected with stripe rust fungus. The results showed that the expression level of TaFER-NW was downregulated 24 hours after stripe rust infection in the incompatible system, indicating that TaFER-NW may negatively regulate wheat resistance to stripe rust fungus.

[0040] Internal reference primer:

[0041] TaEF-F:TGGTGTCATCAAGCCTGGTATGGT;

[0042] TaEF-R:ACTCATGGTGCATCTCAACGGACT.

[0043] Gene editing target design:

[0044] Target1:

[0045] TaFER-NW-Target1-F: ACTCGACGGAGGAATCGGTAGAC; TaFER-NW-Target1-R: AAACGTCTACCGATTCCTCCGCTC.

[0046] Target2:

[0047] TaFER-NW-Target1-F: ACTCGTATACGAATTTATGCCCCG;

[0048] TaFER-NW-Target1-R:AAACCGGGGCATAAATTCGTATAC.

[0049] Primers for detecting transgenic positive plants:

[0050] Blp-F:GCAAGACCCTTCCTCTATAAGG;

[0051] Blp-R:TCAGATCTCGGTGACGGGCAGGACC.

[0052] Figure 4 This is a schematic diagram of PCR detection results for wheat receptor protein kinase TaFER-NW gene-edited plants. Transgenic positive plants were detected using Blp-F / R primers, and PCR products were detected by 1% agarose gel electrophoresis. Figure 5 This is a schematic diagram showing the detection results of wheat receptor protein kinase TaFER-NW gene editing. The TaFER-NW gene sequence was amplified by PCR in Fielder and TaFER-NW gene-edited materials, and then compared after sequencing.

[0053] In summary, the application of wheat receptor protein kinase TaFER-NW in the improvement of wheat rust-resistant varieties provided in this embodiment of the invention utilizes gene editing technology to construct a gene editing vector for the TaFER-NW gene. This gene editing vector is then delivered to the recipient wheat Fielder through Agrobacterium-mediated wheat genetic transformation. The resulting transformed plants were tested for positive plants by PCR and gene editing type detection, revealing a single-base insertion mutant, TaFER-NW-KO. Three lines (L1, L2, and L3) from the T1 generation were inoculated with the prevalent race CYR31. After 14 days, observation showed that the TaFER-NW gene-edited plants exhibited reduced sporulation compared to Fielder plants, demonstrating enhanced resistance.

[0054] As described above, the present invention can be well implemented. The above embodiments are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, all kinds of changes and improvements made by those skilled in the art to the technical solutions of the present invention should fall within the protection scope defined by the present invention.

Claims

1. Application of wheat receptor protein kinase TaFER-NW in breeding of wheat stripe rust resistant varieties, characterized in that, The amino acid sequence of the wheat receptor protein kinase TaFER-NW is shown as SEQ ID NO: 1; the coding ORF sequence of the wheat receptor protein kinase TaFER-NW is shown as SEQ ID NO: 2; The coding ORF sequence of the wheat receptor protein kinase TaFER-NW is expressed by Agrobacterium-mediated genetic transformation, has a negative regulation effect in the interaction of wheat and Puccinia striiformis, and the use of Crispr / Cas9 gene editing technology to edit the coding ORF sequence of the wheat receptor protein kinase TaFER-NW can enhance the resistance of wheat to Puccinia striiformis.

Images